Application of reagents for inhibiting or detecting exosomal miR-3150a-5p expression and therapeutic drugs and prognostic agents for nasopharyngeal carcinoma metastasis

Abstract

The present invention belongs to the technical field of tumor molecular biology, and discloses an application of a reagent for inhibiting or detecting the expression of exosome miR-3150a-5p, as well as a drug for treating nasopharyngeal carcinoma metastasis and a prognostic preparation. The present invention found that the expression level of miR-3150a-5p in the serum exosomes of patients with nasopharyngeal carcinoma metastasis was significantly higher than that of patients without metastasis, and the area under the AUC curve was 0.84, the diagnostic sensitivity could reach 78%, and the specificity could reach 83%. It was confirmed that miR-3150a-5p has good application prospects in the prognosis of nasopharyngeal carcinoma patients. In addition, it was found that knocking down miR-3150a-5p significantly inhibited the expression of miR-3150a-5p in nasopharyngeal carcinoma cells and their secreted exosomes, and could effectively inhibit malignant progression such as nasopharyngeal carcinoma cell metastasis. This suggests the feasibility of using miRNA inhibitor to target and knock down miR-3150a-5p for the treatment of nasopharyngeal carcinoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor molecular biology, and specifically relates to the application of reagents for inhibiting or detecting exosome miR-3150a-5p expression, as well as nasopharyngeal carcinoma metastasis treatment drugs and prognostic preparations. Background Art

[0002] Nasopharyngeal carcinoma (NPC) originates in the nasopharyngeal epithelium and is the most common malignant tumor of the head and neck. The risk factors for NPC involve genetics, environment, and lifestyle factors, including Epstein-Barr virus infection, smoking, alcohol consumption, genetic factors, dietary habits, and certain chemicals and radiation.

[0003] The World Health Organization defines NPC as three types: keratinizing, non-keratinizing squamous cell carcinoma, and undifferentiated or poorly differentiated carcinoma. Among them, the non-keratinizing subtype of NPC accounts for more than 95% of tumors in endemic areas. Due to the lack of obvious early symptoms of the lesion and the high invasiveness and metastatic potential of NPC, more than 70% of patients are found to have lymph node metastasis at the initial diagnosis, and approximately 20-30% of patients develop distant metastasis, mainly to the lungs, liver, bones, etc. Although radiotherapy combined with chemotherapy can effectively control local lesions, reduce mortality, and improve the 5-year overall survival rate, the treatment effect of patients with distant metastasis is still unsatisfactory, and distant metastasis remains the main reason for clinical treatment failure.

[0004] Exosomes are small, cup-shaped, double-membrane vesicles secreted by nearly all mammalian cells. They circulate in body fluids such as blood and can be released directly into biological fluids by interacting directly with the extracellular matrix. They deliver their contents to recipient cells, impacting their biological functions. Tumor exosomes carry biological information derived from tumor cells (proteins, DNA, microRNA, etc.). The concentration of their contents correlates with the invasiveness of tumor cells and the tumor microenvironment. Analysis of surface markers or internal components within exosomes can directly reveal essential cellular information. Because exosomes are protected by a lipid membrane, their contents are resistant to degradation, allowing analysis of both fresh and long-stored samples. MicroRNAs are present within exosomes and can be released from tumor cells into body fluids through exosome encapsulation, protecting them from degradation by ribosomal enzymes. Importantly, exosomes can be obtained from a wide range of body fluids (blood, urine, etc.), making exosome testing a promising approach for cancer diagnosis and treatment, making it an ideal "liquid biopsy" method.

[0005] Therefore, there is an urgent need to develop new, reliable, non-invasive, and prognostic markers for early metastasis diagnosis to promote early, precise intervention and treatment of NPC and prolong the survival of NPC patients. Patent application CN118086492A discloses that miR-376a-5p is expressed at significantly higher levels in the blood of NPC patients than in healthy controls, suggesting its potential as a miRNA marker for NPC diagnosis and a therapeutic target. This invention not only develops a new prognostic marker for NPC, miR-3150a-5p, but also derives it from exosomes, unlike the blood-derived marker described in the patent application. Summary of the Invention

[0006] To address the problems of the existing technologies, the present invention provides the use of reagents for inhibiting or detecting exosomal miR-3150a-5p expression, as well as therapeutic and prognostic agents for nasopharyngeal carcinoma metastasis. The present invention utilizes exosomal miR-3150a-5p as a marker for predicting nasopharyngeal carcinoma metastasis risk. By analyzing its expression, rapid auxiliary prognostic testing for nasopharyngeal carcinoma can be achieved. Furthermore, miR-3150a-5p can serve as a therapeutic target, and targeted inhibition of its expression can achieve treatment for nasopharyngeal carcinoma patients, thus promising broad application prospects.

