DsRNA molecule for inhibiting sod1 gene expression and application thereof
Patent Information
- Application Number
- CN202480001710.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-08-29
- Filing Date
- 2024-08-29
- Publication Date
- 2025-06-24
AI Technical Summary
There is currently no effective treatment method that can significantly alleviate or delay the symptoms of amyotrophic lateral sclerosis (ALS). The existing treatment methods cannot cure the disease, and there is a huge need for treatment.
A modified double-stranded RNAi molecule was developed to reduce the expression level of the sod1 gene by inhibiting the expression of the sod1 gene by using the dsRNA molecule or its pharmaceutical composition to relieve the symptoms of ALS.
This double-stranded RNAi agent has high stability and high inhibitory activity, which can significantly reduce the expression level of sod1 gene, delay the onset of ALS and prolong the survival time.
Smart Images

Figure 00000041_0000 
Figure 00000041_0001 
Figure 00000042_0000
Abstract
Description
A dsRNA molecule for inhibiting sod1 gene expression and its application Technical Field
[0001] The present application belongs to the field of molecular biology and relates to a modified dsRNA molecule and its application, specifically to a dsRNA molecule for inhibiting the expression of the sod1 gene and its pharmaceutical composition, as well as a method for reducing the expression level of the sod1 gene using the dsRNA molecule or its pharmaceutical composition. Background Art
[0002] RNA interference (RNAi) is widely present in species throughout nature. Since Andrew Fire, Craig Mello, and others first discovered RNAi in nematodes in 1998, and Tuschl, Phil Sharp, and others confirmed its existence in mammals in 2001, research has made significant progress in understanding its mechanisms, gene functions, and clinical applications. RNAi plays a key role in various protective mechanisms, including defense against viral infection and transposon jumping. Products developed based on RNAi mechanisms are highly promising drug candidates. Small interfering RNA (siRNA), capable of exerting RNAi interference, is the primary tool for achieving RNAi.
[0003] Soluble SOD1 enzyme (also known as Cu / Zn superoxide dismutase) is one of the superoxide dismutases that can protect biological molecules from oxidative damage by catalyzing the dismutation of superoxide to hydrogen peroxide (H2O2). 2- ) are potentially harmful cellular byproducts produced primarily by errors in oxidative phosphorylation in the mitochondria. Mutations in the SOD1 gene are associated with a dominantly inherited form of ALS, a disorder characterized by selective degeneration of upper and lower motor neurons. There is a tight genetic linkage between familial ALS and missense mutations in the SOD1 gene. The toxicity of mutant SOD1 is thought to result from an initial misfolding (gain of function) that leads to a reduced protection of the nucleus by the active enzyme (loss of function in the nucleus), a process that may be relevant to the pathogenesis of ALS.
[0004] There are two different types of ALS, sporadic and familial. Sporadic ALS is the most common form of the disease, accounting for 90% to 95% of all cases, and it can affect anyone, anywhere. ALS patients account for a relatively high proportion of patients with rare diseases and have a high mortality rate. Familial ALS means that the disease is hereditary. In these families, each offspring has a 30%-60% chance of inheriting the gene mutation and may develop the disease. There are also some therapeutic agents that slow the loss of physiological functions of ALS or prolong survival, including riluzole, edaravone, tofersen, etc. However, currently known therapeutic agents cannot alleviate the symptoms of all ALS patients, and there is currently no known cure for ALS.
[0005] Due to the intractability of related diseases, there is an extreme lack of treatment options and a huge unmet need for treatment. Therefore, it is still necessary to develop other inhibitors targeting this target to have better efficacy, specificity, stability, targeting or tolerability.
[0006] SUMMARY OF THE INVENTION
[0007] The present application provides a modified double-stranded RNAi molecule, a pharmaceutical composition containing the modified double-stranded RNAi molecule, and applications thereof.
[0008] Specifically, on the one hand, the present application provides a double-stranded RNAi agent for inhibiting the expression of the sod1 gene, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, the sense strand and / or the antisense strand comprising or consisting of 15-25 nucleotides, the antisense strand being complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 3, the double-stranded region being 15-25 bp in length, and at least one nucleotide in the double-stranded RNAi agent being modified;
[0009] The modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2′-methoxyethyl modification, 2′-O-methyl modification, 2′-O-allyl modification, 2′-C-allyl modification, 2′-fluoro modification, 2′-deoxy modification, phosphorothioate backbone modification, DNA modification, and lipophilic modification.
[0010] In some embodiments, the sense strand of the double-stranded RNAi agent comprises the nucleotide sequence of UAGCUGUAGAAAUGUAUCCUG (SEQ ID NO: 1), and / or the antisense strand comprises the nucleotide sequence of CAGGAUACAUUUCUACAGCUAGC (SEQ ID NO: 2); or the sense strand of the double-stranded RNAi agent comprises the nucleotide sequence of AGCUGUAGAAAUGUAUCCUGA (SEQ ID NO: 3), and / or the antisense strand comprises the nucleotide sequence of UCAGGAUACAUUUCUACAGCUAG (SEQ ID NO: 4).
[0011] In some embodiments, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence of UAGCUGUAGAAAUGUAUCCUG (SEQ ID NO: 1), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence of CAGGAUACAUUUCUACAGCUAGC (SEQ ID NO: 2); or the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence of AGCUGUAGAAAUGUAUCCUGA (SEQ ID NO: 3), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence of UCAGGAUACAUUUCUACAGCUAG (SEQ ID NO: 4).
[0012] In some embodiments, the double-stranded RNAi agent is modified in a manner that: (1) the sense strand is 17-21 nt in length, such as 17, 18, 19, 20, or 21 nt; it is composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, and the number of consecutive nucleotides in each modified region is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides; the modification manner of the 5' end and the first modified region from the 3' end is the same; and (2) the antisense strand is 19-23 nt in length, such as 19, 20, 21, 22, or 23 nt; it is composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions, or DNA regions, and the length of consecutive nucleotides in each modified region is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides; the modification manner of the 5' end and the first modified region from the 3' end is the same;
[0013] In the sense strand and the antisense strand, the continuous nucleotide region from positions 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7 from the 5' end, and the continuous nucleotide region from positions 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7 from the 3' end are all connected by a thiophosphate backbone; in some embodiments, the continuous nucleotide region from positions 1 to 3 from the 5' end, and the continuous nucleotide region from positions 1 to 3 from the 3' end are all connected by a thiophosphate backbone.
[0014] In some embodiments, the lipophilic modification is one or more lipophilic moieties conjugated to one or more internal positions (i.e., nucleotides within the chain) on at least one chain of the double-stranded RNAi agent, wherein the lipophilic moiety is selected from a saturated or unsaturated straight or branched C4-C 30 Hydrocarbon chains, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, glycerol, borneol, menthol, 1,3-propylene glycol, palmitic acid, myristic acid, dimethoxytrityl, or phenoxazine;
[0015] In some embodiments, the one or more lipophilic moieties are conjugated to one or more of the following internal positions: positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand; the conjugation is attached to the base or to the sugar ring; in some embodiments, the lipophilic moiety is attached to the sugar ring; in some embodiments, the lipophilic moiety is attached to the 2' position of the sugar ring.
[0016] In some embodiments, the double-stranded RNAi agent comprises:
[0017] (1) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence C msAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and corresponding modifications;
[0018] (2) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and corresponding modifications;
[0019] (3) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and corresponding modifications;
[0020] (4) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence of UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and corresponding modifications;
[0021] Among them, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) means that the two nucleotides are connected by a phosphorothioate backbone.
[0022] In some embodiments, the double-stranded RNAi agent comprises: an antisense strand complementary to the target gene as described above; a sense strand complementary to the antisense strand; and one or more lipophilic moieties optionally conjugated to one or more internal positions (i.e., nucleotides within the strand) on at least one strand via a linker or a carrier;
[0023] The one or more lipophilic moieties are conjugated to one or more nucleotides selected from the group consisting of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand; the lipophilic moiety is attached to a base or to a sugar ring; in some embodiments, the lipophilic moiety is attached to a sugar ring; in some embodiments, the lipophilic moiety is attached to the 2' position of the sugar ring;
[0024] In some embodiments, the lipophilic moiety is selected from a saturated or unsaturated linear or branched C4-C30 hydrocarbon chain, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, glycerol, borneol, menthol, 1,3-propylene glycol, palmitic acid, myristic acid, dimethoxytrityl, or phenoxazine.
[0025] In some embodiments, the lipophilic moiety is selected from saturated or unsaturated linear or branched C 10 -C 25 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 12 -C 22 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 14 -C 20 hydrocarbon chain; further preferably the lipophilic portion is selected from saturated or unsaturated linear or branched C 16 Hydrocarbon chain, C 17 Hydrocarbon chain, C 18 In some embodiments, the lipophilic portion is selected from saturated or unsaturated linear or branched C 16 hydrocarbon chain;
[0026] The lipophilic moiety is attached to the base or to the sugar ring; in some embodiments, the lipophilic moiety is attached to the sugar ring; in some embodiments, the lipophilic moiety is attached to the 2' position of the sugar ring.
