Biologically related orthogonal cytokine / receptor pairs
By designing engineered orthogonal cytokine receptor/ligand pairs, the problem of T cells being difficult to accurately manipulate in adoptive immunotherapy is solved, and the specific activation and survival of T cells is achieved, avoiding the impact of endogenous signaling.
Patent Information
- Application Number
- CN202510224041.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2018-03-09
- Filing Date
- 2019-03-08
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to achieve precise manipulation of T cells in adoptive immunotherapy, especially in activating, amplifying and other behaviors, and it is difficult to avoid the impact of endogenous signaling.
Design and implement engineered orthogonal cytokine receptor/ligand pairs to create ligand-receptor pairs that significantly reduce binding to native cytokines or receptors through amino acid alteration and selective binding methods, thereby introducing orthogonal receptors in T cells to modify cells and implement specific signaling.
Accurate manipulation of T cells is achieved, specific activity and survival in vivo is ensured, the influence of non-targeted cells is avoided, and controllable biological activity simulates natural responses.
Smart Images

Figure BDA0005289610970000071 
Figure BDA0005289610970000081 
Figure BDA0005289610970000441
Abstract
Description
[0001] This application is a divisional application of the patent application for invention with the application number 201980031023.X. The filing date of the original application is March 8, 2019, and the invention title is: Orthogonal Cytokine / Receptor Pairs Related to Biology.
[0002] Cross - References
[0003] This patent application claims the priority of U.S. Provisional Patent Application Serial No. 15 / 916,689, filed on March 9, 2018, the entire disclosure of which is incorporated herein by reference.
[0004] Federally Sponsored Research and Development
[0005] This invention was made with government support under grant number AI513210 from the National Institutes of Health. The government has certain rights in the invention. Technical Field
[0006] The present invention relates to engineered orthogonal cytokine receptor / ligand pairs and methods of using the same. Background Art
[0007] Manipulating cells, especially immune cells, to differentiate, develop specific functions, and expand cell numbers is of clinical significance. Many protein factors that affect these activities are known in the art, particularly cytokines and chemokines. However, these signaling molecules also have pleiotropic effects on non - targeted cells, so methods for selectively activating signal transduction in target cell populations are needed. In particular, engineering T cells for controlled behavior is meaningful. For example, in adoptive immunotherapy, T cells are isolated from the blood, processed ex vivo, and re - infused into the patient. T cells have been engineered for therapeutic applications, such as recognizing and killing cancer cells, intracellular pathogens, and cells involved in autoimmunity.
[0008] A key challenge in cell - based therapies is engineering desired behaviors, such as activation, expansion, etc., in adoptively transferred cells, which are protected from endogenous signaling pathways, do not affect non - targeted endogenous cells, and can be controlled in the patient receiving the administration. This is particularly relevant to T - cell engineering because developmental plasticity and environmental factors have a great impact on determining T - cell fate, function, and localization.
[0009] The ability to engineer proteins to bind and respond to modified ligands in a manner independent of or orthogonal to the influence of natural proteins or ligands poses a significant challenge in protein engineering. To date, many synthetic ligand-direct homolog-receptor pairs that are orthogonal to similar natural interactions have been generated. Proteins used in this study have included nuclear hormone receptors and G protein-coupled receptors. Despite extensive work to design receptors activated by synthetic small molecule ligands, the engineering of biologically relevant protein pairs remains a significant challenge. SUMMARY OF THE INVENTION
[0010] The present invention provides engineered orthogonal cytokine receptor / ligand pairs and methods of using the same. Engineered (orthogonal) cytokines specifically bind to corresponding engineered (orthogonal) receptors. Upon binding, the orthogonal receptors activate signal transduction that is transduced by native cellular elements to provide a biological activity that mimics the native response but is specific to engineered cells expressing the orthogonal receptor. The orthogonal receptors exhibit significantly reduced binding to endogenous corresponding cytokines, including the natural pairings of orthogonal cytokines, while the orthogonal cytokines exhibit significantly reduced binding to any endogenous receptor, including the natural pairings of orthogonal receptors. In some embodiments, the affinity of the orthogonal cytokine for the orthogonal receptor is comparable to the affinity of the native cytokine for the native receptor.
[0011] Methods of designing orthogonal cytokine-receptor pairs can include the steps of: (a) engineering amino acid changes into a native receptor to disrupt binding to a native cytokine; (b) generating a plurality of cytokine analogs that have selective amino acid changes at contact residues of the native cytokine that bind the receptor; (c) selecting a cytokine direct homolog that binds to the direct homolog receptor; (d) discarding direct homolog cytokines that bind significantly to the native receptor, or alternatively discarding steps (c) and (d); (e) selecting a receptor direct homolog that binds to the direct homolog cytokine; (f) discarding direct homolog receptors that bind to the native cytokine. In preferred embodiments, knowledge of the cytokine / receptor complex structure is used to select amino acid positions for site-directed or error-prone mutagenesis. Yeast display systems can be conveniently used for the selection process, although other display and selection methods are also useful.
[0012] In some embodiments, an engineered cell is provided, wherein the cell is modified by introducing an orthogonal receptor of the present invention. Any cell can be used for this purpose. In some embodiments, the cell is a T cell, including but not limited to naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, such as T H 1, T H 2, T H 9, T H11, T H 22, T FH ; Regulatory T cells, such as T R 1. Natural R 1. Natural T Reg , Induced T Reg ; Memory T cells, such as central memory T cells, effector memory T cells, NKT cells, γδ T cells, and engineered variants of such T cells including CAR-T cells, etc. In other embodiments, the engineered cells are stem cells, such as hematopoietic stem cells, NK cells, macrophages, or dendritic cells. In some embodiments, the cells are genetically modified in ex vivo treatment before being transferred to a subject. The engineered cells can be provided in unit doses for treatment and can be allogeneic, autologous, etc. relative to the intended recipient.
[0013] In some embodiments, a vector comprising a polynucleotide coding sequence encoding an orthogonal receptor is provided, wherein the coding sequence is operably linked to a promoter active in a desired cell. Various vectors are known in the art and can be used for this purpose, such as viral vectors, plasmid vectors, microcirculation vectors, which can integrate into the target cell genome or can be maintained episomally. The receptor-encoding vector can be provided in a kit in combination with a vector encoding an orthogonal cytokine that binds to and activates the receptor. In some embodiments, the coding sequence of the orthogonal cytokine is operably linked to a high-expression promoter and can be optimized for production. In other embodiments, a kit is provided wherein the vector encoding the orthogonal receptor provides a purified composition of the orthogonal cytokine, such as packaged in a unit dose for patient administration (e.g., a pre-filled syringe). In some other embodiments, a kit is provided wherein a vector encoding an orthogonal cytokine is provided to the vector encoding the orthogonal receptor such that the orthogonal receptor can be expressed in a cell and also express an orthogonal cytokine intended to be secreted by the same cell to achieve autocrine orthogonal cytokine receptor signaling.
[0014] In some embodiments, a method of treatment is provided that includes introducing a population of engineered cells into a receptor in need thereof, wherein the population of cells is modified by introducing a sequence encoding the orthogonal receptor of the present invention. The population of cells can be engineered ex vivo and is typically autologous or allogeneic relative to the receptor. In some embodiments, after administration of the engineered cells, the introduced population of cells contacts a cognate orthogonal cytokine in vivo. An advantage of the present invention is the lack of cross-reactivity between the orthogonal cytokine and the native receptor. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] A thorough understanding of the present invention can be obtained by reading the following detailed description in conjunction with the accompanying drawings. It should be emphasized that, according to convention, the various features of the drawings are not drawn to scale. Instead, for clarity, the dimensions of each feature may be arbitrarily enlarged or reduced. The following illustrations are included in the drawings:
[0016] Figure 1-1 (ii). Orthogonal IL-2 / IL-2 receptor controls T cell expansion.
[0017] Figure 2 . Workflow of engineered orthogonal IL-2 / IL-2Rβ pair.
[0018] Figure 3 . Sequences of orthogonal mouse IL-2Rβ variants.
[0019] Figure 4 . The mIL-2RβH134D Y135F mutation abolishes the binding of wild-type mIL-2.
[0020] Figure 5 . Workflow of engineered orthogonal IL-2 / IL-2Rβ pair.
[0021] Figure 6 . Sequences of characterized orthogonal mouse Il-2 variants.
[0022] Figure 7 . Orthogonal IL-2 variants bind to orthogonal IL-2R with an affinity similar to or greater than that of wild-type IL-2 and IL-2Rβ interactions.
[0023] Figure 8 . Orthogonal IL-2 variants exhibit blunted activity (phosphorylated STAT5) against wild-type CD25-positive and CD25-negative splenocytes
[0024] Figure 9 . Generation of mouse CTLL-2 T cells expressing orthogonal IL-2R.
[0025] Figure 10 . The first group of orthogonal IL-2 variants is selective for orthogonal T cells.
[0026] Figure 11 . Orthogonal IL-2 variants induce selective STAT5 phosphorylation on CTLL-2 cells expressing orthogonal IL-2Rβ
[0027] Figure 12 . T cells derived from primary lymph nodes are engineered to express orthogonal IL-2Rβ (H134DY135F).
[0028] Figure 13.Orthogonal IL-2 variants induce selective STAT5 phosphorylation on the orthogonal IL-2Rβ expressed in primary murine T cells.
[0029] Figure 14 .Orthogonal IL-2 variants induce selective cell growth of CTLL-2 cells expressing orthogonal IL-2Rβ compared to wild-type T cells.