[0007] The nucleotide sequence of miR-3150a-5p described in the present invention is CAACCUCGACGAUCUCCUCAGC.

[0008] One of the purposes of the present invention is to provide an application of a reagent for inhibiting the expression of exosomal miR-3150a-5p for the preparation of a drug for treating nasopharyngeal carcinoma.

[0009] Furthermore,

[0010] The reagent for inhibiting the expression of exosome miR-3150a-5p includes a miR-3150a-5p inhibitor.

[0011] Furthermore,

[0012] The miR-3150a-5p inhibitior sequence is GCUGAGGAGAUCGUCGAGGUUG.

[0013] A second object of the present invention is to provide a drug for treating nasopharyngeal carcinoma metastasis, including an agent for inhibiting the expression of exosomal miR-3150a-5p.

[0014] Furthermore,

[0015] The reagent for inhibiting the expression of exosome miR-3150a-5p includes a miR-3150a-5p inhibitor.

[0016] Furthermore,

[0017] The miR-3150a-5p inhibitior sequence is GCUGAGGAGAUCGUCGAGGUUG.

[0018] A third objective of the present invention is to provide a reagent for detecting exosomal miR-3150a-5p expression for use in the preparation of a prognostic agent for nasopharyngeal carcinoma metastasis. By detecting the expression level of exosomal miR-3150a-5p in nasopharyngeal carcinoma patients, it can assist in the diagnosis and / or assessment of the risk of early metastasis of nasopharyngeal carcinoma.

[0019] Furthermore,

[0020] The reagent for detecting the expression of exosomal miR-3150a-5p includes a PCR detection reagent.

[0021] Furthermore,

[0022] The amplification primer sequences in the PCR detection reagent are: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

[0023] Preferably, the test sample is serum exosomes.

[0024] A fourth object of the present invention is to provide a nasopharyngeal carcinoma metastasis prognosis preparation, including a reagent for detecting exosomal miR-3150a-5p expression.

[0025] The reagent for detecting exosomal miR-3150a-5p expression includes a PCR detection reagent.

[0026] Furthermore,

[0027] The amplification primer sequences in the PCR detection reagent are: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

[0028] Preferably, the test sample is serum exosomes.

[0029] Through clinical serum exosome miRNA sequencing and TCGA database analysis, the present invention found that the expression of miR-3150a-5p in patients with nasopharyngeal carcinoma metastasis was significantly higher than that in patients without metastasis, which can be used as a reliable marker for predicting the risk of nasopharyngeal carcinoma metastasis and poor prognosis.

[0030] The present invention achieves rapid auxiliary diagnosis of early metastasis of nasopharyngeal carcinoma through a kit for specific amplification of miR-3150a-5p and serum sample detection. The area under the curve (AUC) calculated and analyzed is 0.84, with a sensitivity of 78% and a specificity of 83%.

[0031] The present invention designed an inhibitor sequence (GCUGAGGAGAUCGUCGAGGUUG) based on miR-3150a-5p and found that targeted knockdown of this miRNA can significantly inhibit the proliferation, migration and invasion of nasopharyngeal carcinoma cells, indicating that it has the potential to be developed as a drug for the treatment of nasopharyngeal carcinoma.

[0032] Detecting miR-3150a-5p expression levels in serum exosomes for auxiliary diagnosis and risk prediction of nasopharyngeal carcinoma metastasis. Designing primers and developing kits based on this miRNA, as well as specific applications in clinical diagnosis. Inhibiting miR-3150a-5p expression through specific inhibitor sequences for the treatment of nasopharyngeal carcinoma. This includes drug development and therapeutic applications using miRNA inhibitors or other vectors (such as nucleic acid drugs and bioactive fragments).

