MiRNA marker and kit for diagnosing and evaluating myocardial aging and application of miRNA marker and kit

Abstract

The invention discloses an application of a substance for detecting a miRNA marker. The application comprises one or more of the following applications: A1) an application in preparation of a product for diagnosing myocardial aging; a2) in preparation of products for screening myocardial aging; a3) in preparation of a product for treating myocardial aging; a4) in preparation of a myocardial aging prognosis evaluation product; a5) in preparation of products for identifying and distinguishing myocardial aging and other diseases; the miRNA marker is hsa-miR-186-5p, and the nucleotide sequence of the miRNA marker is as shown in SEQ ID No. 1. The expression quantity of the hsa-miR-186-5p marker provided by the invention in the plasma of a myocardial aging patient is obviously increased compared with that of a healthy control person, so that the hsa-miR-186-5p is indicated to be a potential myocardial aging biomarker. The ROC curve of the efficacy of the hsa-miR-186-5p in the aspect of diagnosing myocardial aging patients shows that the hsa-miR-186-5p has good diagnosis efficacy.

Description

Technical Field

[0001] The present invention relates to a marker for diagnosing myocardial aging, specifically a miRNA marker, and also relates to a kit for detecting the miRNA marker and its application, belonging to the field of medical molecular diagnosis. Background Art

[0002] Aging is a continuous process that accompanies an individual throughout their life. Different from diseases, it affects everyone. Although aging is determined by genetic programs, environmental factors have a significant impact on it, resulting in great differences in the aging speed of individuals. Therefore, an individual's physiological aging may be faster or slower than their actual age. With age, physiological aging causes the functions of multiple organ systems to gradually decline. At the same time, the incidence of cardiovascular diseases (CAD), including cardiomyopathy and coronary artery disease, also increases. In the era of population aging, how to improve the diagnosis and treatment ability of myocardial aging-related diseases has become an important research direction, which requires in-depth study of the key etiological factors and molecular biological reasons of myocardial aging.

[0003] Aging can lead to an increase in the thickness of the left ventricular (LV) wall and a decrease in diastolic function. These pathological changes are considered endogenous cardiac aging and are not related to traditional risk factors for cardiovascular diseases such as smoking, hypertension, blood lipid levels, and diabetes. To compensate for the reduced LV filling due to the increased LV wall thickness, with age, atrial contraction and atrial pressure gradually increase, which can promote atrial hypertrophy and increase the incidence of atrial fibrillation. Impaired early diastolic filling and increased atrial contraction will gradually lead to diastolic dysfunction, which is very common in the elderly population. However, early diastolic dysfunction cannot be fully detected by existing instruments. Therefore, a new diagnostic method is needed to identify the pathophysiological changes caused by myocardial aging.

[0004] MicroRNA (miRNA) is a highly conserved and regulatory small ribonucleic acid, with a length of approximately 22 nucleotides. By binding to messenger RNA (mRNA), miRNA can inhibit the translation process. Due to the short seed sequence of miRNA (about 6 nt), some miRNAs have been speculated and experimentally proven to regulate signaling pathways and their downstream targets. Due to its multifunctionality, miRNA dysregulation is associated with various diseases, including cancer and cardiovascular diseases. A large number of studies have confirmed the importance of miRNA regulation and are exploring therapeutic silencing. However, since miRNA is widely distributed in the body (such as in the blood circulation), and one miRNA may have multiple target mRNAs, it is still difficult to precisely elucidate the specific mechanism of each miRNA. There is an urgent need to apply miRNA to clinical diagnosis and treatment, especially when considering miRNA as a potential therapeutic target. There are few reports on miRNA as a diagnostic and therapeutic target for myocardial aging. In-depth research in this direction will be of great significance for the clinical diagnosis and treatment of myocardial aging. Summary of the Invention

[0005] The primary technical problem to be solved by the present invention is to provide an application of a new miRNA biomarker. This miRNA biomarker can not only be used to prepare substances for diagnosing, screening, assessing the condition, and differentiating myocardial aging from other heart diseases, but also become a new target for treating diseases related to myocardial aging.

[0006] Another technical problem to be solved by the present invention is to provide a kit for detecting this miRNA biomarker. This kit can be used for diagnosing, screening, evaluating, and differentiating myocardial aging from other heart diseases.

[0007] The third technical problem to be solved by the present invention is to provide a primer for detecting this miRNA biomarker. This primer can be used for diagnosing, screening, evaluating, and differentiating myocardial aging from other heart diseases.