[0027] In some embodiments, the sense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 12; and the antisense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 10 or SEQ ID NO: 13.
[0028] In some embodiments, the lipophilic portion of the double-stranded RNAi agent is conjugated to the double-stranded iRNA agent via a linker containing an ether, urea, carbonate, amine, amide, phosphodiester, sulfonamide bond, bond, or carbamate.
[0029] On the other hand, the present application provides a biomaterial selected from any one of the following groups:
[0030] (A) a DNA molecule capable of producing any of the aforementioned double-stranded RNAi agents;
[0031] (B) a vector capable of expressing any of the aforementioned double-stranded RNAi agents;
[0032] (C) a reagent or kit comprising any of the aforementioned double-stranded RNAi agents or the DNA molecule or vector described in (A) or (B);
[0033] (D) A pharmaceutical composition consisting of any of the aforementioned double-stranded RNAi agents and other pharmaceutically acceptable components.
[0034] In another aspect, the present application provides a use of a double-stranded RNAi agent selected from any one of the following groups:
[0035] (I) Use of any of the aforementioned double-stranded RNAi agents or any of the aforementioned biological materials in inhibiting sod1 gene expression or in preparing a product for inhibiting sod1 gene expression;
[0036] (II) Use of any of the aforementioned double-stranded RNAi agents or any of the aforementioned biomaterials for reducing sod1 mRNA expression or SOD1 protein concentration in different brain tissue regions and spinal cord, or for preparing a product for reducing sod1 mRNA expression or SOD1 protein concentration in different brain tissue regions and spinal cord;
[0037] (III) Use of any of the aforementioned double-stranded RNAi agents or any of the aforementioned biomaterials for reducing the concentration of SOD1 protein and / or neurofilament protein in serum and CSF, or for preparing a product for reducing the concentration of SOD1 protein and / or neurofilament protein in serum and CSF;
[0038] (IV) Use of any of the aforementioned double-stranded RNAi agents or any of the aforementioned biological materials for preventing and / or treating diseases mediated by a mutated sod1 gene, or for preparing a product for preventing and / or treating diseases mediated by a mutated sod1 gene;
[0039] (V) Use of any of the aforementioned double-stranded RNAi agents or any of the aforementioned biological materials for alleviating symptoms of a disease mediated by a mutated sod1 gene, or for preparing a product for alleviating symptoms of a disease mediated by a mutated sod1 gene;
[0040] The aforementioned diseases mediated by mutated sod1 genes include amyotrophic lateral sclerosis (ALS) or neurodegenerative diseases.
[0041] It should be understood that the aspects and embodiments of the present application described herein include aspects and embodiments that "comprise," "consist of," and "consist essentially of." The preferred embodiments of the present application are described in detail above, but the present application is not limited thereto. Within the technical concept of the present application, various simple variations of the technical solution of the present application may be made, including combining the various technical features in any other suitable manner. These simple variations and combinations should also be considered as disclosed in the present application and fall within the scope of protection of the present application.
[0042] Technical effect:
[0043] The unexpected technical effects of this application are reflected in the following aspects: 1. The modified double-stranded RNAi agent has high stability and high inhibitory activity both in vivo and in vitro, significantly superior to existing similar products on the market; 2. While maintaining high inhibitory activity and stability, the modified double-stranded RNAi agent also has a good ability to be internalized by cells, reducing the amount of double-stranded RNAi agent used, thereby achieving the purpose of reducing toxicity and reducing costs; 3. The modified double-stranded RNAi agent can enter target cells and target tissues without the need for transfection reagents, reducing the negative effects of transfection reagents, such as cell or tissue toxicity. 4. The modified double-stranded RNAi agent can not only effectively delay the onset of the disease, but also greatly prolong survival, thereby providing a possibility for targeted treatment of ALS.
[0044] It should be noted that, although many modifications can be attempted to improve the performance of double-stranded RNAi agents, these attempts generally have difficulty demonstrating both RNA interference-mediated and improved stability in serum (e.g., increased resistance to nucleases and / or prolonged duration). The modified double-stranded RNAi agents of the present application have high stability while maintaining high inhibitory activity, achieving unexpected technical effects. Description of the drawings:
[0045] Figure 1: Gene expression data of candidate modified sequences in U-251MG cells. The experimental results for each concentration are from left to right: S952, S954, and NC.
[0046] Figure 2: Gene expression data for candidate sequence modification strategies in U-251MG cells. The experimental results for each concentration are S592.11, S592.21, S594.11, S594.21, and NC from left to right.
[0047] Figures 3A-3E: Gene expression data for candidate modified sequence S594.21 and aCSF control in mice. Figure 3A: Gene expression data for the prefrontal cortex; Figure 3B: Gene expression data for the cerebellum; Figure 3C: Gene expression data for the cervical spine; Figure 3D: Gene expression data for the lumbar spine; Figure 3E: Gene expression data for the thoracic spine.
[0048] Figure 4A-Figure 4B: Rotarod behavioral efficacy test of candidate modified sequences in mice; Figure 4A: Rotarod behavioral efficacy test data in mice administered ICV in the late stage of the disease; Figure 4B: Rotarod behavioral efficacy test data in mice administered IT in the early stage of the disease.
[0049] Figure 5A-Figure 5B: Inverted hanging behavioral efficacy test of candidate modified sequences in mice; Figure 5A: Inverted hanging behavioral efficacy test data of mice administered ICV in the late stage of the disease; Figure 5B: Inverted hanging behavioral efficacy test data of mice administered IT in the early stage of the disease.
[0050] Figure 6: Efficacy test of the effect of ICV administration of candidate modification sequences in the late stage of onset on the climbing behavior of mice.
[0051] Figure 7: Efficacy test of ICV administration of candidate modified sequences in late stage of disease on body weight rescue in mice.
[0052] Figure 8: Efficacy study of the effect of ICV administration of candidate modified sequences on mouse survival rate in the late stage of disease.
[0053] Figure 9: Efficacy study of the effect of IT administration of candidate modified sequences on mouse survival rate in the early stage of disease.
[0054] Detailed Description of the Invention
[0055] The present application provides a dsRNA molecule, reagent, kit and pharmaceutical composition for inhibiting sod1 gene expression, as well as methods and uses of the above dsRNA molecule, reagent, kit or pharmaceutical composition in inhibiting or reducing sod1 gene expression or treating sod1 gene-mediated diseases or symptoms.
[0056] Specifically, in one aspect, the present application provides a double-stranded RNAi agent for inhibiting the expression of the sod1 gene, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, the sense strand or the antisense strand comprising 15-25 nucleotides, the antisense strand being complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 3, the length of the double-stranded region being 15-25 bp, preferably 19-21 bp, and at least one nucleotide in the double-stranded RNAi agent being modified; the modification being selected from any one or more of the following: locked nucleic acid (LNA) modification, open ring or unlocked (UNA) modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and lipophilic modification.
[0057] In some embodiments, the present application provides a double-stranded RNAi agent for inhibiting the expression of the sod1 gene, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, wherein the sense strand or the antisense strand consists of 15-25 nucleotides, and the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 3, and the length of the double-stranded region is 15-25 bp, preferably 19-21 bp, and at least one nucleotide in the double-stranded RNAi agent is modified; the modification is selected from any one or more of the following: locked nucleic acid (LNA) modification, open ring or unlocked (UNA) modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, phosphorothioate backbone modification, DNA modification, fluorescent probe modification, and lipophilic modification.
[0058] The double-stranded RNAi agent of the present application consists of two chains, wherein the chain that binds to the target mRNA is called the antisense chain or guide chain, and the other chain is called the sense chain or passenger chain. The term "antisense chain" refers to a chain of a double-stranded RNAi agent, which includes a region that is completely or substantially complementary to the target sequence. The term "sense chain" refers to a chain of a double-stranded RNAi agent, which includes a region that is substantially complementary to the region of the antisense chain as defined herein. The term "complementary region" refers to a region on the antisense chain that is completely or substantially complementary to the target mRNA sequence. In the case where the complementary region is not completely complementary to the target sequence, the mismatch can be located in the interior or terminal region of the molecule. As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions, such as stringent conditions.
[0059] The double-stranded RNAi agent promotes the sequence-specific degradation of sod1 mRNA through RNAi action, thereby inhibiting the expression of the sod1 gene or reducing the level of the sod1 gene expression.
[0060] In some embodiments, the present application provides a double-stranded RNAi agent, the nucleotide sequence of the sense strand of which is shown in SEQ ID NO: 1 or SEQ ID NO: 3, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO: 2 or SEQ ID NO: 4.