[0033] Possible design changes or variations of the present invention include:

[0034] (1) Combined detection of multiple miRNAs

[0035] The diagnostic function of a single miRNA may be replaced by a combination of miR-3150a-5p and other miRNAs (such as multi-marker combined detection) to improve sensitivity and specificity.

[0036] (2) Improvement of sample sources

[0037] The present invention is based on the detection of serum exosome samples. Possible variations include the use of other biological samples such as saliva, urine, tissue biopsy, and plasma as detection sources to achieve non-invasive or diversified diagnostic solutions.

[0038] (III) Design of alternative inhibitors

[0039] The present invention utilizes the miR-3150a-5p inhibitor sequence to inhibit the miRNA, and other forms of miRNA inhibitors such as small molecule compounds, antisense oligonucleotides (ASOs), and siRNAs may also be designed.

[0040] Beneficial effects of the present invention

[0041] The advantages of the present invention are as follows: The present invention found that the expression level of miR-3150a-5p in the serum exosomes of patients with nasopharyngeal carcinoma metastasis was significantly higher than that of patients without metastasis. The area under the AUC curve was calculated to be 0.84, and the diagnostic sensitivity of miR-3150a-5p could reach 78% and the specificity could reach 83%. This confirms that the miR-3150a-5p gene has good application prospects in the diagnosis and prognosis of nasopharyngeal carcinoma patients. In addition, it was found that knocking down miR-3150a-5p significantly inhibited the expression of miR-3150a-5p in nasopharyngeal carcinoma cells and their secreted exosomes, and could effectively inhibit the malignant progression of nasopharyngeal carcinoma cells, such as metastasis. The above findings demonstrate the importance of miR-3150a-5p to nasopharyngeal carcinoma and suggest the feasibility of using miRNA inhibitors to target and knock down miR-3150a-5p for nasopharyngeal carcinoma treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 : MiRNA sequencing analysis of serum exosomes in 5 patients with high metastasis risk and 5 patients with low metastasis risk nasopharyngeal carcinoma;

[0043] Figure 1 A: Scatter plot of miRNA sequencing in exosomes from serum samples of nasopharyngeal carcinoma patients; Figure 1 B: Heat map of the expression levels of the eight most significantly upregulated and four downregulated miRNAs in exosome miRNA sequencing of serum samples from NPC patients;

[0044] Figure 2 : Overall survival analysis of three candidate exosomal miRNAs expression in head and neck cancer (HNSC) using the TCGA database;

[0045] Figure 2 A: Overall survival analysis of candidate exosomal miR-205-5p expression in head and neck cancer (HNSC) using the TCGA database; Figure 2 B: Overall survival analysis of candidate exosomal miR-885-5p expression in head and neck cancer (HNSC) using the TCGA database; Figure 2 C: Overall survival analysis of candidate exosomal miR-3150a-5p expression in head and neck cancer (HNSC) using the TCGA database;

[0046] Figure 3 : TCGA database analysis of miR-3150a-5p expression differences in normal tissues and HNSC tissues;

[0047] Figure 4 : Receiver operating characteristic (ROC curve) of exosomal miR-3150a-5p in differentiating patients with metastatic nasopharyngeal carcinoma from those without metastatic nasopharyngeal carcinoma;

[0048] Figure 5 :The expression of miR-3150a-5p gene in nasopharyngeal carcinoma cell line 5-8F before and after treatment with miR-3150a-5p inhibitor;

[0049] Figure 6 :Analysis of proliferation ability of nasopharyngeal carcinoma cell 5-8F before and after treatment with miR-3150a-5p inhibitor;

[0050] Figure 7 : Analysis of migration and invasion ability of nasopharyngeal carcinoma cell 5-8F before and after treatment with miR-3150a-5p inhibitor. DETAILED DESCRIPTION

[0051] Unless otherwise specified, the reagents, kits, raw materials, and equipment used in the following examples can all be purchased from commercial sources. The experiments or detection methods involved in this invention, unless otherwise specified, are all conventional in the art, or are performed with reference to the corresponding kits or product instructions.