[0008] To achieve the above technical objectives, the present invention adopts the following technical solutions:

[0009] According to the first aspect of the embodiments of the present invention, there is provided an application of a substance for detecting an miRNA biomarker, including one or more of the following applications:

[0010] A1) Application in preparing a product for diagnosing myocardial aging;

[0011] A2) Application in preparing a product for screening myocardial aging;

[0012] A3) Application in preparing a product for treating myocardial aging;

[0013] A4) Use in the preparation of products for evaluating the prognosis of myocardial senescence;

[0014] A5) Use in the preparation of products for differentiating myocardial senescence from other diseases;

[0015] The miRNA marker is hsa-miR-186-5p, and its nucleotide sequence is as shown in SEQ ID No.1.

[0016] The "product" described above can be a product for diagnosing myocardial senescence by detecting the expression level of hsa-miR-186-5p through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platform.

[0017] In the above applications, the expression of hsa-miR-186-5p is significantly up-regulated in the plasma samples of patients with myocardial senescence; the expression level of hsa-miR-186-5p in healthy people is significantly lower than that in patients with myocardial senescence.

[0018] Preferably, the substance is a reagent for detecting the expression level of hsa-miR-186-5p, or a reagent for specifically recognizing hsa-miR-186-5p, or a reagent for detecting the content of hsa-miR-186-5p.

[0019] Preferably, the substance is a substance for detecting hsa-miR-186-5p, specifically a), b) or c) below

[0020] a) Primers for detecting or specifically recognizing hsa-miR-186-5p;

[0021] b) A reagent set containing the a);

[0022] c) A kit containing the a) or the b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0024] According to the second aspect of the embodiments of the present invention, a kit for detecting miRNA markers is provided, and the kit includes one or more of the following applications:

[0025] A1) Use in the preparation of products for diagnosing myocardial senescence;

[0026] A2) Use in the preparation of products for screening myocardial senescence;

[0027] A3) Use in the preparation of products for treating myocardial senescence;

[0028] A4) Use in the preparation of products for evaluating the prognosis of myocardial senescence;

[0029] A5) Use in the preparation of products for differentiating myocardial senescence from other diseases;

[0030] The miRNA marker is hsa-miR-186-5p, and its nucleotide sequence is as shown in SEQ ID No.1; the kit includes reagents for detecting or specifically recognizing hsa-miR-186-5p, or reagents for detecting the expression level of hsa-miR-186-5p.

[0031] Using the kit provided by the present invention, the expression of the hsa-miR-186-5p characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected, and then the probability of myocardial senescence of the subject can be determined according to the information of up-regulation or down-regulation of these gene expressions, so as to realize the diagnosis of myocardial senescence.

[0032] The kit provided by the present invention may include appropriate packaging and instructions for use in the methods disclosed in the present invention. Preferably, the detection kit provided by the present invention is a nucleic acid detection kit, including reagents required for RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases, and may also include control primers and / or probes.

[0033] Preferably, the reagent for detecting or specifically recognizing hsa-miR-186-5p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0034] According to the third aspect of the embodiments of the present invention, a primer for detecting miRNA markers is provided, and the primer includes one or more of the following applications:

[0035] A1) Use in the preparation of products for diagnosing myocardial senescence;

[0036] A2) Use in the preparation of products for screening myocardial senescence;

[0037] A3) Use in the preparation of products for treating myocardial senescence;

[0038] A4) Use in the preparation of products for evaluating the condition of myocardial senescence;

[0039] A5) Use in the preparation of products for differentiating myocardial senescence from other diseases;

[0040] The primer is a primer for detecting the expression level of hsa-miR-186-5p or specifically recognizing hsa-miR-186-5p.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The miRNA hsa-miR-186-5p provided by the present invention can be used as a new biomarker for the diagnosis of myocardial senescence. The expression level of hsa-miR-186-5p in the plasma of patients with myocardial senescence is significantly higher than that in the plasma of healthy controls, indicating that hsa-miR-186-5p is a potential biomarker for myocardial senescence and can be used for the application of diagnosis, screening, evaluation, and / or differentiation of myocardial senescence from other diseases.

[0044] (2) The ROC curve of the efficacy of hsa-miR-186-5p in diagnosing patients with myocardial senescence shows that hsa-miR-186-5p has good sensitivity and specificity and good diagnostic efficacy.