[0061] In some embodiments, the sense strand of the double-stranded RNAi agent comprises the nucleotide sequence of UAGCUGUAGAAAUGUAUCCUG (SEQ ID NO: 1), and / or the antisense strand of the double-stranded RNAi agent comprises the nucleotide sequence of CAGGAUACAUUUCUACAGCUAGC (SEQ ID NO: 2); in some embodiments, the sense strand of the double-stranded RNAi agent comprises the nucleotide sequence of AGCUGUAGAAAUGUAUCCUGA (SEQ ID NO: 3), and / or the antisense strand of the double-stranded RNAi agent comprises the nucleotide sequence of UCAGGAUACAUUUCUACAGCUAG (SEQ ID NO: 4).
[0062] In some embodiments, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence shown in UAGCUGUAGAAAUGUAUCCUG (SEQ ID NO: 1), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence shown in CAGGAUACAUUUCUACAGCUAGC (SEQ ID NO: 2); in some embodiments, the sense strand of the double-stranded RNAi agent consists of the nucleotide sequence shown in AGCUGUAGAAAUGUAUCCUGA (SEQ ID NO: 3), and / or the antisense strand of the double-stranded RNAi agent consists of the nucleotide sequence shown in UCAGGAUACAUUUCUACAGCUAG (SEQ ID NO: 4).
[0063] In some embodiments, the modification methods of the double-stranded RNAi agent provided herein include: (1) sense strand: 17-23 nt in length, such as 17, 18, 19, 20, 21 nt, 22 nt, or 23 nt; preferably 19-23 nt, such as 19, 20, 21 nt, 22 nt, or 23 nt; more preferably 19-21 nt, such as 19, 20, or 21 nt; the sense strand is composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, and the number of consecutive nucleotides in each modified region is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides; The 5' end and the first modified region from the 3' end are modified in the same manner; and (2) the antisense strand: 19-25 nt in length, such as 19, 20, 21, 22, 23 nt, 24n or 25 nt; preferably 19-23 nt, such as 19, 20, 21 nt, 22 nt, or 23 nt; consisting of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions or DNA regions, and the length of the continuous nucleotides in each modified region is any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides; the 5' end and the first modified region from the 3' end are modified in the same manner;
[0064] In the sense strand and the antisense strand, the continuous nucleotide region from positions 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7 from the 5' end, and the continuous nucleotide region from positions 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7 from the 3' end are all connected by a phosphorothioate backbone; preferably, the continuous nucleotide region from positions 1 to 3 from the 5' end, and the continuous nucleotide region from positions 1 to 3 from the 3' end are all connected by a phosphorothioate backbone.
[0065] In some embodiments, the double-stranded RNAi agent includes: (1) the antisense chain has a protruding end with a 5'(s)mN(s)mN3' structure at the 3' end; (2) the antisense chain is fluorinated at least at positions 2, 14, and 16 from the 5' end, and other positions are modified with methoxy as much as possible; (3) the antisense chain has at least two thio modifications from the 3' end and the 5' end; (4) the sense chain is continuously fluorinated at position 7 and positions 9-11 from the 5' end, and other positions are modified with methoxy as much as possible; (5) the sense chain has at least two thio modifications from the 5' end.
[0066] In some embodiments, the double-stranded RNAi agent comprises: (1) a sense strand comprising 21 nucleotides, consisting of alternating 2'-fluoro modified regions and 2'-O-methyl modified regions, each modified region being 1 to 7 nucleotides in length; the modification pattern of the first modified region from the 5' end and the 3' end is the same; (2) an antisense strand comprising 23 nucleotides, consisting of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, each modified region being 1 to 5 nucleotides in length, and the continuous nucleotide region from positions 1 to 7 from the 5' end and the continuous nucleotide region from positions 1 to 7 from the 3' end are all connected by a thiophosphate backbone; preferably, the continuous nucleotide region from positions 1 to 3 from the 5' end and / or the continuous nucleotide region from positions 1 to 3 from the 3' end are all connected by a thiophosphate backbone.
[0067] In some embodiments, the double-stranded RNAi agent comprises an antisense strand complementary to the target gene, a sense strand complementary to the antisense strand, and one or more lipophilic moieties conjugated to one or more internal positions (i.e., nucleotides within the chain) on at least one strand, optionally via a linker or carrier. The lipophilic moiety is selected from a saturated or unsaturated linear or branched C4-C 30 Hydrocarbon chains, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, glycerol, borneol, menthol, 1,3-propylene glycol, palmitic acid, myristic acid, dimethoxytrityl, or phenoxazine.
[0068] In some embodiments, one or more lipophilic moieties are conjugated to one or more of the following internal positions (i.e., nucleotides within the chain): positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5' end of each strand; preferably, the one or more lipophilic moieties are conjugated to one or more of the following internal positions (i.e., nucleotides within the chain): positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5' end of each strand; more preferably, the lipophilic moiety is conjugated to position 6 on the sense strand.
[0069] In some embodiments, the ligand (lipophilic moiety) is linked to the 3' end, the 5' end, and / or in the middle of the sequence of the double-stranded RNAi agent.
[0070] In some embodiments, the lipophilic moiety contains a saturated or unsaturated C4-C 30 More specifically, the lipophilic portion contains a saturated or unsaturated C6-C 18 Hydrocarbon chain, most preferably saturated or unsaturated C 16 Hydrocarbon chain.
[0071] In some embodiments, the lipophilic moiety is conjugated to the double-stranded RNAi agent via a linker containing an ether, urea, carbonate, amine, amide, phosphodiester, sulfonamide bond, bond, or carbamate.
[0072] In some embodiments, the 3' end, 5' end and / or the middle of the double-stranded RNAi agent are subjected to the lipophilic portion containing a saturated or unsaturated linear or branched C 10 -C 25 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 12 -C 22 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 14 -C 20 Further preferably, the lipophilic portion contains a saturated or unsaturated straight or branched chain C 16 Hydrocarbon chain, C 17 Hydrocarbon chain, C 18 The lipophilic moiety is attached to the base or the sugar ring, preferably to the sugar ring, and more preferably to the 2' position of the sugar ring. In some embodiments, the sixth nucleotide from the 5' end of the sense strand is modified with a 2'-O-hexadecyl group.
[0073] In another example of the present application, in the double-stranded RNAi agent, the nucleoside structure containing the lipophilic portion is as shown in Formula I:
[0074] Wherein B is a natural or modified base, n=15;
[0075] Preferably, the lipophilic moiety is linked to the middle of the sense strand of the double-stranded RNAi agent;
[0076] In one example of the present application, in the double-stranded RNAi agent, the lipophilic portion is C 16 ;
[0077] The 5'-position of the 5'-terminal nucleotide of the antisense strand may or may not be linked to vinyl phosphate (VP).
[0078] In some embodiments of the present application, the double-stranded RNAi agent comprises a modification motif selected from any one of the following:
[0079] (1) Justice chain: NmsNmsNmNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmsNmsNm,
[0080] Antisense strand: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0081] (2) Justice chain: NmsNmsNmNmNmNmNmNfNmNfNfNfNfNmNmNmNmNmNmNmNmsNmsNm,
[0082] Antisense strand: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0083] (3) Justice chain: NmsNmsNmNmNmN(hd)NfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm,
[0084] Antisense strand: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; and
[0085] (4) Justice chain: NmsNmsNmNmNmN(hd)NfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm,
[0086] Antisense strand: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm;
[0087] Among them, Nm represents a 2'-O-methyl modified ribonucleotide; Nf represents a 2'-fluoro modified ribonucleotide; (s) represents that the two nucleotides are connected by a phosphorothioate backbone; N(hd) represents a 2'-O-C16 modified ribonucleotide.
[0088] In one example of the present application, the double-stranded RNAi agent includes any one or more selected from the following:
[0089] (1) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and corresponding modifications;
[0090] (2) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence CmsAfsGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and corresponding modifications;
[0091] (3) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and corresponding modifications; or
[0092] (4) a sense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence that is at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleotide sequence UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and corresponding modifications;
[0093] Among them, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) means that the two nucleotides are connected by a phosphorothioate backbone.
[0094] In one example of the present application, the double-stranded RNAi agent comprises any one or more selected from the following:
[0095] (1) the sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0096] The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0097] (2) the sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0098] The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0099] (3) the sense strand nucleotide sequence consists of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0100] The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0101] (4) the sense strand nucleotide sequence consists of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0102] The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0103] (5) the sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0104] The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0105] (6) the sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11) and 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0106] The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0107] (7) the sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0108] The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends; and
[0109] (8) the sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends,
[0110] The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and an additional 0-5 (e.g., 0, 1, 2, 3, 4, or 5) nucleotides at the 5' and / or 3' ends;
[0111] Among them, Am, Um, Cm and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a phosphorothioate backbone; G(hd) and U(hd) represent 2'-O-C16-modified G and U, respectively.