[0052] Example 1: Screening of characteristic miRNAs of metastatic nasopharyngeal carcinoma based on serum exosome miRNA sequencing of clinical patients:

[0053] Clinical serum sample collection and sequencing:

[0054] Serum specimens were collected from five patients with NPC at high metastatic risk (no metastases at initial diagnosis but developing distant metastases after radical treatment) and five patients with low metastatic risk (no metastases at initial diagnosis and no metastasis or recurrence during follow-up after radical treatment) and stored in 1.5 mL EP tubes at -80°C. Patients met the following inclusion criteria: primarily pathologically confirmed NPC; stratification was based on the presence or absence of distant metastases, with the metastatic group requiring clear evidence of distant metastases (e.g., imaging or histological diagnosis) and the non-metastatic group requiring no distant metastases; basic information for all cases was complete; and serum from all NPC patients was collected at the time of diagnosis but before receiving any chemotherapy, radiotherapy, or surgery. The serum samples were shipped on dry ice to RiboBiotechnology (Guangzhou, China) for EV extraction and miRNA isolation, followed by miRNA sequencing using an Illumina HiSeq™ 2500 genome sequencer.

[0055] A volcano plot was drawn with |log2(Fold Change)|≥2 as the threshold and P<0.05 to show the expression differences of miRNAs. Red dots indicate miRNAs that were upregulated in the serum of patients with metastatic NPC, blue dots indicate miRNAs that were downregulated in the serum of patients with metastatic NPC, and gray dots indicate no statistical significance ( Figure 1 A); 12 miRNAs with P < 0.001 were selected for heat map analysis, and it was found that the expression of three miRNA molecules, miR-205-5p, miR-885-5p, and miR-3150a-5p, was significantly higher in the NPC group with metastasis than in the NPC group without metastasis ( Figure 1 B). Clinical sample information is shown in Table 1.

[0056]

[0057] Example 2 Analysis of the correlation between candidate exosomal miRNAs and patient prognosis based on the TCGA database:

[0058] Data mining and analysis of head and neck squamous cell carcinoma (HNSC) patient samples using the TCGA (The Cancer Genome Atlas) database were performed to investigate the relationship between miR-205-5p, miR-885-5p, and miR-3150a-5p expression levels and patient prognosis. Clinical and miRNA expression data of HNSC patients were downloaded from the TCGA database. After data processing, overall survival (OS) and miRNA expression levels were used as analysis indicators. Patients were divided into high and low miRNA expression groups based on miRNA expression levels (high expression group and low expression group), with the median as the cutoff. Overall survival (OS) was estimated using the Kaplan-Meier survival analysis method, and survival curves were plotted using GraphPad Prism 9.5 software.

[0059] Further survival analysis showed that patients with high expression of miR-205-5p and miR-885-5p had a longer overall survival time, suggesting that their high expression was positively correlated with a better prognosis; whereas patients with high expression of miR-3150a-5p had a significantly shorter overall survival time, showing a negative correlation ( Figure 2 Based on this result, miR-3150a-5p was selected as the research object in this example. Further analysis of miR-3150a-5p expression was performed using the TCGA database, and it was found that the expression of miR-3150a-5p in head and neck squamous cell carcinoma tissues was higher than that in normal tissues (P < 0.05) ( Figure 3 ).

[0060] Example 3 Analysis of the diagnostic value of miR-3150a-5p gene in a large group of nasopharyngeal carcinoma patients:

[0061] (1) Clinical serum sample collection

[0062] In addition, serum specimens were collected from 59 patients with NPC at high metastatic risk (no metastases at initial diagnosis but development of distant metastases after radical treatment) and 60 patients with low metastatic risk (no metastases at initial diagnosis and no metastasis or recurrence during follow-up after radical treatment) and stored in 1.5 mL EP tubes at -80°C. Clinical specimen information is shown in Table 2.

[0063]

[0064] (2) Extraction of exosomes

[0065] Remove the serum from the refrigerator and thaw on ice. Add 1 / 3 volume of RiboTM serum exosome extraction reagent and vortex to mix. After standing at 4°C for 60 minutes, centrifuge at 12000g at 4°C for 20 minutes. A yellow-white precipitate should be visible at the bottom of the tube. Carefully remove all the supernatant. Add an appropriate amount of PBS solution to the centrifuge tube and mix thoroughly to obtain the exosome-rich solution.