[0045] (3) In clinical experiments, it can be seen from the relationship between human plasma BNP and the expression level of hsa-miR-186-5p that BNP is positively correlated with the expression of hsa-miR-186-5p; BNP is a peptide hormone synthesized by the heart when the ventricular wall is dilated or stretched, which can reflect the compensatory function of the heart and is a biomarker for evaluating cardiac function, mainly used for the diagnosis of heart failure. The level of hsa-miR-186-5p in plasma is positively correlated with the BNP level. These results indicate that the level of hsa-miR-186-5p in plasma can reflect the severity of myocardial senescence, suggesting that hsa-miR-186-5p can be used to prepare products for evaluating the condition of myocardial senescence.

[0046] (4) There is a good correlation between the senescence marker galactosidase of cardiomyocytes and the expression level of hsa-miR-186-5p, and the two are positively correlated, indicating that the relationship between hsa-miR-186-5p and cell senescence is conclusive and has good diagnostic efficacy.

[0047] (5) In in vitro cytological verification experiments, the expression level of hsa-miR-186-5p in AC16 cells treated with D-gal was increased compared with that of the normal control; indicating that when cardiomyocytes aged, the level of hsa-miR-186-5p increased, which was the cyto-molecular basis for hsa-miR-186-5p as a biomarker for the diagnosis of myocardial senescence. This experiment further verified the relationship between hsa-miR-186-5p and myocardial senescence. After knocking down hsa-miR-186-5p in the D-gal-induced cell senescence model, the senescence situation was alleviated, which also proved that hsa-miR-186-5p was expected to become a new biomarker for the diagnosis of myocardial senescence and a therapeutic target. Description of the Drawings

[0048] Figure 1 It is a heat map of the differential miRNA expression between senescent cardiomyocytes obtained by sequencing and normal controls;

[0049] Figure 2 It is to measure the content of hsa-miR-186-5p in the plasma of patients with myocardial senescence and normal controls by qRT-PCR;

[0050] Figure 3 It is the ROC curve of hsa-miR-186-5p for diagnosing patients with myocardial senescence;

[0051] Figure 4 It is to measure the content of hsa-miR-186-5p in the plasma of patients with myocardial senescence and normal controls in the external validation population again by qRT-PCR;

[0052] Figure 5 It is the ROC curve of hsa-miR-186-5p for diagnosing patients with myocardial senescence in the external validation population;

[0053] Figure 6 It is the relationship between human plasma BNP and the expression level of hsa-miR-186-5p;

[0054] Figure 7 It is the relationship between the positive ratio of the senescence marker galactosidase and the expression level of hsa-miR-186-5p in cardiomyocytes induced by D-gal;

[0055] Figure 8A It is the expression level map of hsa-miR-186-5p after transfecting cardiomyocytes with hsa-miR-186-5p small interfering RNA;

[0056] Figure 8B It is the expression level map of mRNA after transfecting cardiomyocytes with hsa-miR-186-5p small interfering RNA;

[0057] Figure 9A The expression of P21 mRNA in cardiomyocytes induced by D-gal after knocking down hsa-miR-186-5p with siRNA;

[0058] Figure 9B The expression of IL-1β mRNA in cardiomyocytes induced by D-gal after knocking down hsa-miR-186-5p with siRNA;

[0059] Figure 10 The expression of BNP in the supernatant of cardiomyocytes after knocking down hsa-miR-186-5p and in the control group of cardiomyocytes after treatment with D-gal;

[0060] Figure 11A The figure of the cell cycle of cardiomyocytes induced by the inducer D-gal detected by flow cytometry;

[0061] Figure 11B The figure of the cell cycle of cardiomyocytes induced by the inducer D-gal after knocking down hsa-miR-186-5p in cardiomyocytes detected by flow cytometry. Detailed implementation manners

[0062] The technical content of the present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. These embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the methods provided by the present invention. The preferred implementation methods and materials described herein are only for demonstration purposes.

[0063] The R & D process and idea of the present invention: First, total RNA was extracted from 3 cases of naturally aged cardiomyocytes (AC 16) and 3 cases of normal control cells and sent to Guangzhou Epigenetics Biotechnology Co., Ltd. for miRNA sequencing to screen miRNAs with significantly different expression levels (Fold change ≥ 2.0, P value < 0.05). Then, the contents of the top 10 miRNAs in the plasma of patients were measured by qRT-PCR, and the first one with a significant increase was selected for subsequent experiments. Then, the inventors further verified the relationship between the expression level of hsa-miR-186-5p and myocardial aging at the cell level in vitro. The specific data are as follows: Example 1: Screening and correlation study of old miRNA markers in myocardial failure Screening and correlation study of old miRNA markers

[0064] 1. Clinical samples:

[0065] Collect venous blood at admission from 50 patients aged 60 - 90 years who were hospitalized at the Chinese PLA General Hospital from 2020 to 2023 and had other heart diseases excluded. At the same time, collect venous blood from 50 healthy physical examination subjects aged ≤30 years. Divide them into a control group and an aging group for subsequent determination of miRNA levels in plasma.