[0112] In some embodiments, the nucleic acid sequence of the double-stranded RNAi agent is formed by attaching a vinyl phosphate to the 5' position of the 5' terminal nucleotide of the antisense strand in the double-stranded RNAi agent as described above.
[0113] In one example of the present application, the double-stranded RNAi agent comprises any one or more selected from the following:
[0114] (1) The sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5),
[0115] The antisense strand nucleotide sequence consists of VP-CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 18);
[0116] (2) the sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5),
[0117] The antisense strand nucleotide sequence consists of VP-CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 19);
[0118] (3) the sense strand nucleotide sequence consists of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8),
[0119] The antisense strand nucleotide sequence consists of VP-UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 20);
[0120] (4) the sense strand nucleotide sequence consists of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8),
[0121] The antisense strand nucleotide sequence consists of VP-UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 13);
[0122] (5) the sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11),
[0123] The antisense strand nucleotide sequence consists of VP-CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 18);
[0124] (6) The sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11) and 0-5 nucleotides at the 5' and / or 3' ends.
[0125] The antisense strand nucleotide sequence consists of VP-CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 19);
[0126] (7) the sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12),
[0127] The antisense strand nucleotide sequence consists of VP-UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 20); and
[0128] (8) The sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12),
[0129] The antisense strand nucleotide sequence consists of VP-UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 13);
[0130] Among them, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides are connected by a thiophosphate backbone; G(hd) and U(hd) represent 2'-O-C16 modified G and U, respectively; VP- indicates that the 5' position of the nucleotide connected to it is connected to vinyl phosphate.
[0131] In some embodiments, the sense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 12; the antisense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 10. In some embodiments, the sense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 12; the antisense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO: 13.
[0132] On the other hand, the present application relates to a method for reducing the expression of a target gene in a cell, the method comprising contacting the cell with a double-stranded RNAi agent, the double-stranded RNAi agent comprising: an antisense strand complementary to the target gene, a sense strand complementary to the antisense strand, and one or more lipophilic moieties optionally conjugated to one or more internal positions (i.e., nucleotides within the chain) on at least one strand via a linker or a carrier. The lipophilic moiety is a saturated or unsaturated straight or branched C4-C 30 Hydrocarbon chains, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexanol, glycerol, borneol, menthol, 1,3-propylene glycol, palmitic acid, myristic acid, dimethoxytrityl, or phenoxazine.
[0133] In some embodiments, the lipophilic moiety is selected from saturated or unsaturated linear or branched C4-C30 Hydrocarbon chain; preferably the lipophilic part is selected from saturated or unsaturated straight or branched C 10 -C 25 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 12 -C 22 Hydrocarbon chain; further preferably a saturated or unsaturated straight or branched chain C 14 -C 20 hydrocarbon chain; further preferably the lipophilic portion is selected from saturated or unsaturated linear or branched C 16 Hydrocarbon chain, C 17 Hydrocarbon chain, C 18 Further preferably, the nucleotides 6-8 from the 5' end of the sense strand are modified with 2'-O-hexadecyl. In some embodiments, the nucleotide 6 from the 5' end of the sense strand is modified with 2'-O-hexadecyl.
[0134] More specifically, the lipophilic portion contains saturated or unsaturated C 16 Hydrocarbon chain, a single nucleoside structure containing the C16 is shown in Formula I:
[0135] Wherein, B is a natural or modified base (e.g., A, T, G, C, U), and n=15;
[0136] The 5' position of the 5'-terminal nucleotide of the antisense strand may or may not be linked to vinyl phosphate (VP).
[0137] This application provides the following illustrative examples of double-stranded RNAi agents: S592.1, S592.2, S594.1, S594.2.
[0138] Furthermore, exemplary double-stranded RNAi agents are any of those listed in Table 1:
[0139] Table 1
[0140] Among them, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) means that the two nucleotides are connected by a phosphorothioate backbone.
[0141] In some embodiments, the sense strand structure and antisense strand structure of the double-stranded RNAi agent are as shown in Table 2:
[0142] Table 2
[0143] Wherein, Am, Um, Cm, and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C, and G, respectively; Af, Uf, Cf, and Gf represent 2'-fluoro-modified ribonucleotides A, U, C, and G, respectively; (s) indicates that the two nucleotides are linked by a phosphorothioate backbone. U(hd) and G(hd) represent 2'-O-hexadecyl-modified ribonucleotides U and G, respectively; VP- indicates that VP (vinyl phosphate) is attached to the 5' position of the nucleotide to which it is linked.
[0144] The double-stranded RNAi agent can inhibit the expression of the sod1 gene in humans, monkeys, rats or mice.
[0145] Biological materials related to the double-stranded RNAi agent also fall within the protection scope of this application.
[0146] The biological material associated with the double-stranded RNAi agent may be any of the following:
[0147] (A) a DNA molecule capable of producing the double-stranded RNAi agent;
[0148] (B) a vector capable of expressing the double-stranded RNAi agent;
[0149] (C) a reagent or kit containing the double-stranded RNAi agent or the DNA molecule described in (A) or the vector described in (B);
[0150] (D) A pharmaceutical composition, consisting of the double-stranded RNAi agent and other pharmaceutically acceptable components.
[0151] The pharmaceutical composition includes a pharmacologically effective amount of the double-stranded RNAi agent of the present application and other pharmaceutically acceptable components. "Effective amount" refers to the amount of the double-stranded RNAi agent that can effectively produce the expected pharmacological therapeutic effect. "Other components" include water, saline, glucose, buffer (such as PBS), excipients, diluents, disintegrants, binders, lubricants, sweeteners, flavorings, preservatives or combinations thereof.
[0152] The pharmaceutical composition can be used for preventing and / or treating diseases mediated by the sod1 gene, or for alleviating the symptoms of diseases mediated by the sod1 gene.
[0153] Diseases mediated by the sod1 gene include amyotrophic lateral sclerosis (ALS) and neurodegenerative diseases.
[0154] This application also provides any of the following applications:
[0155] (I) Use of the double-stranded RNAi agent or the biological material in inhibiting sod1 gene expression or preparing a product for inhibiting sod1 gene expression.
[0156] Wherein, the inhibition of sod1 gene expression is to inhibit or reduce the expression level of sod1 gene in human, monkey, rat or mouse in vivo or in vitro cells. The inhibition of sod1 gene expression is to inhibit or reduce the expression level of sod1 gene by at least 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%. Detection of target gene, target RNA or target protein levels can be used to predict or evaluate activity, efficacy or treatment outcome.
[0157] The cells are mammalian cells expressing sod1, such as primate cells or human cells. Preferably, the target cells express the sod1 gene at high levels. More preferably, the cells are derived from the brain, salivary glands, heart, spleen, lungs, liver, kidneys, intestines, or tumors. Even more preferably, the cells are SK-N-SH, SH-SY5Y, U87MG, or U-251MG cells in the central nervous system (CNS). Even more preferably, the cells are U-251MG.
[0158] In the in vivo application, the pharmaceutical composition can be administered by any suitable means, such as parenteral administration, including intramuscular, intravenous, intraarterial, peritoneal, or subcutaneous injection, intracerebroventricular administration, and intrathecal administration. The administration mode includes but is not limited to single administration or multiple administration.
[0159] In some embodiments, a single dose of the pharmaceutical composition can be long-lasting, with the reduction in sod1 expression lasting for at least 3, 7, 28 days or longer.
[0160] (II) Use of the double-stranded RNAi agent or the biomaterial in reducing sod1 mRNA expression or SOD1 protein concentration in different brain tissues and spinal cord (vertebra, lumbar vertebra, thoracic vertebra), or in preparing a product for reducing sod1 mRNA expression or SOD1 protein concentration in different brain tissues and spinal cord (vertebra, lumbar vertebra, thoracic vertebra);
[0161] Wherein, the reducing of SOD1 protein concentration in different brain region tissues and spinal cord (spine, lumbar vertebrae, thoracic vertebrae) is reducing the SOD1 protein concentration in different brain region tissues and spinal cord (spine, lumbar vertebrae, thoracic vertebrae) of humans, monkeys, rats or mice.
[0162] The concentration or content of SOD1 protein in different brain region tissues and spinal cord (vertebral, lumbar, thoracic) is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 50%.
[0163] (III) use of the double-stranded RNAi agent or the biological material in preventing and / or treating a disease mediated by the sod1 gene, or in preparing a product for preventing and / or treating a disease mediated by the sod1 gene;
[0164] (IV) use of the double-stranded RNAi agent or the biological material in alleviating symptoms of a disease mediated by the sod1 gene, or in preparing a product for alleviating symptoms of a disease mediated by the sod1 gene;
[0165] The diseases mediated by the sod1 gene include amyotrophic lateral sclerosis (ALS) or other neurodegenerative diseases.