[0066] (3) RNA isolation and extraction

[0067] Total RNA was extracted using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). The internal reference cel-miR-39-3p was added to the collected exosome pellet. In a clean bench, 1 mL of the total RNA extraction reagent TRnaZol Reagent from the kit was added. The solution was allowed to stand for 2 minutes, then pipetted and mixed thoroughly. The mixture was then transferred to a new 1.5 mL EP tube and the subsequent steps were the same. One-fifth of the RNA Extraction Buffer was added to the above solution. The tube was vigorously shaken for 15 seconds until a uniform pink liquid appeared. The solution was allowed to stand at room temperature for 5 minutes and then centrifuged at 12,000 g at 4°C for 20 minutes. A pink organic phase was observed at the bottom, a white substance was observed in the middle, and a colorless aqueous phase was observed at the top. Transfer as much of the upper aqueous phase as possible to a new 1.5 mL RNase-free EP tube. Add an equal volume of isopropanol to the colorless aqueous phase in the EP tube, mix thoroughly by inversion, let stand at room temperature for 15 minutes, and centrifuge at 12,000 g at 4°C for 15 minutes. Carefully aspirate the supernatant. A translucent precipitate, representing the extracted RNA, should be observed at the bottom of the tube. Wash the precipitate with 75% ethanol prepared with DEPC-treated sterile ddH2O. Add an equal volume of 75% ethanol to the volume of TRnaZol Reagent used, and centrifuge at 8,000 g at 4°C for 5 minutes. Discard the supernatant and air-dry the precipitate at room temperature for 10 minutes. Add 20-50 μL of RNase-free water to fully dissolve the RNA. After measuring the concentration, store the sample at -80°C or use it directly for reverse transcription.

[0068] (IV) Real-time quantitative PCR

[0069] Exosomal RNA extracted from serum was reverse transcribed into cDNA using the Mir-X miRNA First-Strand Synthesis Kit (638315, TaKaRa) under the following reaction conditions: 1) 37°C for 1 hour, 2) 85°C for 5 minutes. qRT-PCR was then performed using SYBRGreen PCR Master Mix (B21203, Bimake) in a total volume of 20 μL, containing 5 μL of cDNA (10 ng / μL), and performed on a CFX96 Real Time System (Bio-Rad) according to the manufacturer's instructions. Initial denaturation was performed at 95°C for 10 minutes, followed by cycling for 45 cycles of 1) 95°C for 2 seconds, 2) 60°C for 20 seconds, and 3) 70°C for 10 seconds. Melting curve analysis was then performed to assess PCR specificity. cel-miR-39-3p was used as an exogenous control. Reactions were measured in triplicate. The expression levels of candidate miRNAs were measured using 2- ΔΔCt The sensitivity and specificity of the method were calculated using the area under the curve (AUC). The primer sequences are shown in Table 3.

[0070]

[0071] In this example, all subjects participating in the experiment were randomly divided into a training cohort and a validation cohort at a ratio of 7:3. The sensitivity and specificity were calculated by the area under the AUC curve. Figure 4 As shown, miR-3150a-5p is generally highly expressed in NPC patients, with an area under the curve (AUC) of 0.84, indicating a diagnostic sensitivity of 78% and a specificity of 83%. This experimental data analysis further confirms the promising application of miR-3150a-5p in the diagnosis of early metastasis in NPC patients.

[0072] Example 4 Analysis of the improvement of nasopharyngeal carcinoma by inhibiting the expression of miR-3150a-5p:

[0073] (1) Preparation of experimental materials:

[0074] Human nasopharyngeal carcinoma cells 5-8F with high metastatic potential were activated in RMPI-1640 culture medium containing 10% FBS, subcultured at 37° C. and 5% CO 2 for later use.

[0075] (2) Test methods

[0076] (1) Design of miR-3150a-5p inhibitor fragment: The siRNA sequence was synthesized at Guangzhou Ruibo Company, where the inhibitor sequence was GCUGAGGAGAUCGUCGAGGUUG; the negative control sequence was CAGUACUUUUGUGUAGUACAAA.