[0066] For the external validation population, select inpatients at Fuwai Hospital, Chinese Academy of Medical Sciences from 2022 to 2023 who had other heart diseases excluded. A total of 52 inpatients aged 60 - 90 years were included, and at the same time, 44 healthy physical examination subjects aged ≤30 years were included. Collect venous blood at admission and divide them into a control group and an aging group. Record the clinical data of all subjects.

[0067] Inclusion criteria:

[0068] (1) Inpatients aged 60 years ≤ age < 90 years;

[0069] (2) Healthy physical examination subjects aged ≤30 years;

[0070] (3) Have complete blood sample data.

[0071] Exclusion criteria: Malignant tumors, severe hepatic and renal insufficiency, severe autoimmune diseases, severe hematological diseases, or other cardiovascular diseases such as coronary heart disease, valvular heart disease, cardiomyopathy, and peripheral vascular diseases, etc.

[0072] 2. Plasma extraction:

[0073] Collect human peripheral blood using an EDTA anticoagulant blood collection tube, centrifuge at 2500g for 15 minutes, take the upper plasma into a 2ml sterile tube, and store it frozen in an -80°C refrigerator.

[0074] 3. RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR):

[0075] Use the RNA simple Total RNA Kit (DP419, TIANGEN, Beijing, China) to extract total RNA from AC16.

[0076] 3.1 RNA extraction

[0077] Plasma samples were used to extract tissue RNA according to the instructions of TRIZOL Reagent (Invitrogen). Add 1 ml of TRIZOL Reagent (Invitrogen) to the plasma and add 200 μL of chloroform, shake for 20 s, and let stand at room temperature for 10 min: centrifuge at 13,000 rpm at 4 °C for 15 min. Carefully aspirate the supernatant, add 800 μL of isopropanol, gently mix by inverting up and down, let stand at -20 °C for 1 h, centrifuge at 13,000 rpm at 4 °C for 15 min, and discard the supernatant. Add 1 ml of 75% ethanol, gently wash the precipitate, centrifuge at 13,000 rpm at 4 °C for 5 min, then remove the supernatant and air-dry. Add an appropriate amount of enzyme-free water, dissolve at 65 °C for 10 min, and detect the OD value and concentration of RNA, and store at -80 °C for later use.

[0078] 3.2 Reverse transcription of RNA to synthesize cDNA

[0079] Using a reverse transcription kit (Takara RR037A), 500 ng of RNA was reverse transcribed into cDNA.

[0080] 3.3 Reverse transcription of miRNA:

[0081] Perform the operation on ice, and each reaction system is 20 μL, as shown in the following table:

[0082] Table 1

[0083]

[0084] 3.4 Reverse transcription of mRNA:

[0085] Perform the operation on ice, and each reaction system is 20 μL, as shown in the following table:

[0086] Table 2

[0087]

[0088] The reaction program is: 37 °C for 45 min, 85 °C for 5 min, and maintain at 4 °C.

[0089] 3.5 qRT-PCR

[0090] Design the primer sequences of miRNAs according to the miRNA primer design principle.

[0091] Dilute the cDNA obtained from the reverse transcription reaction at a ratio of 1:10 and perform the following qRT-PCR reaction:

[0092] Perform the operation on ice, and each reaction system is 20 μL, as shown in the following table:

[0093] Table 3

[0094]

[0095] Mix the reaction solution. The reaction program of the Real-time PCR instrument is as follows:

[0096] Stage 1: 95°C for 2 min;

[0097] Stage 2: Cycle 35, 94°C for 5 s, 60°C for 1 min;

[0098] Stage 3: 95°C for 15 s, 60°C for 1 min, 95°C for 5 s;

[0099] Quantify the relative levels of each mRNA using GAPDH and express them as relative ratios.

[0100] 4. miRNA sequencing analysis:

[0101] Select 3 cases of naturally aged AC16 cardiomyocytes and 3 cases of normal control cells. After extracting total RNA, send them to Guangzhou Epigenetics Biotechnology Co., Ltd. for miRNA sequencing. Screen miRNAs with significant differences in expression levels (Fold change ≥ 2.0, P value < 0.05), and then use qRT-PCR to measure the content of the top 10 miRNAs in the plasma of patients. Select the biomarker with the highest expression level for the following experiments.