[0166] (V) Use of the double-stranded RNAi agent or the biomaterial in reducing the SOD1 protein concentration and / or neurofilament protein concentration in serum and CSF, or in preparing a product for reducing the SOD1 protein concentration and / or neurofilament protein concentration in serum and CSF.
[0167] the term:
[0168] REL (Relative expression level): relative expression level of mRNA.
[0169] ALS: amyotrophic lateral sclerosis.
[0170] N: refers to ribonucleotides, including: ribonucleotides are divided into adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, and uracil ribonucleotides.
[0171] dN: refers to deoxyribonucleotide.
[0172] Nm: 2'OMe-modified ribonucleotide.
[0173] Nf: 2'F-modified ribonucleotide.
[0174] (s) in the nucleotide sequence: PS backbone, i.e., 5'-thio-modified phosphate backbone.
[0175] Nhd: 2'-O-hexadecyl-modified ribonucleotide.
[0176] VP-: indicates that VP (vinyl phosphate) is linked to the 5' position of the nucleotide to which it is linked.
[0177] DNA modification: The DNA modification of the double-stranded RNAi agent described in this application refers to replacing the ribonucleotides in the double-stranded RNAi agent with deoxyribonucleotides, wherein the nucleotides are the same but the type of ribose is different.
[0178] ICV: intraventricular injection.
[0179] Late administration: In this application, the drug is generally administered to disease model mice at 14-15 weeks of age.
[0180] Early administration: in this application, generally refers to administration to disease model mice when they are 5-8 weeks old.
[0181] IT injection: intrathecal injection.
[0182] DCA: dichloroacetic acid.
[0183] CAPA: Capping reagent A (20% acetic anhydride in acetonitrile, v / v).
[0184] CAPB: Capping reagent B (N-methylimidazole:pyridine:acetonitrile=2:3:5).
[0185] ACN: acetonitrile.
[0186] TEAA: triethylamineacetic acid.
[0187] Trityl-off synthesis: Trityl-off synthesis
[0188] ESI-MS: electrospray ionization mass spectrometry;
[0189] IEX HPLC: ion-exchange high-performance liquid chromatography;
[0190] GAPDH: glyceraldehyde-3-phosphate dehydrogenase;
[0191] NC group: negative control group, i.e., transfection reagent control group;
[0192] aCSF: Artificial cerebrospinal fluid (sterile), also known as cerebrospinal fluid simulant. In scientific research, aCSF is often used to maintain pH balance and tissue oxygen delivery, conduct rat brain microdialysis experiments, and culture hippocampal tissue slices.
[0193] As used herein, percentages of "identity," such as 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, or 99.5% identity, refer to a degree of similarity between amino acid sequences or nucleotide sequences determined by sequence alignment of 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 98.5%, 99%, or 99.5%. For example, the percentage of positions with identical bases or amino acid residues is determined as the ratio of the total number of positions after two sequences have been aligned to have identical residues at as many positions as possible, such as by introducing gaps. Percentages of "identity" can be determined using software programs known in the art. Preferably, the alignment is performed using default parameters. A preferred alignment program is BLAST. Preferred programs are BLASTN and BLASTP. Details of these programs can be found on the corresponding pages of the NCBI website. It should be noted that when describing a nucleotide sequence that has at least a certain percentage of identity with a certain nucleotide sequence and the corresponding modifications (for example, "a nucleotide sequence that has at least 90% identity with the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and the corresponding modifications"), the sequence alignment needs to take into account the modification of each nucleotide monomer of the nucleotide sequence, that is, the two nucleotides are considered to be the same nucleotides only when the entire monomers (including artificial modifications) of the two nucleotides are completely identical.
[0194] As used herein, "complementarity" of nucleic acids refers to the ability of one nucleic acid to form hydrogen bonds with another nucleic acid through traditional Watson-Crick base pairing. Percent complementarity represents the percentage of nucleotides in the shorter of two nucleic acid molecules that can form hydrogen bonds (i.e., Watson-Crick base pairing) with the other nucleic acid molecule (e.g., about 5, 6, 7, 8, 9, 10 out of 10 are about 50%, 60%, 70%, 80%, 90% and 100% complementary, respectively). "Complete complementarity" refers to the ability of all consecutive residues of a nucleic acid sequence to form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. For single bases or single nucleotides, according to the Watson-Crick base pairing rules, when A pairs with T or U, or C pairs with G or I, and vice versa, they are said to be complementary, paired, or matched; base pairings other than these are said to be non-complementary.
[0195] As used herein, "hybridization" of nucleic acids refers to the reaction of one or more polynucleotides to form a complex that is stabilized by hydrogen bonding between the nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific manner. The complex can include two chains forming a double-stranded structure, three or more chains forming a multi-stranded complex, a single self-hybridizing chain, or a combination thereof.
[0196] The term "nucleotide", in addition to referring to naturally occurring ribonucleotides or deoxyribonucleotide monomers, is also understood herein to refer to related structural variants thereof, including derivatives and analogs, which are functionally equivalent with respect to the specific context in which the nucleotide is used, unless the context clearly indicates otherwise. For example, "nucleotide" refers to a deoxyribonucleotide or a ribonucleotide. A nucleotide can be a standard nucleotide (i.e., adenosine, guanosine, cytidine, thymidine, and uridine), a nucleotide isomer, or a nucleotide analog. A nucleotide analog refers to a nucleotide having a modified purine or pyrimidine base or a modified ribose moiety. A nucleotide analog can be a naturally occurring nucleotide (e.g., inosine, pseudouridine, etc.) or a non-naturally occurring nucleotide. Non-limiting examples of modifications on the sugar or base portion of a nucleotide include the addition (or removal) of an acetyl group, an amino group, a carboxyl group, a carboxymethyl group, a hydroxyl group, a methyl group, a phosphoryl group, and a thiol group, and the substitution of the carbon and nitrogen atoms of the base by other atoms (e.g., 7-deazapurine). Nucleotide analogs also include dideoxynucleotides, 2'-O-methyl nucleotides, locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino oligonucleotides. In some embodiments, the "nucleotides" of the present application do not include non-natural nucleotides with modified bases. In some embodiments, the "nucleotides" of the present application do not include nucleotides with modified bases. In the present application, "G", "C", "A", "T" and "U" generally represent nucleotides with guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, in the context of RNA and in RNA sequences, unless otherwise specified, "T" refers to uridine or uracil. It should be understood that in the context of nucleotide sequences in this application, "nucleotides", "nucleotide residues" and "bases" can be used interchangeably. The number of base pairs is in bp, and one bp is one base pair. The number of nucleotides is in nt, and one nt is one nucleotide.
[0197] As used herein, the term "3' end" specifically refers to the position of the first nucleotide or base pair at the 3' end of a single nucleotide sequence or a double-stranded polynucleotide, and thus "3' end" and "3' terminal nucleotide" are used interchangeably. The term "5' end" specifically refers to the position of the first nucleotide or base pair at the 5' end of a single nucleotide sequence or a double-stranded polynucleotide, and thus "5' end" and "5' terminal nucleotide" are used interchangeably.
[0198] As used herein, the term "nucleic acid molecule" may be used to refer to any molecule having a nucleotide sequence composed of two or more nucleotides linked by a phosphate bond, or a modified phosphate bond (eg, a phosphorothioate bond).
[0199] In this article, siRNA and double-stranded RNAi agent have similar meanings and can be used interchangeably.
[0200] As used herein, the singular forms "a," "an," and "the" include plural forms unless otherwise indicated.
[0201] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0202] It should be understood that the present application includes various aspects, embodiments, and combinations of the aspects and / or embodiments described herein. The above description and subsequent examples are intended to illustrate rather than limit the scope of the present application. Within the scope of the technical concept of the present application, the technical solution of the present application can be subjected to a variety of simple modifications, including combining various technical features in any other suitable manner. These simple modifications and combinations should also be regarded as the contents disclosed in the present application and all fall within the scope of protection of the present application.
[0203] The practice of this application will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology.
[0204] It should be understood that the present application includes various aspects, embodiments and combinations of the aspects and / or embodiments described herein. The above description and subsequent examples are intended to illustrate rather than limit the scope of the present application. Other aspects, improvements and modifications within the scope of the present application will be apparent to those skilled in the art. Therefore, those of ordinary skill in the art will recognize that the scope of the present application also includes the improvements and modifications to the aspects and embodiments. Example:
[0205] Example 1: sod1-siRNA activity screening
[0206] 1.1 siRNA Design
[0207] Based on the human sod1 mRNA sequence, different sites were selected to design sod1 siRNAs. All designed single siRNAs can target all transcripts of the target gene (as shown in Table 3). The above siRNA sequences (as shown in Table 4) have the lowest homology with all other non-target gene sequences after sequence similarity software alignment.