[0077] (2) Cell transfection: Experimental group: 5-8F cells were transfected with miR-3150a-5p inhibitor, and the control group was transfected with miR-3150a-5p inhibitor. The transfection was carried out according to the instructions of the transfection reagent Lipo 3000. After 48 hours of transfection, the cells and cell culture supernatant were collected.

[0078] (3) Verification of inhibition efficiency: 1) Cell level: Total RNA was extracted from cells using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). For specific analysis methods, please refer to the kit instructions. 2) Exosome level: Exosome extraction: The culture supernatant of cells in the logarithmic growth phase was collected and centrifuged at 2000 g for 15 min at 4°C. The supernatant was transferred to a new centrifuge tube, and 1 / 4 exosome extraction reagent (EXOTC10A-1, SBI) was added and vortexed. After standing at 4°C for 4 h, the tube was centrifuged at 13000 rpm for 60 min at 4°C. The supernatant was removed and the precipitate was collected as exosomes. Exosome total RNA was extracted using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). For specific analysis methods, please refer to the kit instructions. The exosome RNA in the cells and the cell culture supernatant was extracted according to the above steps, and then the expression level of miR-3150a-5p in the exosomes in the cells and the cell culture supernatant was detected by real-time quantitative PCR method in Example 3.

[0079] (4) Cell proliferation analysis: The proliferation capacity of 5-8F cells before and after inhibitor transfection was analyzed using the CCK8 cell proliferation kit (C0005, Targetmol). For specific analysis methods, please refer to the kit instructions.

[0080] (5) Cell invasion and migration assay: 48 h after inhibitor transfection, the experimental and control cells were collected, resuspended in complete culture medium, and the cells were counted. 200 μL of cell suspension (containing serum-free RMPI-1640 culture medium, approximately 5 × 10 cells per well) was added to the Transwell chambers without or with Matrigel. 4Cells were cultured in a 24-well cell culture plate (100 μL). 600 μL of RMPI-1640 culture medium containing 20% ​​FBS was added to the lower chamber. The cells were cultured at 37°C, 5% CO2, and saturated humidity for 24 hours. The chamber was removed, the culture medium in the 24-well plate discarded, and the cells inside the chamber were gently wiped clean with a sterile cotton swab. The cells were fixed with 1 mL of 4% paraformaldehyde for 10 minutes, followed by 600 μL of 0.1% crystal violet staining solution and stained for 10 minutes. Cells were photographed and counted using an inverted microscope.

[0081] result Figure 5 It can be seen that the inhibitor fragment that inhibits the expression of miR-3150a-5p can significantly reduce the expression of miR-3150a-5p in human nasopharyngeal carcinoma cell 5-8F, and significantly reduce the expression of miR-3150a-5p in human nasopharyngeal carcinoma cell 5-8F exosomes, and the cell proliferation ability is also significantly reduced ( Figure 6 ). In addition, after inhibiting the expression of miR-3150a-5p, the number of 5-8F cells undergoing migration and invasion was significantly reduced ( Figure 7 ), suggesting that inhibition of miR-3150a-5p expression can significantly inhibit the migration and invasion ability of nasopharyngeal carcinoma cells.

[0082] The above results show that the inhibitor targeting miR-3150a-5p provided by the present invention has a good inhibitory effect and can significantly inhibit the proliferation, invasion and migration ability of nasopharyngeal carcinoma cells after transfection, and has a broad application prospect.

Claims

1. The use of a reagent for inhibiting the expression of exosome miR-3150a-5p, characterized in that: Used for preparing drugs for treating nasopharyngeal carcinoma; the reagent for inhibiting exosome miR-3150a-5p expression includes miR-3150a-5p inhibitior; the sequence of miR-3150a-5p inhibitior is GCUGAGGAGAUCGUCGAGGUUG.

2. The application of a reagent for detecting the expression of exosome miR-3150a-5p is characterized in that: Used to prepare a prognostic preparation for nasopharyngeal carcinoma metastasis; the reagent for detecting the expression of exosomal miR-3150a-5p includes a PCR detection reagent; the amplification primer sequence in the PCR detection reagent is: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

Images