[0102] The results are as Figure 1 shown in Table 4. Figure 1 Figure [ID] is a heat map of the differential expression of miRNAs in senescent cardiomyocytes and normal controls obtained by sequencing. Table 4 records the top 10 up-regulated miRNAs obtained from the sequencing data.

[0103] Table 4 The top 10 up-regulated miRNAs obtained from the sequencing data

[0104]

[0105] 5. ROC curve plotting:

[0106] The receiver operator characteristic (ROC) curve is a curve obtained by plotting the true positive rate and the false positive rate, which can be used to reflect the relationship between sensitivity and specificity. It takes sensitivity as the ordinate and 1 - specificity as the abscissa. According to the measured values of the experimental group and the control group, a series of cut-off values are divided, and the sensitivity and specificity are calculated respectively. Connect the given points to form a line, and this curve is the ROC curve. Use GraphPad Prism software to plot the ROC curve. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.

[0107] 6. Statistical analysis:

[0108] For normal variables, t-tests and analysis of variance were used, while for non-normal variables, Mann-Whitney U tests and Kruskal Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (v 8.00). Biological replicates were shown as individual data points superimposed on bar graphs. A P < 0.05 was considered to indicate a significant difference.

[0109] 7. Experimental results:

[0110] As Figure 2 shown, the content of hsa-miR-186-5p in the plasma of patients with myocardial senescence was measured by qRT-PCR. The results showed that the expression of hsa-miR-186-5p in the plasma of patients with myocardial senescence was significantly higher than that in the plasma of healthy controls, indicating that hsa-miR-186-5p is a potential biomarker for myocardial senescence.

[0111] As Figure 3 shown, the ROC curve of the efficacy of hsa-miR-186-5p in diagnosing patients with myocardial senescence had good specificity and sensitivity, indicating that hsa-miR-186-5p had good diagnostic efficacy.

[0112] As Figure 4 shown, after selecting the external validation population, the content of hsa-miR-186-5p in the plasma of patients with myocardial senescence was measured by qRT-PCR. The results showed that the expression of hsa-miR-186-5p in the plasma of patients with myocardial senescence was significantly higher than that in the plasma of healthy controls, verifying the reliability of hsa-miR-186-5p as a biomarker for myocardial senescence.

[0113] As Figure 5 shown, the ROC curve of the efficacy of hsa-miR-186-5p in diagnosing patients with myocardial senescence in the external validation set had good specificity and sensitivity, indicating that hsa-miR-186-5p also had good diagnostic efficacy in the external validation set.

[0114] Example 2: Experiment on the relationship between BNP and the expression level of hsa-miR-186-5p

[0115] 1. Experimental purpose:

[0116] Brain natriuretic peptide (BNP) and N-terminal pro-brain natriuretic peptide (in patients above the median level) are biomarkers of cardiac function and are also the first-choice biomarkers for the diagnosis and differential diagnosis of heart failure, as well as for the assessment of disease severity and prognosis. In healthy adults, the normal value of BNP should be < 100 ng / L. As age increases and cardiac function declines, BNP will gradually increase. Generally, when it is greater than 100 ng / L, it is considered abnormal. The diagnostic criteria are based on the 2004 American College of Cardiology (ACC) expert consensus: If BNP < 100 ng / L, the likelihood of heart failure is extremely low, and its negative predictive value is 90%. If BNP > 500 ng / L, the likelihood of heart failure is extremely high, and its positive predictive value is 90%. The normal value of BNP should be < 100 ng / L, and within the normal range of BNP, acute heart failure can be excluded.

[0117] BNP in the heart mainly exists in the left and right atria. The content in the right atrium is more than three times that in the left atrium. The content of BNP in the ventricle is low because the BNP precursor is not stored in the ventricle. Only when the ventricular wall tension increases can it rapidly stimulate the high expression of the BNP gene, synthesize and secrete a large amount into the blood. In other words, the increase in BNP in the plasma means that due to the impairment of the systolic or diastolic function of the heart, the venous return blood volume cannot be fully discharged from the heart, and it is produced when the ventricle is stretched, and its increase has a dynamic change rule.