[0030] Figure 15 .Alignment of murine and human reference IL-2Rβ / IL-2 sequences. A partial sequence of human IL-2Rβ is provided as SEQ ID NO:1, residues 1 - 235; a partial sequence of murine IL-2Rβ is provided as SEQ ID NO:2, residues 1 - 238. Murine IL-2 is provided as SEQ ID NO:3. Human IL-2 is provided as SEQ ID NO:4.
[0031] Figures 16A-16D .Yeast evolution of orthogonal human IL-2 pairs. ( Figure 16A )FACS analysis of yeast shows that wild-type human IL-2 binds to wild-type (blue histogram) but not to the orthogonal (red histogram) human IL-2RβH133DY134F mutant tetramer. ( Figure 16B )A library of human IL-2 mutants (~1 8 mutant) with randomized IL-2 residues predicted to be near or in contact with the human IL-2Rβ HY mutant is displayed on the yeast surface. After successive rounds of positive (against orthogonal hIL-2Rβ) and negative (against wild-type hIL-2Rβ) selection, we obtain yeast-displayed human IL-2 mutants that bind to the orthogonal (red histogram) but not to the wild-type (blue histogram) human IL-2Rβ tetramer. ( Figure 16C 、 16D )Subsequently, orthogonal hIL-2 mutants are isolated and sequenced in the yeast library. A set of common mutations is identified, indicating that the orthogonal hIL-2 sequence set is capable of binding to orthogonal hIL-2Rβ.
[0032] Figure 17. In vivo mouse model for demonstrating selective expansion or increased survival of T cells expressing orthogonal IL-2Rβ in mice. Donor cells were isolated from the spleens of wild-type C57BL / 6J mice expressing CD45.2, activated ex vivo with CD3 / CD28, transduced with a retrovirus encoding orthogonal IL-2Rβ-IRES-YFP, expanded for 2 days in 100 IU / mL mIL-2, and purified using a mouse CD8 T cell isolation kit (Miltenyi). A ~1:1 mixture of wild-type (CD45.2 positive, YFP negative) and T cells expressing orthogonal IL-2Rβ (CD45.2 positive, YFP positive) was adoptively transferred into recipient BL6.Rag2 - / - x IL2rg - / - CD45.1 mice. Immediately after T cell transfer (d0), daily intraperitoneal injections of PBS, wild-type mIL-2 (150,000 Iu / mouse), or orthogonal IL-2 clone 1G12 / 149 (1,000,000 Iu / mouse) were initiated and continued for 5 days at 24-hour intervals (up to d4). Mice were sacrificed on d5 and d7, and total donor T cells in mouse blood and spleen were quantified by flow cytometry.
[0033] Figures 18A-18B . Gating strategy for quantifying donor T cell expansion in recipient mice. Single-cell suspensions were prepared from mouse blood and spleen and stained with Cd45.2-Pacific Blue for 1 hour at 4°C to identify donor T cells. Immediately before flow cytometry, cells were incubated with 1:2000 diluted propidium iodide (PI) for live / dead exclusion. Cells were gated by FACS quantification based on forward and side scatter (SSC-A v FSC-A), single peak (FSC-A v FSC-H), live cells (PI negative), and total wild-type T cells (CD45.2 positive, YFP negative) and orthogonal T cells (CD45.2 positive, YFP positive). **p < 0.01, ***p < 0.001, ****p < 0.0001, determined by one-way ANOVA using Prism.
[0034] Figure 19 . Orthogonal IL-2 clone 1G12 / 149 selectively expands orthogonal but not wild-type T cells in mice. Blood was quantified by flow cytometry (10 3The numbers of wild-type and orthogonal T cells in the blood (cells / uL) and spleen (total number of cells per spleen) are shown as follows. 18. The ratio of orthogonal T cells to wild-type T cells was determined by dividing the total number of orthogonal T cells by the total number of wild-type T cells in the blood and spleen. A ratio greater than 1 indicates selective expansion of orthogonal T cells, achieved by orthogonal IL-2 clone 1G12 / 149. The total number of live cells in the blood (left) and spleen (right) on day 5 (top) and day 7 (bottom) was quantified by flow cytometry. Treatment with wild-type IL-2 led to the expansion of wild-type and orthogonal T cells compared to the PBS control, while treatment with orthogonal IL-2 clone 1G12 / 149 selectively expanded orthogonal T cells with limited activity against wild-type T cells.
[0035] Figures 20A-20B . Orthogonal IL-2 has selective activity against orthogonal IL-2Rβ T cells. ( Figure 20A ) Primary murine T cells derived from the spleen of IL-2KO NOD mice were isolated, and viral transfection was performed to express orthogonal IL-2Rβ. FACS analysis can be determined using an IRES-YFP reporter and surface staining of IL-2Rβ. T cells also retained the expression of wild-type IL-2Rβ ( Figure 20B ) Orthogonal IL-2 induces selective STAT5 phosphorylation on T cells expressing orthogonal IL-2Rβ and is inactive against wild-type T cells.
[0036] Figures 21A-21B . Orthogonal IL-2 selectively expands orthogonal IL-2Rβ T cells in vitro. ( Figure 21A ) FACS analysis of spleen-derived primary murine T cells transfected with virus to express orthogonal IL-2Rβ can be confirmed using IRES-YFP. A mixture of transfected and untransfected T cells was cultured for 5 days in various concentrations of wild-type, orthogonal IL-2 clone 1G12 or 3A10 and analyzed by FACS. IL-2 expands wild-type and orthogonal T cells, while only orthogonal T cells expand when cultured in orthogonal IL-2 3A10, and orthogonal IL-2 1G12 selectively expands orthogonal T cells with significantly reduced activity against wild-type T cells. The FACS plots shown correspond to cultures in 100 nM IL-2, 64 pM orthogonal IL-2 1G12, and 10 μM orthogonal IL-2 3A10. ( Figure 21B ) After culturing for 5 days in increasing concentrations of cytokines, the dose-response of wild-type and orthogonal T cell proliferation to wild-type and orthogonal IL-2 clones 1G12 and 3A10 was measured. IL-2 expands wild-type and orthogonal T cells with the same potency, orthogonal IL-2 1G12 selectively expands orthogonal T cells, and orthogonal IL-2 3A10 specifically expands orthogonal T cells.
[0037] Figures 22A-22E.Orthogonal human IL-2 signals through the orthogonal IL-2R expressed in YT cells in vitro. Dose response of STAT5 phosphorylation after 20 minutes of stimulation. Stat5 phosphorylation was measured in YT human NK cell lines expressing human CD25 (YT+), without (YFP-, WT) or with (YFP+, orthogonal) human orthogonal IL-2Rβ.( Figure 22A )Mouse serum albumin (MSA) fusions of human IL-2 or orthogonal variants( Figure 22B )1A1,( Figure 22C )1C7,( Figure 22D )SQVLKA or( Figure 22E )SQVKqA were titrated in RPMI complete medium and added to the cells. The mean fluorescence intensity (MFI) of APC-pStat5 staining of WT (YFP-) and orthogonal Rb (YFP+) cells was plotted against the concentration of the cytokine, and log(agonist) vs response (three parameters) modeling was fitted using Prism 5 (GraphPad). 1C7 was run on another day with other proteins and normalized to wild-type IL-2 staining run on two days. All data are presented as mean (n = 3) ± standard deviation.
[0038] Figures 23A-23B .Orthogonal human IL-2 preferentially expands human PBMCs expressing the orthogonal IL-2R. Human PBMCs were isolated, activated, and transduced with a retrovirus containing IRES-YFP (YFP+) of orthogonal human IL-2Rβ. The initial ratio of YFP+ cells to total live cells was 20%. On day 1, 5x10 5 cells were plated with the indicated concentrations of MSA-human IL-2 (circles) or the orthogonal variant MSA-SQVLKA (diamonds), MSA-SQVLqA (squares), or MSA-1A1 (triangles), and re-cultured at the same concentration on day 3. On day 5, the plates were read by flow cytometry.( Figure 23A )The ratio of YFP+ (orthogonal-expressing) cells to total live cells was calculated and the mean (n = 4) ± SD was plotted against the concentration (left).( Figure 23B )The total live cell count (mean (n = 4) ± standard deviation) was plotted against the cytokine concentration (right). At the same concentration, the orthogonal cytokine could not support as much total cell growth as wild-type MSA-hIL-2. Detailed Description
[0039] To facilitate a better understanding of the present disclosure, certain terms and phrases are defined below and throughout the specification. The definitions provided herein are non-limiting and should be considered in light of what is known to those skilled in the art at the time of the invention.
[0040] Definitions
[0041] Before further describing the method and the sections, it should be understood that the present invention is not limited to the specific method or section described, as there will surely be differences in actual implementation. It should also be understood that the terms used in this patent are only for describing specific embodiments and are not intended to limit the inventive concept. The scope of the present invention will be defined only by the appended claims.
[0042] In the case where a numerical range is provided, it should be understood that each intermediate value between the upper and lower limits of the range, as well as the intermediate values within the range, are included within the scope of the present invention. Unless the context clearly dictates otherwise, each intermediate value should be as low as one-tenth of the lower limit unit. The present invention encompasses each smaller range between any of the stated values or intervening values within the stated range and any other stated or intervening values within that stated range. The upper and lower limits of these smaller ranges may independently be included within or excluded from the range and are also included within the present invention, subject to the requirements of any specifically excluded limits within the stated range. Ranges excluding any one or both of the included limits are also included within the present invention when the stated range includes one or both of the limits.