[0208] Table 3 Target genes
[0209] Table 4 High-throughput screening sequences
[0210] 1.2 siRNA Synthesis
[0211] All modified or unmodified nucleic acid compounds used in this application (such as those shown in Table 4 and Table 7) were synthesized according to the theoretical yield of 1 μmol, and 1 μmol of a universal Frit solid phase carrier ( All oligonucleotides were prepared on a Biocomma LK-192X synthesizer. The natural or modified phosphoramidite nucleomonomers used (e.g., 2'-O-C16-modified, 5'-VP-modified, 2'-OMe-modified, and 2'-F-modified) were commercially available. After completion, the Frit solid phase support was transferred to a 2 mL centrifuge tube, 1.2 mL of aqueous ammonia was added, and the tube was heated in a 36°C oven for 16 hours to remove the protecting groups. The tube was then cooled to room temperature and concentrated under vacuum for 30 minutes. The solution was then filtered through a 0.22 μm filter into a vial. Single-stranded oligonucleotides were purified using a semi-preparative reverse-phase purification system with an elution gradient of 7% to 30% (ACN:100 mM TEAA) over 12 minutes at a flow rate of 5 mL / min. After purification, the product was concentrated under vacuum and dried by spin drying at room temperature. Finally, the sample was dissolved in water, desalted, and the final oligonucleotide product was eluted. All identities and purity were confirmed using ESI-MS and IEX HPLC, respectively. Concentration was determined using a microplate reader under UV light. Equimolar amounts of the sense and antisense strands were combined in a new 2-ml Eppendorf tube, heated at 95°C for 5 minutes, and slowly annealed to room temperature. Finally, the final product was dried using a vacuum concentrator at room temperature.
[0212] 1.3. Sod1-siRNA transfection of cells
[0213] The cells used in the examples of this application were all from the collection of the Chinese Academy of Sciences, and may also be from other publicly available sources; other reagents are commercially available. Among them, the cells used are the human astrocytoma cell line U-251MG (model: CBP60300).
[0214] The cells were cultured in MEM medium (Gibco) containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), they were plated for transfection. The cell concentration was adjusted to 2×10 5 / ml, 1 ml of cell solution was added to each well of a 24-well plate and incubated overnight in a 5% CO2, 37°C incubator. To prepare the transfection complex, 250 μL of Opti-MEM (Gibco) and 5 μL of 10 nM siRNA were mixed, followed by 250 μL of Opti-MEM and 2.5 μL of Lipofectamine 2000 reagent (Thermo) transfection reagent. The mixture was allowed to stand for 5 minutes, and then the two mixtures were mixed and allowed to stand for 20 minutes. The MEM medium in the 24-well plate was aspirated, and the transfection complex was added to each well. The cells were incubated in a 5% CO2, 37°C incubator for 6 hours. The transfection complex was then aspirated, and 1 mL of complete medium (MEM + 10% FBS + 1% non-essential amino acids (NEAA) + 1 mM sodium pyruvate) was added to each well. The cells were incubated in a 5% CO2, 37°C incubator for 24 hours before being adopted.
[0215] In addition to the experimental group, a transfection reagent control group was also set up for each cell plating. Both the experimental group and the control group were repeated three times.
[0216] 1.4 Real-time quantitative PCR analysis of target mRNA levels
[0217] 1) After siRNA transfection, cells were lysed 24 hours later and total cellular RNA was extracted using a column extraction kit (Novozymes, Fastpure Cell / Tissue Total RNA Isolation Kit V2, Catalog No. RC112-01).
[0218] 2) One-step fluorescence quantitative PCR (qPCR):
[0219] Using the GAPDH gene as the internal reference gene, real-time fluorescence quantitative PCR was performed using the Taqman one-step Real-time PCR kit and a Bio-Rad CFX96 fluorescence quantitative PCR instrument. The primers used are shown in Table 5:
[0220] Table 5: Primer sequence information
[0221] 3) Data Analysis
[0222] After the PCR reaction, six replicates of each sample (three transfection replicates and three qPCR replicates per sample) were analyzed with a Ct error of ±0.5 for relative quantitative analysis using CFX 2.1 software. Table 6 shows the mean target gene expression levels of the screened siRNAs relative to the NC group (transfection reagent control group) (the relative mRNA expression level in the NC group is set to 1).
[0223] 1.5. Naked sequence screening
[0224] U-251MG cells were transfected with the siRNAs listed in Table 4 at concentrations of 100 nM, 1 nM, and 0.1 nM. After 24 hours, the cells were lysed and the amount of SOD1 mRNA was determined using one-step fluorescence quantitative PCR. The average values are shown in Table 6, and the specific statistical results are shown in Figure 1.
[0225] Table 6: Average values of real-time quantitative PCR test results
[0226] The two siRNA molecules are homologous to humans and cynomolgus monkeys, that is, they are highly homologous to the human and cynomolgus monkey mRNAs in Table 3 and can simultaneously target human and cynomolgus monkey SOD1 mRNAs.
[0227] Example 2: Optimization of sod1-siRNA: Inhibitory Activity Detection
[0228] To further confirm the high activity of these two double-stranded RNAi agents (also referred to herein as siRNA), we modified and optimized their sequences (Table 7). Their synthesis, transfection, quantitative PCR detection, and PCR primers were the same as in Example 1. U-251MG cells were transfected. Table 8 shows the average target gene expression levels relative to the NC group (the relative mRNA expression level in the NC group is 1). NC represents the transfection reagent (Lipofectamine 2000; Thermo) control group.
[0229] Table 7: Modified sequences of 5 highly active double-stranded RNAi agents
[0230] Among them, Am, Um, Cm and Gm represent 2'-O-methyl-modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro-modified ribonucleotides A, U, C and G, respectively; (s) indicates that the two nucleotides before and after are connected by a thiophosphate backbone; U(hd) and G(hd) represent 2'-O-hexadecyl-modified ribonucleotides U and G, respectively; VP- indicates that VP (vinyl phosphate) is connected to the 5' position of the nucleotide to which it is connected.
[0231] Table 8: Average values of real-time quantitative PCR test results
[0232] The results in Table 8 and Figure 2 indicate that 100 nM chemically modified S594.21 has higher inhibitory activity in U-251MG cells than S592.11, S592.21 and S594.11.
[0233] Example 3: In vivo efficacy detection - sod1-mRNA detection
[0234] The experiment used male, 14-week-old SPF grade hSOD1 G93A Mice (Jiangsu Jinzhihe Co., Ltd.) transgenically express the G93A mutant form of human SOD1. Mutated SOD1 is toxic and causes motor neuron degeneration. Heterozygotes exhibit a phenotype similar to amyotrophic lateral sclerosis (ALS) in humans and are useful for studying neuromuscular diseases including ALS. hSOD1 is screened based on transgene copy number. G93A After positive mice were enrolled, they were randomly divided into groups and administered a single intracerebroventricular (ICV) injection of S594.21 (sequence and modifications are shown in Table 7); the control group was injected with artificial cerebrospinal fluid (aCSF); the dosing groups are shown in Table 9). On days 3, 7, and 28 after administration, different brain regions (prefrontal cortex, cerebellum) and spinal cords (cervical, lumbar, and thoracic vertebrae) of the mice were collected, and the mice were euthanized. The collected tissues were used to measure sod1 mRNA levels.
[0235] Table 9: ICV administration of siRNA drug hSOD1 G93A Mouse experimental protocol
[0236] sod1-mRNA detection
[0237] 3.1 Methods
[0238] Cryopreserved mouse brain and spinal cord tissues were selected and ground using an automated grinder. Total RNA was extracted from different brain and spinal cord tissues using the Trizol method, and RNA purity and concentration were determined. The mRNA expression level of the sod1 gene was detected using the qRT-PCR Starter Kit (Novagen Fastpure Cell / Tissue Total RNA Isolation Kit V2; Catalog No. RC112-01), and inter-group comparisons were performed. The specific real-time quantitative PCR method and PCR primers used were the same as in Example 1.
[0239] 3.2 Results
[0240] The experimental results showed (Figures 3A-3E) that the relative expression of sod1 gene mRNA in the S594.21-treated group was significantly lower than that in the control group after ICV administration, and the difference was statistically significant (P<0.01). Referring to Table 10, relative to the control group, after 3 days of administration, the mRNA levels of the prefrontal cortex, cerebellum, cervical vertebrae, lumbar vertebrae, and thoracic vertebrae in the S594.21-treated group were downregulated by 29.48%, 38.39%, 67.67%, 31.66%, and 7.7% respectively relative to the aCSF group; after 7 days of administration, the mRNA levels of the prefrontal cortex, cerebellum, cervical vertebrae, lumbar vertebrae, and thoracic vertebrae in the S594.21-treated group were downregulated by 36.8% and 7.7% respectively relative to the aCSF group. After 28 days of administration, the mRNA levels of the prefrontal cortex, cerebellum, cervical vertebrae, lumbar vertebrae, and thoracic vertebrae of the S594.21-treated group were downregulated by 65.32%, 50.72%, 80.49%, 79.69%, and 84.34%, respectively, compared with the aCSF group, suggesting that the drug may allow for low-frequency administration, thereby facilitating patient care. It also demonstrates that the siRNA of the present application can significantly downregulate the mRNA expression level of the sod1 gene in mouse brain and spinal cord tissues.