[0118] Myocardial aging is a process in which the heart muscle gradually loses its function and efficiency as age increases. This process may lead to weakened cardiac pumping function and poor blood circulation, thus increasing the release of BNP. Therefore, the level of BNP can be an important indicator for assessing myocardial aging and the risk of heart failure.

[0119] 2. Experimental methods:

[0120] BNP determination: Let the whole blood in the blood collection tube stand at room temperature for more than half an hour. Turn on the centrifuge and centrifuge at 3500 - 4000 rpm for 5 - 10 minutes. Plasma is separated. Use the BNP / NT-proBNP ELISA kit (ZC-34225) from Zhuocai Biotechnology to measure the plasma or cell supernatant. First, add 100 μL of the sample to each well. Equilibrate the kit at room temperature for 30 min. Then take out the required strip from the aluminum foil bag and seal the remaining strips with a self-sealing bag and return them to 4°C. Add 50 μL of standards with different concentrations to the standard wells. Add 50 μL of the sample to be tested to the sample wells; do not add to the blank wells. Except for the blank wells, add 100 μL of the detection antibody labeled with horseradish peroxidase (conjugated) to each well in the standard wells and sample wells. Seal the reaction wells with a sealing film and incubate in a 37°C water bath or incubator for 60 minutes. Discard the liquid, pat dry on absorbent paper. Fill each well with washing solution (350 μL), let stand for 1 minute, discard the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (or use a plate washer). Add 50 μL of substrate A and B to each well and incubate at 37°C in the dark for 15 minutes. Add 50 μL of the stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 minutes.

[0121] 3. Experimental results:

[0122] As Figure 6 shown, it is the relationship between the expression levels of human plasma BNP and hsa-miR-186-5p; it can be seen from the figure that the expression of BNP is positively correlated with that of hsa-miR-186-5p; BNP is a marker protein for heart failure, and hsa-miR-186-5p is positively correlated with the BNP level. These results indicate that the level of hsa-miR-186-5p in plasma can reflect the severity of the disease.

[0123] Example 3: Verification of the relationship between hsa-miR-186-5p and myocardial senescence by galactosidase staining experiment

[0124] 1. Experimental purpose:

[0125] Normal cells stop dividing after a limited number of divisions, showing irreversible growth arrest. At this time, the cells enter the senescent state, and the senescence-related galactosidase is in an activated state. Galactosidase is a hydrolase in the cell lysosome, but its activity is up-regulated in senescent cells. Based on this phenomenon and principle, using galactoside as the substrate, the senescence cell-specific galactosidase catalyzes the substrate to generate a blue product, manifested as blue deposits in the cell cytoplasm, and it is very easy to observe the cells or tissues expressing galactosidase that turn blue under an optical microscope. The galactosidase staining experiment is the gold standard for judging whether cells are senescent in cell molecular experiments.

[0126] 2. Cell culture:

[0127] The human cardiomyocyte cell line (AC16) was purchased from Wuhan Pure Science. The cells were cultured in RPMI-1640 medium + 10% fetal bovine plasma and incubated in an incubator at 37°C with 5% carbon dioxide.

[0128] 3. Cell senescence induction treatment:

[0129] The cultured AC16 cardiomyocytes were exposed to 10 mM D-gal for cell senescence induction treatment. D-galactose (D-gal) is a well-established senescence model inducer, a more potent glycating agent than glucose, and can induce oxidative stress. The D-gal concentration can induce cytotoxicity and senescence-like changes, causing an increase in the level of BNP secreted by AC16 cells. Further analysis was performed after 24 hours of treatment.

[0130] 4. β-galactosidase staining:

[0131] Staining was performed using the Beyotime β-galactosidase staining kit (C0602). For the cells cultured in a 6-well plate, the cell culture medium was aspirated, the cells were washed once with PBS, and 1 mL of β-galactosidase staining fixation solution was added and fixed at room temperature for 15 minutes. The cell fixation solution was aspirated, the cells were washed 3 times with PBS, 3 minutes each time. The PBS was aspirated, and 1 mL of staining working solution was added to each well. The preparation method of the staining working solution is as follows: 10 μL of β-galactosidase staining solution a, 10 μL of β-galactosidase staining solution b, 930 μL of β-galactosidase staining solution c, 50 μL of X-Gal solution, incubated overnight at 37°C, and the 6-well plate was sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be carried out in a carbon dioxide incubator. Observation was performed under an ordinary optical microscope.

[0132] 5. Statistical analysis:

[0133] The cells stained blue observed under an optical microscope were used as positive cells. The number of positive cells per 100 cells was randomly counted in the field of view, and the proportion of positive cells (%) was determined. The proportion of positive cells in each sample was analyzed for correlation with hsa-miR-186-5p.