[0043] Unless otherwise defined, all technical and scientific terms used in this patent have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. Although methods and materials similar or equivalent to those described in this patent may also be used in the practice or testing of the present invention, some potential and preferred methods and materials are described below. All publications mentioned in this patent are incorporated herein by reference to disclose and describe the methods and / or materials related to the cited publications. It should be understood that when there is a contradiction, the content of the present invention shall supersede any disclosure in the cited publications.
[0044] It should be noted that, as used in this patent and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, the referent of "a cell" includes multiple such cells, and "the peptide" refers to one or more agents and equivalents known to those skilled in the art, such as polypeptides, and so on.
[0045] The publications discussed in this patent are for disclosure only prior to the filing date of this patent. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of a prior invention. Additionally, the provided publication dates may differ from the actual publication dates and may require separate verification.
[0046] Cytokine receptor and ligand pairs include, but are not limited to, the following receptors:
[0047]
[0048]
[0049] "Direct homologs" or "orthogonal cytokine / receptor pairs" refer to pairs of genetically engineered proteins modified by amino acid changes that (a) exhibit significantly reduced affinity for the native cytokine or cognate receptor; and (b) specifically bind to the corresponding engineered (orthogonal) ligand or receptor. Upon binding of the orthogonal ligand, activation of the orthogonal receptor transduces a signal through native cellular components to provide a biological activity that mimics the native response but is specific to the engineered cells expressing the orthogonal receptor.
[0050] Orthogonal receptors exhibit significantly reduced binding to their cognate native cytokine ligands, while orthogonal cytokines exhibit significantly reduced binding to their cognate native receptors. In some embodiments, the affinity of an orthogonal cytokine for its cognate orthogonal receptor is comparable to the affinity of the native cytokine for the native receptor, e.g., having an affinity of at least about 1% of the native cytokine-receptor pair affinity, at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 100%, and can be higher, e.g., 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more of the affinity of the native cytokine for the native receptor.
[0051] As used herein, "does not bind" or "cannot bind" means no detectable binding or insignificant binding, i.e., having a binding affinity far lower than that of the native ligand. Affinity can be determined using a competitive binding assay that measures the binding of a receptor to a single concentration of a labeled ligand in the presence of various concentrations of an unlabeled ligand. Typically, the concentration of the unlabeled ligand varies over at least six orders of magnitude. From the competitive binding assay, the IC 50 . As used herein, "IC 50 " refers to the concentration of the unlabeled ligand required to inhibit the association between the receptor and the labeled ligand by 50%. IC 50 is an indicator of ligand-receptor binding affinity. A low IC 50 represents high affinity, while a high IC 50 represents low affinity.
[0052] As used herein, the term "specifically binds" refers to the degree of selectivity or affinity of one molecule for another molecule. In a binding pair (e.g., ligand / receptor, antibody / antigen, antibody / ligand, antibody / receptor binding pair), the first molecule of the binding pair specifically binds the second molecule of the binding pair when the first molecule of the binding pair does not bind significantly to other components present in the sample. The first molecule of the binding pair is said to specifically bind the second molecule of the binding pair when the affinity of the first molecule for the second molecule is at least two-fold greater, at least ten-fold greater, at least 20-fold greater, or at least 100-fold greater than the affinity of the first molecule for other components present in the sample. In one specific embodiment, the first molecule of the binding pair is an antibody, and the antibody specifically binds the second molecule of the binding pair (e.g., protein, antigen, ligand or receptor) if the affinity of the antibody for the second molecule of the binding pair is greater than about 10 9 liters / mole, or greater than about 10 10 liters / mole, greater than about 10 11 liters / mole, greater than about 10 12 liters / mole, as determined by Scatchard analysis (Munsen et al. 1980 Analyt. Biochem. 107:220-239). Specific binding can be evaluated using techniques known in the art, including but not limited to competitive ELISA, assay and / or assay.
[0053] As used herein, the term "exhibits significantly reduced binding" is used to describe the binding affinity of an orthogonal ligand for an orthogonal receptor relative to the binding of the native ligand to its cognate receptor in its native form. In the practice of the present invention, the term "exhibits significantly reduced binding" is used to describe the comparative binding and activity of an orthogonal ligand relative to the native ligand relative to the native receptor. An orthogonal ligand exhibits significantly reduced binding relative to the native form of the ligand if it binds less than 20%, or less than about 10%, or less than about 8%, or less than about 6%, or less than about 4%, or less than about 2%, or less than about 1%, or less than about 0.5% of the native ligand to the native receptor. Similarly, an orthogonal receptor exhibits significantly reduced binding relative to the native form of the ligand if the native form of the ligand binds to the orthogonal form of the receptor less than 20%, or less than about 10%, or less than about 8%, or less than about 6%, or less than about 4%, or less than about 2%, or less than about 1%, or less than about 0.5% of the native receptor.
[0054] Orthogonal IL-2 polypeptides exhibit significantly reduced activation through native IL-2Rβ. Activity can be measured in a proliferation assay, for example, using the proliferation assay of CTLL-2 murine cytotoxic T cells, see Gearing, A.J.H. and C.B.Bird (1987) in Lymphokines and Interferons, A Practical Approach. Clemens, M.J. et al. (eds.): IRL Press. 295. The specific activity of recombinant human IL-2 is approximately 2.1x10 4 Iu / μg, which is calibrated against the recombinant human IL-2 WHO International Standard (NIBSC code: 86 / 500). Orthogonal human IL-2 may have less than 20%, or less than about 10%, or less than about 8%, or less than about 6%, or less than about 4%, or less than about 2%, or less than about 1%, or less than about 0.5% of the IL-2 polypeptide activity of the WHO International Standard (NIBSC code: 86 / 500) in a comparable assay.
[0055] As used herein with reference to polypeptide or DNA sequences, the term "identity" refers to sequence identity between two molecules. The similarity between two amino acid or two nucleotide sequences is a direct function of the number of identical positions. Generally, sequences are aligned to obtain maximal matching. If necessary, publicly available techniques and widely available computer programs can be used to calculate identity, such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990). Sequence identity can be measured using sequence analysis software and its default parameters, such as the sequence analysis software package of the Genetics Computer Group of the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wisconsin 53705).
[0056] The terms "polypeptide", "protein" or "peptide" refer to any chain of amino acid residues, regardless of its length or post-translational modifications (such as glycosylation or phosphorylation).
[0057] As used herein, "protein variant", "variant protein", or "variant polypeptide" refers to a protein that differs from the wild-type protein by at least one amino acid modification. The parental polypeptide can be a naturally occurring or wild-type (WT) polypeptide, or can be a modified form of the WT polypeptide. The term variant polypeptide can refer to the polypeptide itself, a composition comprising the polypeptide, or a nucleic acid sequence encoding it. Compared to the parental polypeptide, the variant polypeptide desirably contains at least one amino acid modification, e.g., about 1 to about 10 amino acid modifications compared to the parent, and preferably about 1 to about 5 amino acid modifications compared to the parental. The variant can be at least about 99% identical, at least about 98% identical, at least about 97% identical, at least about 95% identical, at least about 90% identical to the wild-type protein.
[0058] As used herein, "parental polypeptide", "parental protein", "precursor polypeptide", or "precursor protein" refers to an unmodified polypeptide that is subsequently modified to produce a variant polypeptide. The parental polypeptide can be a wild-type (or natural) polypeptide. The parental polypeptide can refer to the polypeptide itself, a composition comprising the parental polypeptide, or an amino acid sequence encoding it.
[0059] As used herein, "wild-type" or "WT" or "natural" refers to an amino acid sequence or nucleotide sequence found in nature, including allelic variations. WT proteins, polypeptides, antibodies, immunoglobulins, IgG, etc. have an amino acid sequence or nucleotide sequence that has not been artificially modified.
[0060] The terms "recipient", "individual", "subject", "host", and "patient" are used interchangeably herein and refer to any mammalian subject in need of diagnosis, treatment, or therapy, particularly a human. "Mammal" for therapeutic purposes refers to any animal classified as a mammal, including humans, domestic and farm animals, as well as zoo, sports, or pet animals such as dogs, horses, cats, cows, sheep, goats, pigs, etc. The mammal is preferably a human.
[0061] As used herein, "therapeutically effective amount" refers to the amount of a therapeutic agent, e.g., adoptive T cells or orthogonal cytokines, sufficient to prevent, treat, or control a disease or disorder. A therapeutically effective amount can refer to the amount of a therapeutic agent sufficient to delay or minimize the onset of a disease, e.g., delay or minimize the spread of cancer, or reduce or increase the amount of signaling effect from a receptor of interest. A therapeutically effective amount can also refer to the amount of a therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease. In addition, a therapeutically effective amount of a therapeutic agent of the present invention refers to the amount of the therapeutic agent alone or in combination with other therapies that provides a therapeutic benefit in the treatment or management of a disease.
[0062] As used herein, the terms "prevent", "preventive", and "preventing" refer to preventing the recurrence or onset of one or more conditions in a subject due to the administration of a preventive agent or a therapeutic agent.
[0063] As used herein, the term "combination" refers to the use of more than one prophylactic and / or therapeutic agent. The use of the term "combination" does not limit the order in which prophylactic and / or therapeutic agents are administered to a subject having a disorder. The first prophylactic or therapeutic agent can be administered (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks prior) prior to, concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) administration of a second prophylactic or therapeutic agent to a subject having a disorder.