[0241] Table 10: Percentage reduction of sod1 mRNA levels caused by S594.21 RNAi agent relative to the aCSF group
[0242] Example 4: In vivo drug efficacy assay-behavioral rescue assay
[0243] The experiment used male 5-week-old or 14-week-old SPF hSOD1 G93A Mice (Jiangsu Jinzhihe Co., Ltd., this strain is commonly used in the study of neuromuscular diseases such as ALS, with a 50% lifespan of approximately 157.1 ± 9.3 days) were administered a single dose via intrathecal (IT) or intracerebroventricular (ICV) injection (groupings are shown in Table 11). One week prior to dosing, a baseline test was performed, followed by behavioral testing using the rotarod, hanging, and climbing poles. These behavioral tests were repeated every other week after dosing.
[0244] Table 11: ICV / IT administration of WT; hSOD1 G93A Mouse experimental protocol
[0245] 4.1 Environmental adaptation
[0246] All mice underwent a 7-day acclimatization process by the experimental staff before experimental manipulation and drug administration to eliminate the impact of experimental staff stimulation on mouse behavior. A transparent cylinder with a diameter of 10 cm and a length of 20 cm, open at both ends, was placed in the mouse cage. After the experimental mouse climbed into the cylinder, it was lifted approximately 60 cm off the ground and allowed to move freely for 5 minutes. During this period, the mouse's condition was observed in real time through the transparent cylinder.
[0247] 4.2 Rotarod test
[0248] Before the start of the experiment, the mice were allowed to adapt to the rotarod test room for 30 minutes. The rotarod was wiped with 75% alcohol. On the first day, the mice were placed on a 4rpm rotarod for 60 seconds of adaptation training. Each mouse adapted 3 times with an interval of 30 minutes. On the second day, the mice were placed on an 8rpm rotarod for 60 seconds of adaptation training. Each mouse adapted 3 times with an interval of 30 minutes. On the third day, the mice were placed on an accelerated rotarod for testing. The rotarod speed slowly accelerated from 4rpm to 40rpm. The acceleration process took 360 seconds, and then maintained at 40rpm for 240 seconds, that is, the maximum total time was 600 seconds. The time the mouse stayed on the rotarod was recorded. After the experiment, the rotarod was cleaned and wiped with 75% alcohol. After the first week is completed, only one day of 8rpm adaptation training is required.
[0249] 4.3 Inverted hanging test
[0250] Before the experiment began, mice were allowed to acclimate to the inverted hanging test chamber for 30 minutes. The mice were placed flat on a fine iron grid. Once the mice had a firm grip, the grid was flipped over and placed on the top of an open transparent box at an appropriate height. The timer began when the grid flipped over and stopped when the mice fell off the grid. The duration of the grip was recorded. Each mouse was tested twice, with a two-hour interval between tests.
[0251] 4.4 Pole climbing test
[0252] Mice were allowed to acclimate to the pole climbing test room for 30 minutes beforehand. Before the test began, mice completed three consecutive pole climbing acclimatization training sessions to ensure they could climb smoothly. At the start of the test, mice were placed at the top of the pole. The timer began when the mouse's head was facing downward and its body was vertical. The timer stopped when its forelimbs touched the ground, and the time it took for the mouse to descend the pole was recorded. Each mouse was tested three times, with a one-hour interval between tests.
[0253] 4.5 Results
[0254] The test results showed (rotarod behavior results are shown in Figures 4A and 4B, hanging behavior results are shown in Figures 5A and 5B, and climbing behavior results are shown in Figure 6): ICV / IT administration can significantly improve the motor ability and muscle capacity of the mice with the disease, and the difference is statistically significant (P<0.01).
[0255] In 15-week-old mice, ICV administration of compound S594.21 significantly prolonged the rotarod time at the endpoint compared to the aCSF control group (Figure 4A, normalized mean: 0.17 vs 1.18); the hanging time at the endpoint was significantly prolonged (Figure 5A, normalized mean: 0.04 vs 0.74); and the time required to climb the pole at the endpoint was significantly shortened (Figure 6, normalized mean: 1.43 vs 0.72). It can be concluded that compound S594.21 significantly improved the motor and muscle function of the affected mice, and the difference was statistically significant (P < 0.01).
[0256] Mice were given IT at 7 weeks of age. Compared with the control group aCSF and Tofersen, the S594.3-treated group had a significantly prolonged rotation rod time at the end of the experiment (Figure 4B normalized mean: 0.52; 0.54 vs 1.03); and a significantly prolonged hanging time (Figure 5B normalized mean: 0.24; 0.35 vs 1.13). It can be concluded that compound S594.3 significantly improved the motor ability and muscle capacity of the diseased mice, and the difference was statistically significant (P<0.01).
[0257] The above-mentioned trial results are all based on single administration, suggesting that the drug may allow low-frequency administration, thereby improving the patient's disease condition and improving the quality of life.
[0258] Example 5: In vivo drug testing - survival assessment and body weight measurement
[0259] 5.1 Methods
[0260] After entering the animal housing, the mice were acclimated to the environment for 7 days by the experimental staff. The mice were then administered a single dose by intrathecal (IT) or intracerebroventricular (ICV) injection (grouping is shown in Table 11). Before and daily after dosing, a dedicated animal handler carefully observed the mice's gait and forelimb weakness, and also checked their mental state and survival. Mice were considered dead if they failed to right themselves within 30 seconds after being placed on their side.
[0261] Body weight was measured during weekly behavioral testing. Considering that the movement of mice would cause weight fluctuations, each mouse was weighed three times while the mice were relatively still, and the average value was taken.
[0262] 5.2 Results
[0263] The experimental results of S594.21 molecule showed (Figure 7, Figure 8), in the late stage of disease (i.e., 15-week-old SPF hSOD1 G93AICV administration of the drug to mice (20 mice / group) can improve the weight of diseased mice; current data from the simultaneous drug administration group show that compared with the aCSF control group, the S594.21 injection group can significantly prolong the survival of diseased mice by 23 weeks, and the difference compared with the vehicle group is statistically significant (P<0.01). This suggests that the drug may allow for low-frequency administration, thereby improving the patient's weight and prolonging survival, allowing patients to survive with high quality. Currently, the longest survival of mice is at least 41 weeks. Compared with the αCSF control group, the S594.21 group extended the survival of mice by nearly 6 months, which is significantly better than other small nucleic acid drugs with the same target under development in the existing technology. For example, the current literature records (Alex McCampbell et al, 2018) of the same target (SOD1) ASO product (tofersen) only extended the survival of mice by 40 days.
[0264] The results of the S594.3 molecule trial (12 mice / group) showed (Figure 9) that a single IT dose of 300 μg / mouse in the early stages of the disease significantly prolonged the survival of mice with the disease by 9 weeks compared to the aCSF (artificial cerebrospinal fluid) group. Compared to Tofersen, the difference was statistically significant (P<0.01) using a T-test, demonstrating a significant advantage in suppressing SOD1 mRNA levels. This suggests that the drug may allow for less frequent dosing, thereby improving patient weight and prolonging survival, ultimately contributing to a better quality of life.
Claims
1. A double-stranded RNAi agent for inhibiting the expression of sod1 gene, comprising a sense strand and an antisense strand that complement each other to form a double-stranded region, wherein the sense strand and / or the antisense strand comprises or consists of 15-25 nucleotides, the antisense strand is complementary to at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 3, the length of the double-stranded region is 15-25 bp, and at least one nucleotide in the double-stranded RNAi agent is modified; The modification is selected from any one or more of the following: locked nucleic acid modification, open ring or non-locked nucleic acid modification, 2'-methoxyethyl modification, 2'-O-methyl modification, 2'-O-allyl modification, 2'-C-allyl modification, 2'-fluoro modification, 2'-deoxy modification, phosphorothioate backbone modification, DNA modification, and lipophilic modification.
2. The double-stranded RNAi agent according to claim 1, wherein the sense strand of the double-stranded RNAi agent comprises the nucleotide sequence of UAGCUGUAGAAAUGUAUCCUG (SEQ ID NO: 1) or consists of the sequence shown in SEQ ID NO: 1, and the antisense strand comprises the nucleotide sequence of CAGGAUACAUUUCUACAGCUAGC (SEQ ID NO: 2) or consists of the sequence shown in SEQ ID NO: 2; or The sense strand of the double-stranded RNAi agent includes the nucleotide sequence of AGCUGUAGAAAUGUAUCCUGA (SEQ ID NO: 3) or consists of the sequence shown in SEQ ID NO: 3, and the antisense strand includes the nucleotide sequence of UCAGGAUACAUUUCUACAGCUAG (SEQ ID NO: 4) or consists of the sequence shown in SEQ ID NO:
4.