[0134] 6. Experimental results:

[0135] As Figure 7 shown, there was a good correlation between the expression levels of the senescence marker β-galactosidase and hsa-miR-186-5p in cardiomyocytes, and the two were positively correlated, indicating that the relationship between hsa-miR-186-5p and cell senescence was conclusive and had good diagnostic efficacy.

[0136] Example 4: Further verification of the relationship between the expression level of hsa-miR-186-5p and myocardial senescence at the cellular level in vitro Relationship

[0137] 1. Cell culture:

[0138] The cell culture method was the same as that in Example 3.

[0139] Small interfering RNA (siRNA) knockdown method: The siRNA was ordered from Thermo Fisher. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was determined by qRT-PCR 24 h after induction.

[0140] 2. The cell senescence induction treatment was the same as that in Example 3.

[0141] 3. The method for measuring BNP in the supernatant of cardiomyocytes was the same as that in Example 3.

[0142] 4. The qRT-PCR method was the same as that in Example 1.

[0143] 5. Flow cytometry experiment:

[0144] Remove the culture medium and wash the cells once with PBS. Digest the cells with trypsin until the cells can be gently pipetted or aspirated with a pipette tip, then add the previously collected cell culture medium, pipette down all the adherent cells, and gently disperse the cells. Collect them into a centrifuge tube again. Centrifuge at about 1000 g for 3 - 5 minutes to precipitate the cells. For specific cells, if the cell precipitation is not sufficient, the centrifugation time can be appropriately extended or the centrifugal force can be slightly increased. Carefully aspirate the supernatant, leaving about 50 μL of the culture medium to avoid aspirating the cells. Add about 1 mL of ice-cold PBS, resuspend the cells, and transfer them to a 1.5 mL centrifuge tube. Centrifuge again to precipitate the cells, carefully aspirate the supernatant, leaving about 50 μL of PBS, add 1 mL of ice-cold 70% ethanol, gently pipette to mix well, and fix at 4 °C for 30 minutes. Centrifuge at about 1000 g for 5 minutes to precipitate the cells. Add about 1 mL of ice-cold PBS, resuspend the cells. Centrifuge again to precipitate the cells, carefully aspirate the supernatant, leaving about 50 μL of PBS to avoid aspirating the cells. Gently tap the bottom of the centrifuge tube to appropriately disperse the cells to avoid cell clumping. Add 0.5 mL of propidium iodide staining solution to each tube of cell sample, fully resuspend the cell pellet, incubate at 37 °C in the dark for 30 minutes. Then store in the dark at 4 °C. Detect the red fluorescence with a flow cytometer at an excitation wavelength of 488 nm, and simultaneously detect the light scattering.

[0145] 6. Experimental results:

[0146] Figure 8A It is a graph of the expression level of hsa-miR-186-5p after transfection of AC16 cardiomyocytes with siRNA. It can be seen from the graph that the expression level of hsa-miR-186-5p decreased after transfection. Figure 8BThis is a graph showing the mRNA expression levels. It can be seen that the total mRNA expression level remains unchanged after siRNA transfection of AC16 cardiomyocytes, indicating successful transfection and knockdown of hsa-miR-186-5p. Subsequent experiments were completed based on this.

[0147] Figure 9A and Figure 9B This is to detect the mRNA expression of two cell senescence markers in AC16 cardiomyocytes after transfection with siRNA. Figure 9A This is a graph showing the mRNA expression of the P21 cell senescence protein marker in AC16 cardiomyocytes. Figure 9B This is a graph showing the mRNA expression of the key marker IL-1β related to cell senescence secretion phenotype in AC16 cardiomyocytes. It can be seen that after knockdown of hsa-miR-186-5p, the mRNA expression levels of P21 and IL-1β decreased, indicating that knockdown of hsa-miR-186-5p can slow down cell senescence, and hsa-miR-186-5p may be a therapeutic target for myocardial senescence.

[0148] Figure 10 This is a graph showing the expression levels of hsa-miR-186-5p and BNP in the supernatant of cardiomyocytes after knockdown of hsa-miR-186-5p and in the control group of AC16 cardiomyocytes treated with D-gal. The results show that D-gal-induced senescence can cause a significant increase in BNP levels. The expression of hsa-miR-186-5p increases under D-gal-induced senescence, while the BNP expression level decreases after knockdown of hsa-miR-186-5p. This is the molecular basis for hsa-miR-186-5p as a treatment for cardiomyocyte senescence.