[0064] Interleukin 2 (IL-2) is a pleiotropic cytokine produced primarily by activated CD4+ T cells and plays a key role in generating normal immune responses. IL-2 promotes the proliferation and expansion of activated T lymphocytes, enhances B cell growth, and activates monocytes and natural killer cells. Because of these activities, IL-2 has been tested and used as an approved cancer therapy (aldesleukin, ). Synthetic human IL-2 is a 153 amino acid precursor polypeptide from which 20 amino acids are removed to produce mature secreted IL-2. As used herein, "IL-2" refers to native or wild-type IL-2. Mature human IL-2 exists as a 133 amino acid sequence (less the signal peptide, consisting of an additional 20 N-terminal amino acids) as described by Fujita et al., PNAS USA, 80, 7437-7441 (1983). The amino acid sequence of human IL-2 is retrieved in Genbank with accession locus number NPU000577.2. The reference sequences for human IL-2 (SEQ ID NO:4) and murine IL-2 (SEQ ID NO:3), human IL-2Rβ (SEQ ID NO:1) and murine IL-2Rβ (SEQ ID NO:2) are provided in Figure 15 ).
[0065] IL-2 supports the survival and differentiation of T lymphocytes by initiating a cell signaling pathway upon interaction with the IL-2 receptor (IL-2R). Il-2 is used clinically to treat many human diseases, including cancer and autoimmunity, and as an adjuvant in adoptive T cell therapy to promote the survival of transplanted T cells. However, IL-2 can also have corresponding effects by activating off-target cell types.
[0066] To direct the activity of IL-2 to specific T cell subsets, the present invention provides engineered orthogonal IL-2 and IL-2 receptor pairs. When bound to an orthogonally IL-2 receptor expressed by a cell, orthogonal IL-2 recapitulates the activity of wild-type IL-2 by inducing efficient STAT5 phosphorylation and in vitro proliferation of T cells engineered to express orthogonal IL-2Rbeta. Orthogonal IL-2 has significantly reduced binding to wild-type CD25-positive or -negative murine T cells cultured ex vivo. The studies disclosed herein demonstrate that reshaping the cytokine receptor interface to create interactions not found in nature is a viable strategy to direct the activity of promiscuous cytokines to T cell subsets of interest, enabling precise control of T cell function by genetic engineering.
[0067] In addition to IL-2, IL-15 and IL-7 also regulate lymphoid homeostasis and are also used as adjuvants to enhance adoptive T cell therapy. IL-2 and IL-15 share the same IL-2R-beta chain. Orthogonal IL-15 can be selected against the same orthogonal IL-2R-beta used to orthogonalize IL-2. IL-7 utilizes a unique IL-7R-alpha chain, which is the target for orthogonalization.
[0068] In some embodiments, orthogonal cytokines, such as orthogonal IL2, can be conjugated to additional molecules to provide desired pharmacological properties, such as an extended half-life. In one embodiment, orthogonal IL-2 can be fused to the Fc domain of IgG, albumin, or other molecules to extend its half-life, such as by PEGylation, glycosylation, etc. known in the art. In some embodiments, the orthogonal cytokine is conjugated or "PEGylated" with a polyethylene glycol molecule. The molecular weight of the PEG conjugated to the orthogonal cytokine ligand includes, but is not limited to, PEG with a molecular weight between 5 kDa and 80 kDa. In some embodiments, the PEG has a molecular weight of about 5 kDa, in some embodiments, the PEG has a molecular weight of about 10 kDa, in some embodiments, the PEG has a molecular weight of about 20 kDa, in some embodiments, the PEG has a molecular weight of about 30 kDa, in some embodiments, the PEG has a molecular weight of about 40 kDa, in some embodiments, the PEG has a molecular weight of about 50 kDa, in some embodiments, the PEG has a molecular weight of about 60 kDa. In some embodiments, the PEG has a molecular weight of about 80 kDa. In some embodiments, the molecular weight is from about 5 kDa to about 80 kDa, from about 5 kDa to about 60 kDa, from about 5 kDa to about 40 kDa, from about 5 kDa to about 20 kDa. In a preferred embodiment, (wherein the polypeptides are named with reference to Table 1), the ortho-ligands are PEGylated forms of 1A1, PEGylated forms of 1C7, PEGylated forms of SQVLKA, and / or PEGylated forms of SQVLqA, in each case where the PEG has a molecular weight of about 5 kDa, or 10 kDa, 20 kDa, or 30 kDa, or 40 kDa, or 40 kDa, or 50 kDa, or 30 kDa. The PEG conjugated to the polypeptide sequence can be linear or branched. The PEG can be directly linked to the orthogonal polypeptide or linked through a linker molecule. The methods and chemical reactions necessary to achieve PEGylation of a biological compound are well known in the art.
[0069] Orthogonal IL-2 can be N-terminally acetylated using methods known in the art, such as by an enzymatic reaction with an N-terminal acetyltransferase and an enzyme such as acetyl-CoA. Orthogonal IL-2 can be acetylated at one or more lysine residues, such as by an enzymatic reaction with a lysine acetyltransferase. See, e.g., Choudhary et al. (2009). Science. 325(5942):834-840.
[0070] Fc fusions can also confer in vivo surrogate Fc receptor-mediated properties. An "Fc region" can be a naturally occurring or synthetic polypeptide that is homologous to the IgG C-terminal domain produced by digesting IgG with papain. The IgG Fc has a molecular weight of approximately 50 kDa. A directly homologous IL-2 polypeptide can include the entire Fc region or a smaller portion that retains the ability to extend the circulating half-life of the chimeric polypeptide to which it belongs. Additionally, the full-length or fragmented Fc region can be a variant of the wild-type molecule. That is, they can contain mutations that may or may not affect the function of the polypeptide; natural activity is not required in any of the cases described below.
[0071] In other embodiments, an orthogonal polypeptide can comprise a polypeptide that serves as an antigen tag, such as a FLAG sequence. The FLAG sequence is recognized by a biotinylated, highly specific anti-FLAG antibody (see Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992). In some embodiments, the chimeric polypeptide also comprises a C-terminal C-myc epitope tag.
[0072] As described above, the orthogonal proteins of the present invention can be present as part of a chimeric polypeptide. In addition to or in place of the heterologous polypeptides described above, the nucleic acid molecules of the present invention can comprise a sequence encoding a "marker" or "reporter". Examples of marker or reporter genes include β-lactamase, chloramphenicol acetyltransferase (CAT), adenosine deaminase (ADA), aminoglycoside phosphotransferase (neo1, G418r), dihydrofolate reductase (DHFR), hygromycin B phosphotransferase (HPH), thymidine kinase (Tk), lacz (encoding β-galactosidase), and xanthine-guanine phosphoribosyltransferase (XGPRT). As with many standard procedures relevant to the practice of the present invention, those skilled in the art will know of other useful reagents, e.g., other sequences that can serve the function of a marker or reporter molecule.
[0073] Orthogonal cytokines and receptors can also include conservative modifications and substitutions at other positions of the cytokine (e.g., positions other than those involved in orthogonal engineering). Such conservative substitutions include those described by Dayhoff in Atlas of Protein Sequence and Structure 5(1978) and Argos in EMBO J., 8:779-785(1989). For example, amino acids belonging to one of the following groups represent conservative changes: Group I: ala, pro, gly, gin, asn, ser, thr; Group II: cys, ser, tyr, thr; Group III: val, ile, leu, met, ala, phe; Group IV: lys, arg, his; Group V: phe, tyr, trp, his; and Group VI: asp, glu. In each case, the introduction of additional modifications can be evaluated to minimize any increase in the antigenicity of the modified polypeptide in the organism to which the modified polypeptide is to be administered.
[0074] The term "T cell" refers to mammalian immune effector cells that can be characterized by the expression of CD3 and / or the T cell antigen receptor and can be engineered to express an orthogonal cytokine receptor. In some embodiments, the T cells are selected from naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, such as T H 1, T H 2, T H 9, T H 11, T H 22, T FH ; regulatory T cells, such as T R 1, natural T reg , inducible T Reg , memory T cells, such as central memory T cells, effector memory T cells, NKT cells, γδ T cells.
[0075] In one embodiment of the invention, the T cells expressing the orthogonal receptor are T cells that have been modified to surface express a chimeric antigen receptor (“CAR-T” cells). As used herein, the terms “chimeric antigen receptor T cell” and “CAR-T cell” are used interchangeably and refer to T cells that have been recombinantly modified to express a chimeric antigen receptor. As used herein, CAR-T cells can be engineered to express an orthogonal IL-2Rβ polypeptide. As used herein, the terms “chimeric antigen receptor” and “CAR” are used interchangeably to refer to a polypeptide comprising multiple functional domains arranged in sequence from amino to carboxy terminus: (a) an antigen-binding domain (ABD), (b) a transmembrane domain (TD); (c) one or more cytoplasmic signaling domains (CSD), wherein the foregoing domains can optionally be linked by one or more spacer domains. The CAR can further comprise a signal peptide sequence that is routinely removed during post-translational processing and presentation of the CAR on the cell surface. CARs useful in the practice of the invention are prepared according to principles well known in the art. See, for example: Eshhaar et al., U.S. Patent No. 7,741,465 B1, issued June 22, 2010; Sadelain et al. (2013) Cancer Discovery 3(4):388-398; Jensen and Riddell (2015) Current Opinions in Immunology 33:9-15; Gross et al. (1989) PNAS (USA) 86(24):10024-10028; Curran et al. (2012) J Gene Med 14(6):405-15. Examples of commercially available CAR-T cell products that can be modified to incorporate the orthogonal receptor of the invention include axicabtagene ciloleucel (Yescarta, commercially available from Gilead Pharmaceuticals) and tisagenlecleucel (Kymriah, commercially available from Novartis).