3. The double-stranded RNAi agent according to claim 2, wherein: The modification methods of the double-stranded RNAi agent include: (1) sense strand: 19-23 nt in length, such as 19, 20, 21, 22 or 23 nt; composed of alternating 2'-O-methyl modified regions and 2'-fluoro modified regions, the number of consecutive nucleotides in each modified region being any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides; the modification mode of the first modified region from the 5' end and the 3' end is the same; and (2) Antisense strand: 19-25 nt in length, such as 19, 20, 21, 22, 23, 24 or 25 nt; composed of alternating 2'-O-methyl modified regions, 2'-fluoro modified regions, unmodified regions and / or DNA regions, with the length of consecutive nucleotides in each modified region being any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides; the modification mode of the first modified region from the 5' end and the 3' end is the same; In the sense strand and the antisense strand, the continuous nucleotide region from the 1st to 2nd, 1st to 3rd, 1st to 4th, 1st to 5th, 1st to 6th, or 1st to 7th positions from the 5' end, and the continuous nucleotide region from the 3' end The continuous nucleotide region from positions 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, or 1 to 7 from the 5' end are all connected by a thiophosphate backbone; preferably, the continuous nucleotide region from positions 1 to 3 from the 5' end and the continuous nucleotide region from positions 1 to 3 from the 3' end are all connected by a thiophosphate backbone.
4. The double-stranded RNAi agent according to any one of claims 1 to 3, wherein The lipophilic modification is one or more lipophilic moieties conjugated to one or more nucleotides on at least one strand of the double-stranded RNAi agent, wherein the lipophilic moiety is selected from a saturated or unsaturated straight or branched C4-C30 hydrocarbon chain, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O (hexadecyl) glycerol, geranyloxyhexanol, glycerol, borneol, menthol, 1,3-propylene glycol, palmitic acid, myristic acid, dimethoxytrityl or phenoxazine.
5. The double-stranded RNAi agent according to claim 4, wherein The one or more lipophilic moieties are conjugated to one or more of the following positions in the nucleotide: counting from the 5' end of each chain, positions 4-8 and 13-18 on the sense chain, and positions 6-10 and 15-18 on the antisense chain; the conjugation is connected to the base or to the sugar ring; preferably the lipophilic moiety is connected to the sugar ring; further preferably the lipophilic moiety is connected to the 2' position of the sugar ring.
6. The double-stranded RNAi agent according to claim 5, wherein the one or more lipophilic moieties are conjugated to the 6th, 7th, and / or 8th nucleotide from the 5' end of the sense strand.
7. The double-stranded RNAi agent according to claim 5 or 6, wherein the lipophilic moiety is a hexadecyl group linked to 2'-O.
8. The double-stranded RNAi agent according to claim 6 or 7, wherein: The 5'-terminal nucleotide of the antisense strand has a vinyl phosphate attached to its 5'-position.
9. The double-stranded RNAi agent according to any one of claims 1 to 8, comprising a modification motif selected from any one of the following: (1) Sense chain: NmsNmsNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm, Antisense strand: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (2) Sense chain: NmsNmsNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm, Antisense strand: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; (3) Sense chain: NmsNmsNmNmNmN(hd)NfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm, Antisense strand: NmsNfsNmNmNmNfNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; and (4) Sense chain: NmsNmsNmNmNmN(hd)NfNmNfNfNfNmNmNmNmNmNmNmNmNmsNmsNm, Antisense strand: NmsNfsNmNmNmNmNmNmNmNmNmNmNmNmNfNmNfNmNmNmNmNmsNmsNm; in, Nm represents a ribonucleotide modified with 2'-O-methyl; Nf represents a ribonucleotide modified with 2'-fluoro; (s) represents that the two nucleotides before and after are connected by a phosphorothioate backbone; N(hd) represents a ribonucleotide modified with 2'-O-C16.
10. The double-stranded RNAi agent according to any one of claims 1 to 9, comprising one or more selected from the following: (1) a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO:5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO:6) and corresponding modifications; (2) a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO:5) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO:7) and corresponding modifications; (3) a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications; and a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, 100% identity to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications. The antisense strand consists of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and corresponding modifications; and (4) a sense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and corresponding modifications, and an antisense strand consisting of a nucleotide sequence having at least 90%, preferably 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleotide sequence UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and corresponding modifications; in, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) represents that the two nucleotides are connected by a phosphorothioate backbone.
11. The double-stranded RNAi agent according to claim 10, wherein the nucleic acid sequence comprises any one or more selected from the following: (1) the sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and an additional 0-5 nucleotides at the 5' and / or 3' end; (2) the sense strand nucleic acid sequence consists of UmsAmsGmCmUmGmUfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 5) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and an additional 0-5 nucleotides at the 5' and / or 3' end; (3) the sense strand nucleotide sequence consists of AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 8) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO:9) and an additional 0-5 nucleotides at the 5' and / or 3' end; (4) The nucleotide sequence of the sense strand is AmsGmsCmUmGmUmAfGmAfAfAfUmGmUmAmU mCmCmUmsGmsAm (SEQ ID NO: 8) and 0-5 additional nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and an additional 0-5 nucleotides at the 5' and / or 3' end; (5) the sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUfAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 6) and an additional 0-5 nucleotides at the 5' and / or 3' end; (6) the sense strand nucleotide sequence consists of UmsAmsGmCmUmG(hd)UfAmGfAfAfAmUmGmUmAmUmCmCmsUmsGm (SEQ ID NO: 11) and 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of CmsAfsGmGmAmUmAmCmAmUmUmUmCmUfAmCfAmGmCmUmAmsGmsCm (SEQ ID NO: 7) and an additional 0-5 nucleotides at the 5' and / or 3' end; (7) the sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAfUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 9) and an additional 0-5 nucleotides at the 5' and / or 3' end; and (8) the sense strand nucleotide sequence consists of AmsGmsCmUmGmU(hd)AfGmAfAfAfUmGmUmAmUmCmCmUmsGmsAm (SEQ ID NO: 12) and another 0-5 nucleotides at the 5' and / or 3' end, The antisense strand nucleotide sequence consists of UmsCfsAmGmGmAmUmAmCmAmUmUmUmCfUmAfCmAmGmCmUmsAmsGm (SEQ ID NO: 10) and an additional 0-5 nucleotides at the 5' and / or 3' end; in, Am, Um, Cm and Gm represent 2'-O-methyl modified ribonucleotides A, U, C and G, respectively; Af, Uf, Cf and Gf represent 2'-fluoro modified ribonucleotides A, U, C and G, respectively; (s) It indicates that the two nucleotides before and after are connected by a phosphorothioate backbone; G(hd) and U(hd) respectively represent G and U modified by 2'-O-C16. 12 . The double-stranded RNAi agent according to claim 10 , wherein the nucleic acid sequence thereof is formed by linking vinyl phosphate to the 5′ position of the 5′ terminal nucleotide of the antisense strand in the double-stranded RNAi agent according to claim 10 .
13. The double-stranded RNAi agent according to claim 6 or 7, wherein: The sense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO:12; the antisense strand structure of the double-stranded RNAi agent is shown in SEQ ID NO:10 or SEQ ID NO:
13.
14. A biomaterial, which is: (A) a reagent or a kit comprising the double-stranded RNAi agent according to any one of claims 1 to 13; or (B) A pharmaceutical composition, consisting of the double-stranded RNAi agent according to any one of claims 1 to 13 and other pharmaceutically acceptable components.
15. A use of a double-stranded RNAi agent, selected from any one of the following groups: (I) Use of the double-stranded RNAi agent according to any one of claims 1 to 13 or the biomaterial according to claim 14 in inhibiting sod1 gene expression or preparing a product for inhibiting sod1 gene expression; (II) Use of the double-stranded RNAi agent according to any one of claims 1 to 13 or the biomaterial according to claim 14 in reducing sod1 mRNA expression or SOD1 protein concentration in different brain region tissues and spinal cord, or in the preparation of a product for reducing sod1 mRNA expression or SOD1 protein concentration in different brain region tissues and spinal cord; (III) Use of the double-stranded RNAi agent according to any one of claims 1 to 13 or the biomaterial according to claim 14 in preventing and / or treating a disease mediated by a mutated sod1 gene, or in preparing a product for preventing and / or treating a disease mediated by a mutated sod1 gene; (IV) Use of the double-stranded RNAi agent according to any one of claims 1 to 13 or the biomaterial according to claim 14 for alleviating the symptoms of a disease mediated by a mutated sod1 gene, or for preparing a product for alleviating the symptoms of a disease mediated by a mutated sod1 gene; The diseases mediated by the mutated sod1 gene described in (III) and (IV) above include amyotrophic lateral sclerosis (ALS) or neurodegenerative diseases.