[0149] Figure 11A and Figure 11B This is to determine the cell cycle of AC16 cardiomyocytes after knockdown of hsa-miR-186-5p and normal AC16 cardiomyocytes induced by the senescence inducer D-gal using flow cytometry. Figure 11A As can be seen, when cells undergo senescence, the cell DNA loses its ability to divide, and the proportion of cells in the S phase (stagnant phase) increases, characterized by an increase in the proportion of cells in the S phase in the cell pictures. Figure 11B As can be seen, after knockdown of hsa-miR-186-5p, the proportion of cells in the G2 phase decreased compared to that of D-gal, decreasing to 12.5%. The cell experiment shows that after knockdown of hsa-miR-186-5p, the proportion of senescent cells induced by D-gal decreased, indicating that reducing hsa-miR-186-5p effectively antagonizes cell senescence. Thus, hsa-miR-186-5p may be a therapeutic target for myocardial senescence.

[0150] The above implementation results indicate that hsa-miR-186-5p has a significant correlation with myocardial senescence and is a new biological marker for myocardial senescence. The ROC curve shows that hsa-miR-186-5p has the ability to diagnose patients with myocardial senescence well; the expression of hsa-miR-186-5p is upregulated in cardiomyocytes treated with the senescence inducer D-gal; it indicates that hsa-miR-186-5p may be involved in the senescence induction of cardiomyocytes by D-gal. Flow cytometry was used to measure the cell cycle of cardiomyocytes with knocked-down hsa-miR-186-5p after being induced to senesce with the inducer D-gal, indicating that knocking down hsa-miR-186-5p can alleviate D-gal-induced cell senescence. In summary, when cells undergo senescence, hsa-miR-186-5p is expected to become a new diagnostic biomarker and therapeutic target for myocardial senescence.

[0151] Example 5: Sequences, primers and kit components involved in the present invention

[0152] The nucleotide sequence of the myocardial senescence marker hsa-miR-186-5p provided by the present invention is shown in SEQ ID No.1, source: miRBase database, number: MIMAT0000456.

[0153] SEQ ID No.1: CAAAGAATTCTCCTTTTGGGCT

[0154] The primer pair specifically recognizing hsa-miR-186-5p provided by the present invention includes the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3:

[0155] SEQ ID No.2: ATGCGCGCCAAAGAATTCTCC

[0156] SEQ ID No.3: GTCGTATCCAGTGCAGGGTCC

[0157] The composition of the kit provided by the present invention:

[0158] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primer, RNase-free pure water, SYBR probe II (Tli RNaseH Plus)(2x), PCR Primer (F+R)(10μM), ROX Reference Dye(50x).

Claims

1. An application of a substance for detecting miRNA markers, characterized in that Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging prognosis assessment products; A5) Application in the preparation of products for identification and differentiation of myocardial aging and other diseases; The miRNA marker is hsa-miR-186-5p, and the nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for diagnosing myocardial aging by detecting the expression level of hsa-miR-186-5p through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of hsa-miR-186-5p, or a reagent for specifically identifying hsa-miR-186-5p, or a reagent for detecting the content of hsa-miR-186-5p.

4. The use according to claim 1, characterized in that: The substance is a substance for detecting hsa-miR-186-5p, specifically the following a), b) or c) a) primers for detecting or specifically recognizing hsa-miR-186-5p; b) a reagent set containing the reagent described in a); c) A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

6. A kit for detecting miRNA markers, characterized in that The kit includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging prognosis assessment products; A5) Application in the preparation of products for identification and differentiation of myocardial aging and other diseases; The miRNA marker is hsa-miR-186-5p, and the nucleotide sequence is shown in SEQ ID No.1; the kit includes a reagent for detecting or specifically identifying hsa-miR-186-5p, or a reagent for detecting the expression level of hsa-miR-186-5p.

7. The kit according to claim 6, characterized in that: The reagent for detecting or specifically identifying hsa-miR-186-5p is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.

3.

8. A primer for detecting miRNA markers, characterized in that The primers include one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging prognosis assessment products; A5) Application in the preparation of products for identification and differentiation of myocardial aging and other diseases; The primers are primers for detecting the expression level of hsa-miR-186-5p or specifically identifying hsa-miR-186-5p, the miRNA marker is hsa-miR-186-5p, and the nucleotide sequence is shown in SEQ ID No.

1.

9. The primer according to claim 8, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images