[0076] As used herein, the term antigen-binding domain (ABD) refers to a polypeptide that specifically binds to an antigen expressed on the surface of a target cell. The ABD can be any polypeptide that specifically binds to one or more antigens expressed on the surface of a target cell. In certain embodiments, the target cell antigen is a tumor antigen. Examples of tumor antigens that can be targeted by the ABD of a CAR include one or more antigens selected from the group consisting of, but not limited to, CD19, CD20, HER2, NY-ESO-1, MUC1, CD123, FLT3, B7-H3, CD33, IL1RAP, CLL1 (CLEC12A) PSA, CEA, VEGF, VEGF-R2, CD22, ROR1, mesothelin, c-Met, glycolipid F77, FAP, EGFRvIII, MAGE A3, 5T4, WT1, KG2D ligand, folate receptor (Fra), and Wnt1 antigen.
[0077] In one embodiment, the ABD is a single-chain Fv (ScFv). An ScFv is a polypeptide consisting of the variable regions of the immunoglobulin heavy and light chains of an antibody covalently linked by a peptide linker (Bird et al. (1988) Science 242:423-426; Huston et al. (1988) PNAS (USA) 85:5879-5883; S-z Hu et al. (1996) Cancer Research, 56, 3055-3061. The generation of ScFvs based on monoclonal antibody sequences is well known in the art. See, for example, The Protein Protocols Handbook, John M. Walker, Ed. (2002) Humana Press Section 150 “Bacterial Expression, Purification and Characterization of Single-Chain Antibodies” Kipriyanov, S. Antibodies used for preparing scFvs can be optimized to select molecules with specific desired characteristics (such as enhanced affinity) by techniques well known in the art such as phage display and directed evolution. In some embodiments, the ABD comprises an anti-CD19 scFv, an anti-PSA scFv, an anti-HER2 scFv, an anti-CEA scFv, an anti-EGFR scFv, an anti-EGFRvIII scFv, an anti-NY-ESO-1 scFv, an anti-MAGE scFv, an anti-5T4 scFv or an anti-Wnt1 scFv. In another embodiment, the ABD is a single-domain antibody obtained by immunizing a camel or llama with an antigen derived from a target cell, particularly a tumor antigen. See, for example, Muyldermans, S. (2001) Reviews in Molecular Biotechnology 74:277-302. Alternatively, the ABD can be generated entirely synthetically by generating a peptide library and isolating compounds having the desired target cell antigen-binding properties substantially according to the teachings of or Wigler et al. U.S. Patent No. 6303313B1, issued November 12, 1999; U.S. Patent No. 6696248B1, issued February 24, 2004, Knappik et al., Binz et al. (2005) Nature Biotechnology 23:1257-1268, and Bradbury et al. (2011) Nature Biotechnology 29:245-254.
[0078] ABD may have affinity for multiple target antigens. For example, the ABDs of the present invention may comprise chimeric bispecific binding members, i.e., capable of providing specific binding to an antigen expressed on a first target cell and an antigen expressed on a second target cell. Non-limiting examples of chimeric bispecific binding members include bispecific antibodies, bispecific conjugated monoclonal antibodies (mab)2, bispecific antibody fragments (e.g., F(ab)2, bispecific scFv, bispecific diabodies, single-chain bispecific diabodies, etc.), bispecific T cell engagers (BiTE), bispecific conjugated single domain antibodies, mice and their mutants, etc. Non-limiting examples of chimeric bispecific binding members also include those chimeric bispecific reagents described in Kontermann (2012) Mabs. 4(2):182-197; Stamova et al. (2012) Antibodies, 1(2), 172-198; Farhadfar et al. (2016) Leuk Res. 49:13-21; Benjamin et al. Ther Adv Hematol. (2016) 7(3):142-56; Kiefer et al. Immunol Rev. (2016) 270(1):178-92; Fan et al. (2015) J Hematol Oncol. 8:130; May et al. (2016) Am J Health Syst Pharm. 73(1):e6-e13. In some embodiments, the chimeric bispecific binding member is a bivalent single-chain polypeptide. See, e.g., Thirion et al. (1996) European J. of Cancer Prevention 5(6):507-511; DeKruif and Logenberg (1996) J. Biol. Chem 271(13)7630-7634; and Kay et al. U.S. Patent Application Publication No. 2015 / 0315566, published Nov. 5, 2015. In some cases, the chimeric bispecific binding member can be a bispecific T cell engager (BiTE). Owing is typically carried out by fusing a specific binding member that binds an antigen (e.g., scFv) to a second binding domain that specifically binds a T cell molecule such as CD3. In some cases, the chimeric bispecific binding member can be a CAR T cell engager. As used herein, "CAR T cell engager" refers to a bispecific polypeptide that is expressed, binds to the antigen recognition domain of a CAR, and redirects the CAR to a second antigen. Typically, the CAR T cell engager will have a binding region, one specific for an epitope on the CAR it is targeting, and another epitope for a binding partner, which, when bound, transduces a binding signal that activates the CAR. Useful CAR T cell engagers include, but are not limited to, for example, those described by Kim et al.(2015) J Am Chem Soc. 137(8):2832 - 5; Ma et al. (2016) Proc Natl Acad Sci U S A. 113(4):E450 - 8 and Cao et al. (2016) Angew Chem Int Ed Engl. 55(26):7520 - 4.
[0079] In some embodiments, a linker polypeptide molecule is optionally incorporated into the CAR between the antigen - binding domain and the transmembrane domain to facilitate antigen binding. Moritz and Groner (1995) Gene Therapy 2(8)539 - 546. In one embodiment, the linker is the hinge region from an immunoglobulin, such as the hinge from any one of IgG1, IgG2a, IgG2b, IgG3, IgG4, particularly a human protein sequence. Alternatives include the CH2CH3 region of the immunoglobulin and portions of CD3. In the case where the ABD is a scFv, an IgG hinge can be used. In some embodiments, the linker contains the amino acid sequence (G4S) n , where n is 1, 2, 3, 4, 5, etc., and in some embodiments n is 3.
[0080] CARs useful in the practice of the present invention also include a transmembrane domain that links the ABD (or linker, if used) to the intracellular cytoplasmic domain of the CAR. The transmembrane domain consists of any polypeptide sequence that is thermodynamically stable in a eukaryotic cell membrane. The transmembrane domain can be derived from the transmembrane domain of a naturally occurring transmembrane protein or can be synthetic. When designing a synthetic transmembrane domain, amino acids that favor an alpha - helix structure are preferred. Transmembrane domains for constructing CARs consist of approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 22, 23, or 24 amino acids, favoring the formation of an alpha - helix secondary structure. Amino acids that favor an alpha - helix conformation are well - known in the art. See, for example, Pace et al. (1998) Biophysical Journal 75:422 - 427. Amino acids that are particularly favored in the alpha - helix conformation include methionine, alanine, leucine, glutamic acid, and lysine. In some embodiments, the CAR transmembrane domain can be derived from the transmembrane domain of a type I transmembrane protein, such as CD3ζ, CD4, CD8, CD28, etc.
[0081] The cytoplasmic domain of the CAR polypeptide contains one or more intracellular signaling domains. In one embodiment, the intracellular signaling domain contains the cytoplasmic sequence of the T cell receptor (TCR) and a co-receptor that initiates signal transduction after antigen receptor engagement and its functional derivatives and sub-fragments thereof. The cytoplasmic signaling domain derived from the T cell receptor ζ-chain is used as part of the CAR to generate a stimulatory signal for T lymphocyte proliferation and effector function after binding of the chimeric receptor to the target antigen. Examples of cytoplasmic signaling domains include, but are not limited to, the cytoplasmic domain of CD27, the cytoplasmic domain of CD28, the cytoplasmic domain of CD137 (also known as 4-1BB and TNFRSF9), the cytoplasmic domain of CD278 (also known as ICOS), the p110α, β or δ catalytic subunit of PI3 kinase, the human Cd3ζ-chain, the cytoplasmic region of CD134 (also known as OX40 and TNFζRSF4), the FcεR1γ and β chains, the MB1 (Igα) chain, the B29 (Igβ) chain, etc.), CD3 polypeptides (δ, Δ and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.) and other molecules involved in T cell transduction such as CD2, CD5 and CD28.
[0082] In some embodiments, the CAR may also provide a co-stimulatory domain. The term "co-stimulatory domain" refers to the stimulatory domain of the CAR, typically an intracellular domain, which provides a secondary non-specific activation mechanism through which the primary specific stimulation is propagated. The co-stimulatory domain refers to the part of the CAR that enhances the proliferation, survival or development of memory cells. Examples of co-stimulation include antigen-nonspecific T cell co-stimulation after antigen-specific signal transduction through the T cell receptor and antigen-nonspecific B cell co-stimulation after signal transduction through the B cell receptor. Co-stimulation, such as T cell co-stimulation, and the factors involved have been described in Chen & Flies. (2013) Nat Rev Immunol 13(4):227-42. In some embodiments disclosed herein, the CSD contains one or more members of the TNFR superfamily CD28, CD137 (4-1BB), CD134 (OX40), Dap10, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-1, TNFR-II, Fas, CD30, CD40 or a combination thereof.
[0083] CARs are generally classified into first-generation, second-generation, third-generation or fourth-generation. The term first-generation CAR refers to a CAR in which the cytoplasmic domain transmits signals from antigen binding only through a single signaling domain, such as a signaling domain derived from the high-affinity receptor of IgE FcεRIγ or the Cd3ζ chain. This domain contains one or three immunoreceptor tyrosine-based activation motifs [ITAMs] for antigen-dependent T cell activation. The ITAM-based activation signal confers on T cells the ability to lyse target tumor cells and secrete cytokines in response to antigen binding. Second-generation CARs also include co-stimulatory signals, in addition to the CD3ζ signal. Coincident delivery of co-stimulatory signals enhances cytokine secretion and anti-tumor activity induced by T cells transduced by CAR T. The co-stimulatory domain is typically membrane-proximal relative to the CD3ζ domain. Third-generation CARs include a tripartite signaling domain that contains, for example, CD28, CD3ζ, OX40 or 4-1BB signaling regions. In the fourth generation, or "armored" CAR T cells are further genetically modified to express or block molecules and / or receptors to enhance immune activity.
[0084] Examples of intracellular signaling domains contained in the CARs of the present invention include (amino to carboxyl): CD3ζ; CD28-41BB-CD3ζ; CD28-OX40-CD3ζ; CD28-41BB-CD3ζ; 41BB-CD-28--CD3ζ and 41BB-CD3ζ.
[0085] The term CAR includes CAR variants, including but not limited to split CARs, switch CARs, bispecific or tandem CARs, inhibitory CARs (iCARs) and induced pluripotent (iPS) CAR-T cells.
[0086] The term "split CAR" refers to the extracellular portion of a CAR where the ABD and cytoplasmic signaling domains are present on two separate molecules. CAR variants also include switch CARs, which are conditionally activatable CARs, such as those containing split CARs where the conditional heterodimerization of the two parts of the split CAR is pharmacologically controlled. CAR molecules and their derivatives (i.e., CAR variants), such as in PCT application numbers US2014 / 016527, US1996 / 017060, US2013 / 063083; Fedorov et al. Sci TranslMed (2013); 5(215):215ra172; Glienke et al. Front Pharmacol (2015) 6:21; Kakarla & Gottschalk 52Cancer J (2014) 20(2):151-5; Riddell et al. Cancer J (2014) 20(2):141-4; Pegram et al. Cancer J (2014) 20(2):127-33; Cheadle et al. Immunol Rev (2014) 257(1):91-106; Barrett et al. Annu Rev Med (2014) 65:333-47; Sadelain et al. Cancer Discov (2013) 3(4):388-98; Cartellieri et al., J Biomed Biotechnol (2010) 956304; the disclosures of which are hereby incorporated by reference in their entirety.
[0087] The term "bispecific or tandem CAR" refers to a CAR that contains a secondary CAR binding domain that can amplify or inhibit the activity of a primary CAR.
[0088] The term "inhibitory chimeric antigen receptor" or "iCARs" is used interchangeably herein and refers to a CAR in which binding of the iCARs uses dual antigen targeting to turn off activation of the active CAR by binding to a second inhibitory receptor equipped with an inhibitory signaling domain that binds to the secondary CAR, resulting in inhibition of primary CAR activation. Inhibitory CAR (iCAR) is designed to regulate CAR-T cell activity through activation of the inhibitory receptor signaling module. This approach combines the activities of two CARs, one of which generates a dominant negative signal that limits the response of CAR-T cells activated by the activating receptor. When binding to a specific antigen expressed only by normal tissue, the iCAR can turn off and counteract the response of the activator CAR. In this way, iCARs-T cells can distinguish cancer cells from healthy cells and reversibly block the function of transduced T cells in an antigen-selective manner. The CTLA-4 or PD-1 intracellular domain in iCARs triggers an inhibitory signal on T lymphocytes, resulting in less cytokine production, less efficient target cell lysis, and altered lymphocyte motility.
[0089] The term "tandem CAR" or "TanCAR" refers to a CAR that mediates bispecific activation of T cells through the conjugation of two chimeric receptors designed to deliver stimulatory or costimulatory signals in response to the independent engagement of two different tumor-associated antigens.
[0090] Generally, chimeric antigen receptor T cells (CAR-T cells) are T cells that have been recombinantly modified by transduction with an expression vector encoding a CAR substantially as taught above.
[0091] Cells can be prepared for engineering using the patient's own T cells. Thus, the cell population to be administered will necessarily be variable for a subject. Additionally, since CAR-T cell agents are variable, the response to these agents can also vary, and thus continuous monitoring and management of the treatment-related toxicities during pre-treatment pharmacological immunosuppression or B cell depletion procedures for CAR-T cell therapy are involved. Examples of such immunosuppressive regimens include systemic corticosteroids (such as methylprednisolone). Therapies for B cell depletion include intravenous immunoglobulin (IVIG) administered according to established clinical dosing guidelines to restore normal levels of serum immunoglobulin. In some embodiments, a subject may optionally undergo a lymphodepletion regimen prior to administration of the CAR-T cell therapy of the invention. An example of such a lymphodepletion regimen includes administration of fludarabine (30 mg / m 2 intravenously [IV] for 4 days) and cyclophosphamide (500 mg / m 2 intravenously starting from the first dose of fludarabine for 2 days).
[0092] T cells engineered with the constructs described herein include naive T cells, central memory T cells, effector memory T cells, or combinations thereof. T cells for engineering as described above are collected from a subject or donor, or the donor may be separated from the cell mixture by techniques that enrich for the desired cells, or engineering and culturing may be performed without separation. Suitable solutions can be used to disperse or suspend. The solution is typically a balanced salt solution, such as, for example, saline, PBS, Hank's balanced salt solution, etc., appropriately supplemented with fetal bovine serum or other naturally occurring factors, as well as a low concentration (e.g., 5-25 mM) of an acceptable buffer. Convenient buffers include HEPES, phosphate buffer, lactate buffer, etc. Affinity separation techniques may include magnetic separation using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents conjugated or used in combination with monoclonal antibodies, such as complement and cytotoxins, and "panning" with antibodies attached to a solid matrix (e.g., plate) or other convenient techniques. Techniques providing accurate separation include fluorescence-activated cell sorters, which may have varying degrees of complexity, such as multi-color channels, low-angle and obtuse light scatter detection channels, impedance channels, etc. Dead cells can be identified by using dyes associated with dead cells (e.g., propidium iodide). Any technique that does not unduly compromise the viability of the selected cells can be employed. Affinity reagents can be specific receptors or ligands for the cell surface molecules described above. In addition to antibody reagents, peptide-MHC antigens and T cell receptor pairs; peptide ligands and receptors; effector and receptor molecules, etc. can be used.
[0093] The separated cells can be collected in any suitable medium that maintains cell viability, typically having serum buffering at the bottom of the collection tube. A variety of media are commercially available and can be used depending on the nature of the cells, including dMEM, HBSS, DPBS, RPMI, Iscove's medium, etc., which are often supplemented with fetal bovine serum (FCS). The collected and optionally enriched cell population can be used immediately for genetic modification, or can be frozen and stored at liquid nitrogen temperature, thawed and capable of being reused. Cells are typically stored in 10% DMSO, 50% FCS, 40% RPMI 1640 medium.
[0094] In some embodiments, the engineered cells comprise a complex mixture of immune cells, such as tumor-infiltrating lymphocytes (TILs) isolated from an individual in need of treatment. See, e.g., Yang and Rosenberg (2016) Adv Immunol. 130:279-94, “Adoptive T Cell Therapy for Cancer”; Feldman et al. (2015) Semin Oncol. 42(4):626-39 “Adoptive Cell Therapy-Tumor-Infiltrating Lymphocytes, T-Cell Receptors, and Chimeric Antigen Receptors”; Clinical Trial NCT01174121, “Immunotherapy Using Tumor Infiltrating Lymphocytes for Patients With Metastatic Cancer”; Tran et al. (2014) Science 344(6184)641-645, “Cancer immunotherapy based on mutation-specific CD4+ T cells in a patient with epithelial cancer”.
[0095] In some embodiments, the engineered T cells are allogeneic relative to the individual being treated, see, e.g., Clinical Trials NCT03121625; NCT03016377; NCT02476734; NCT02746952; NCT02808442. See review Graham et al. (2018) Cells. 7(10)E155. In some embodiments, the allogeneic engineered T cells are fully HLA-matched. However, not all patients have a fully matched donor, and cell products that are suitable for all patients independent of HLA type provide an alternative. Universal “off-the-shelf” T cell products have advantages in terms of harvest and manufacturing uniformity.
[0096] T cells collected from a subject or donor for engineering as described above can be isolated from the cell mixture by techniques that enrich for the desired cells, or can be engineered and cultured without isolation. Appropriate solutions can be used for dispersion or suspension. The solutions are typically balanced salt solutions, such as, for example, saline, PBS, Hank's balanced salt solution, etc., which are appropriately supplemented with fetal bovine serum or other naturally occurring factors, as well as a low concentration (e.g., 5 - 25 mM) of an acceptable buffer. Convenient buffers include HEPES, phosphate buffer, lactate buffer, etc. Affinity separation techniques may include magnetic separation, using antibody - coated magnetic beads, affinity chromatography, cytotoxic agents conjugated or used in combination with monoclonal antibodies, such as complement and cytotoxins, and "panning" with antibodies attached to a solid matrix (e.g., plates) or other convenient techniques. Techniques that provide accurate separation include fluorescence - activated cell sorters, which can have varying degrees of complexity, such as multi - color channels, low - angle and obtuse light - scatter detection channels, impedance channels, etc. Dead cells can be identified by using dyes associated with dead cells (e.g., propidium iodide). Any technique that does not unduly compromise the viability of the selected cells can be employed. Affinity reagents can be specific receptors or ligands for the above - mentioned cell - surface molecules. In addition to antibody reagents, peptide - MHC antigens and T - cell receptor pairs; peptide ligands and receptors; effector and receptor molecules, etc. can be used. The isolated cells can be collected in any suitable medium that maintains cell viability, typically with serum buffering at the bottom of the collection tube. A variety of media are available commercially and can be used depending on the nature of the cells, including dMEM, HBSS, DPBS, RPMI, Iscove's medium, etc., which are often supplemented with fetal bovine serum (FCS). The collected and optionally enriched cell population can be used immediately for genetic modification, or can be frozen and stored at liquid nitrogen temperature, thawed and capable of being reused. Cells are typically stored in 10% DMSO, 50% FCS, 40% RPMI 1640 medium. Engineered cells can be infused into a subject in any physiologically acceptable medium by any convenient route of administration (usually intravascularly), although they can also be introduced by other routes where the cells can find a suitable growth site. Typically, at least 1×10 6 cells / kg, at least 1×10 7 cells / kg, at least 1×10 8 cells / kg, at least 1×10 9 cells / kg, at least 1×10 10 cells / kg or more will be administered. The T cells obtained during collection are typically limited by the quantity.
[0097] Allogeneic T cells used in the practice of the present invention can be genetically modified to reduce graft-versus-host disease. For example, the engineered cells of the present invention can be TCRαβ receptor knockout achieved by gene editing techniques. TCRαβ is a heterodimer, and both the α and β chains are required for expression. A single gene encodes the α chain (TRAC), while there are 2 genes encoding the β chain, so the TRAC gene locus KO has been deleted for this purpose. Many different methods have been used to achieve this deletion, such as CRISPR / Cas9; meganucleases; engineered I-CreI homing endonucleases, etc. See, for example, Eyquem et al. (2017) Nature 543:113-117, in which the TRAC coding sequence was replaced by the CAR coding sequence; Georgiadis et al. (2018) Mol. Ther. 26:1215-1227, which linked CAR expression to TRAC fragments by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 without directly integrating the CAR into the TRAC gene locus. Alternative strategies for preventing GVHD modify T cells to express inhibitors of TCRαβ signaling, such as using a truncated form of Cd3ζ as a TCR inhibitory molecule.
[0098] The preparation of T cells useful in the practice of the present invention is achieved by transforming isolated T cells with an expression vector comprising a nucleic acid sequence encoding an orthogonal receptor; optionally in combination with the nucleic acid sequence encoding a CAR as described above. The nucleic acid sequences encoding the CAR and the orthogonal receptor can each be provided on separate expression vectors, each nucleic acid sequence operably linked to one or more expression control elements to effect the expression of the CAR and the orthogonal receptor in the target cell, and the vectors are co-transfected into the target cell. Alternatively, the nucleic acid sequences encoding the CAR and the orthogonal receptor can each be provided on a single vector for each nucleic acid sequence under the control of one or more expression control elements to effect the expression of the relevant nucleic acid sequences. Alternatively, both nucleic acid sequences can be under the control of a single promoter, in which case insertion or downstream control elements facilitate the co-expression of both sequences with the vector.
[0099] Ex vivo T cell activation can be achieved by procedures well recognized in the art, including cell-based T cell activation, antibody-based activation, or activation using various bead-based activation reagents. Cell-based T cell activation can be achieved by exposing T cells to antigen-presenting cells such as dendritic cells or artificial antigen-presenting cells such as irradiated K562 cells. Antibody-based activation of the CD3 molecules on the surface of T cells with soluble anti-CD3 monoclonal antibodies also supports T cell activation in the presence of IL-2.
[0100] Generally, the T cells of the present invention are expanded by culturing cells in contact with a surface that provides a reagent that stimulates signals associated with the CD3 TCR complex (e.g., anti-CD3 antibody) and a reagent that stimulates co-stimulatory molecules on the surface of T cells (e.g., anti-CD28 antibody). Magnetic bead-based T cell activation has been accepted in the art for the preparation of CAR-T cells for clinical use. Magnetic bead-based T cell activation can be achieved using commercially available T cell activation reagents, including but not limited to CTS CD3 / 28 (Life Technologies, Inc. Carlsbad CA) or Miltenyi GMP ExpAct Treg beads or Miltenyi MACS GMP TransAct TM CD3 / 28 beads (Miltenyi Biotec, Inc). Conditions suitable for T cell culture are well known in the art. Lin et al. (2009) Cytotherapy 11(7):912-922; Smith et al. (2015) Clinical & Translational Immunology 4:e31 Published online January 16, 2015. The target cells are maintained under conditions necessary to support growth, such as an appropriate temperature (37 °C) and environment (e.g., air and 5% CO2).
[0101] When the orthogonal receptor or the CAR-T cell expressing the orthogonal receptor is a growth factor receptor, the CAR-T cell expressing the orthogonal receptor can also be selectively amplified from a mixed population of background or transduced and untransduced cells by using the ligand of the orthogonal receptor. In one embodiment, the orthogonal receptor is an orthogonal IL-2 receptor, and the orthogonal IL-2 compound for amplifying such cells is an orthogonal IL-2 selected from the group in Table 1.
[0102] In this method, orthogonal proteins, particularly orthogonal cytokines, can be produced by recombinant methods. The orthogonal receptor can be introduced into the cells to be engineered on an expression vector. The DNA encoding the orthogonal protein can be obtained from various sources designed in the engineering process.
[0103] As described herein, amino acid sequence variants are prepared by introducing appropriate nucleotide changes in the coding sequence. Such variants represent insertions, substitutions, and / or designated deletions of the residues. Any combination of insertions, substitutions, and / or designated deletions is made to obtain the final construct as long as the final construct has the desired biological activity as defined herein.
[0104] To achieve the expression of recombinant proteins, nucleic acids encoding orthogonal proteins (and / or CARs) are inserted into replicable vectors for expression. Many such vectors are available. Vector components generally include, but are not limited to, one or more of the following: origin of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences. Vectors include viral vectors, plasmid vectors, integrating vectors, etc.
[0105] Expression vectors for expressing orthogonal receptors and optionally CARs in T cells can be viral vectors or non-viral vectors. Plasmids are examples of non-viral vectors. To facilitate transfection of target cells, target cells can be directly exposed to non-viral vectors under conditions that promote the uptake of non-viral vectors. Examples of conditions for promoting the uptake of foreign nucleic acids by mammalian cells are well known in the art and include, but are not limited to, chemical means (e.g., Thermo Fisher Scientific), high salt, and magnetic fields (electroporation).
[0106] In one embodiment, non-viral vectors can be provided in a non-viral delivery system. A non-viral delivery system is generally a complex that facilitates the transduction of target cells with nucleic acid cargo, where the nucleic acid is complexed with, such as cationic lipids (DOTAP, DOTMA), surfactants, biological agents (gelatin, chitosan), metals (gold, magnetic iron), and synthetic polymers (PLG, PEI, PAMAM). Many embodiments of non-viral delivery systems are well known in the art, including lipid carrier systems (Lee et al. (1997) Crit Rev Ther Drug Carrier Syst. 14:173-206); polymer coated liposomes (Marin d et al., U.S. Patent. No. 5,213,804 issued May 25, 1993; Woodle et al., U.S. Patent. No. 5,013,556 issued May 7, 1991); cationic liposomes (Epand et al., U.S. Patent. No. 5,283,185 issued February 1, 1994; Jessee, J.A., U.S. Patent. No. 5,578,475 issued November 26, 1996; Rose et al., U.S. Patent. No. 5,279,833 issued January 18, 1994; Gebeyehu et al., U.S. Patent. No. 5,334,761 issued August 2, 1994).
[0107] In another embodiment, the expression vector can be a viral vector. When a viral vector system is used for CAR and expresses an orthogonal receptor, retroviral or lentiviral expression vectors are preferred. In particular, the viral vector is gamma retrovirus (Pule, et al. (2008) Nature Medicine 14(11):1264-1270), self-inactivating lentiviral vectors (June, et al. (2009) Nat Rev Immunol 9(10):704-716) and retroviral vectors, as previously described, Naldini, et al. (1996) Science 272:263-267; Naldini, et al. (1996) Proc. Natl. Acad. Sci. USA Vol.93, pp.11382-11388; Dull, et al. (1998) J. Virology 72(11):8463-8471; Milone, et al. (2009) 17(8):1453-1464; U.S. Patent No. 6096538 issued to Kingsman, et al. on August 1, 2000 and U.S. Patent No. 6924123 issued to Kingsman, et al. on August 2, 2005. In one embodiment of the present invention, the CAR expression vector is a lentiviral vector available from Oxford Biomedica.
[0108] Transduction of T cells with the expression vector can be accomplished using techniques well known in the art, including but not limited to co-incubation of the host T cells with the viral vector, electroporation and / or chemical enhanced delivery.
[0109] Orthogonal proteins can be produced not only by direct recombination, but also as fusion polypeptides with heterologous polypeptides, such as signal sequences or other polypeptides having specific cleavage sites at the N-terminus of the mature protein or polypeptide. Generally, the signal sequence can be a component of the vector, or it can be a part of the coding sequence inserted into the vector. The heterologous signal sequence preferably selected is one that is recognized and processed by the host cell (i.e., cleaved by signal peptidase). In mammalian cell expression, natural signal sequences can be used, or other mammalian signal sequences, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leader sequences, such as herpes simplex gD signal.
[0110] Expression vectors usually contain a selectable gene, also called a selectable marker. This gene encodes a protein that is necessary for the survival or growth of transformed host cells in selective media. Host cells not transformed with a vector containing the selectable gene will not be able to survive in the media. Typically, the protein encoded by the selectable gene (a) confers resistance to an antibiotic or other toxin (e.g., ampicillin, neomycin, methotrexate or tetracycline), (b) complements a nutritional defect, or (c) provides a key nutrient not obtainable from complex media.
[0111] The expression vector will contain a promoter that is recognized by the host organism and operably linked to an orthogonal protein coding sequence. A promoter is a non-translated sequence (usually within about 100 to 1000 bp) upstream (5') of the start codon of a structural gene that controls the transcription and translation of the particular nucleic acid sequence to which it is operably linked. Such promoters are generally divided into two classes: inducible and constitutive. An inducible promoter is a promoter that increases the level of transcription from the DNA under its control in response to some change in the culture conditions (e.g., the presence or absence of a nutrient or a change in temperature). A large number of promoters recognized by a variety of potential host cells are well known.
[0112] Transcription from vectors in mammalian host cells can be controlled, for example, by promoters obtained from viral genomes, such as polyomavirus, fowlpox virus, adenovirus (e.g., adenovirus 2), bovine papillomavirus, avian sarcoma virus, cytomegalovirus, retroviruses (such as murine stem cell virus), hepatitis B virus and most preferably, from heterologous mammalian promoters, such as the actin promoter, PGK (phosphoglycerate kinase) or immunoglobulin promoters of simian virus 40 (SV40), provided that these promoters are compatible with the host cell system. The early and late promoters of the SV40 virus can be conveniently obtained as SV40 restriction fragments, which also contain the SV40 virus origin of replication.
[0113] Transcription in higher eukaryotes is usually increased by inserting enhancer sequences into the vector. An enhancer is a cis-acting element of DNA, usually about 10 to 300 bp, that acts on a promoter to increase its transcription. Enhancers are relatively direction and position independent and have been found 5' and 3' of the transcription unit, within introns, and within the coding sequence itself. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, alpha-fetoprotein and insulin). However, enhancers from eukaryotic cell viruses are commonly used. Examples include the SV40 enhancer late in the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer late in the origin of replication and the adenovirus enhancer. The enhancer can be spliced into the expression vector at the 5' or 3' position of the coding sequence, but is preferably located at a site 5' to the promoter.
[0114] Expression vectors for eukaryotic host cells will also contain sequences necessary for termination of transcription and stabilization of the mRNA. These sequences are commonly available from the 5' and occasionally 3' untranslated regions of eukaryotic or viral DNA or cDNA. Construction of suitable vectors containing one or more of the above components employs standard techniques.
[0115] Suitable host cells for cloning or expressing DNA in the vectors herein are the prokaryotes, yeasts or higher eukaryotic cells described above. Useful mammalian host cell lines include, for example, mouse L cells (L-M [TK-], ATCC CRL-2648), monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cell subclones for growth in suspension culture); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells / -DHFR (CHO); mouse Sertoli cells (TM4); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); dog kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human hepatocytes (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); Trioma cells; MRC 5 cells; FS4 cells; and human hepatoma cell line (HepG2).
[0116] The host cells, including engineered T cells, can be transfected with the above expression vectors for orthogonal IL-2 or IL-2R expression. The cells can be cultured in a conventional nutrient medium suitable for inducing a promoter, selecting transformants or amplifying a gene encoding a desired sequence. Mammalian host cells can be cultured in a variety of media. Commercially available media such as Ham's F10 (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI 1640 (Sigma) and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing host cells. Any of these media can be supplemented as needed with hormones and / or other growth factors (such as insulin, transferrin or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidine), antibiotics, trace elements, and glucose or an equivalent energy source. Any other necessary supplements can also be included at appropriate concentrations known to those skilled in the art. The culture conditions, such as temperature, pH, etc., are those previously used with the host cells selected for expression and will be apparent to the ordinary skilled artisan.
[0117] A nucleic acid is "operably linked" when it is in a functional relationship with another nucleic acid sequence. For example, DNA of a signal sequence is operably linked to DNA of a polypeptide if the former is expressed as a preprotein involved in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned to promote translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous and, in the case of a secretory leader sequence, contiguous and in reading phase. However, an enhancer does not have to be contiguous.
[0118] The orthologous polypeptides generated by recombination can be recovered from the culture medium as secreted polypeptides, although they can also be recovered from the host cell lysates. Protease inhibitors, such as phenylmethylsulfonyl fluoride (PMSF), can also be used to inhibit proteolytic degradation during purification, and antibiotics can be included to prevent the growth of adventitious contaminants. A variety of purification steps are known in the art and can be used, for example, affinity chromatography. Affinity chromatography takes advantage of the highly specific binding sites commonly present in biological macromolecules to separate the ability of molecules to bind to specific ligands. Covalent bonds link the ligand to an insoluble porous support medium in a manner that presents the ligand to the protein sample, thereby separating and purifying a second substance from a mixture using the natural biospecific binding of one molecular species. Antibodies are commonly used in affinity chromatography. Size selection steps can also be used, such as using gel filtration chromatography (also known as size exclusion chromatography or molecular sieve chromatography) to separate proteins according to their size. In gel filtration, a protein solution is passed through a column packed with a semipermeable porous resin. The semipermeable resin has a range of pore sizes that determine the size of the proteins that can be separated by the column. The same applies to cation exchange chromatography.
[0119] The orthologous cytokine compositions can be concentrated, filtered, dialyzed, etc. using methods known in the art. For therapeutic applications, the cytokines can be administered to a mammal that contains appropriately engineered orthologous receptors. Intravenous administration, as a bolus or by continuous infusion over a period of time. Alternative routes of administration include intramuscular, intraperitoneal, intrathecal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical or inhalation routes. The orthologous cytokines are also appropriately administered by intratumoral, peritumoral, intralesional or perilesional routes or lymphatically to exert local and systemic therapeutic effects.
[0120] Such dosage forms include physiologically acceptable carriers that are essentially non-toxic and non-therapeutic. Examples of such carriers include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffering substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances and PEG. Carriers for topical or gel-based polypeptide forms include polysaccharides such as sodium carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyethylene oxide-polyethylene oxide block polymers, PEG and cetostearyl alcohol. For all administrations, traditional depot forms are appropriately used. These forms include, for example, microcapsules, nanocapsules, liposomes, plasters, inhalation dosage forms, nasal sprays, sublingual tablets and sustained release formulations. The polypeptides are generally formulated in such carriers at a concentration of about 0.1 μg / ml to 100 μg / ml.
[0121] If the direct homolog IL-2 polypeptides of the present disclosure are "substantially pure", they can be at least about 60% by weight (dry weight) of the polypeptide of interest, such as a polypeptide containing the direct homolog IL-2 amino acid sequence. For example, the polypeptide can be at least about 75%, about 80%, about 85%, about 90%, about 95% or about 99% by weight of the polypeptide of interest. Purity can be measured by any suitable standard method, such as column chromatography, polyacrylamide gel electrophoresis or HPLC analysis.
[0122] In another embodiment of the present invention, an article of manufacture containing materials for treating the above conditions is provided. The article of manufacture includes a container and a label. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container can be formed from a variety of materials, such as glass or plastic. The container holds a composition effective for treating a disorder and can have a sterile access port (e.g., the container can be an intravenous solution bag or a vial with a stopper pierceable by a hypodermic needle). The active agent in the composition is an orthogonal cytokine. The label on or associated with the container indicates that the composition is for treating the selected condition. Additional containers can be provided with the article of manufacture, which can contain, for example, a pharmaceutically acceptable buffer, such as phosphate buffered saline, Ringer's solution or glucose solution. The article of manufacture can further include other materials desired from a commercial and user perspective, including other buffers, diluents, filters, needles, syringes and package inserts with instructions for use.
[0123] As used herein, the terms "cancer" (or "cancerous"), "hyperproliferative" and "neoplastic" refer to cells having the ability to grow autonomously (e.g., an abnormal state or condition characterized by rapid proliferative cell growth). Hyperproliferative and neoplastic disease states can be classified as pathological (e.g., characterizing or constituting a disease state), or they can be classified as non-pathological (e.g., as a deviation from normal but not associated with a disease state). These terms are intended to include all types of cancerous growths or carcinogenic processes, metastatic tissues or malignantly transformed cells, tissues or organs, regardless of the histopathological type or stage of invasion. "Pathological hyperproliferation" of cells occurs in a disease state characterized by malignant tumor growth. Examples of non-pathological hyperproliferative cells include cell proliferation associated with wound repair. The term "cancer" or "tumor" refers to malignancies of various organ systems, including malignancies affecting the lung, breast, thyroid, lymph glands and lymphoid tissue, gastrointestinal organs and urogenital tract, as well as adenocarcinomas generally considered to include malignancies, such as most colon cancers, renal cell carcinomas, prostate cancers and / or testicular tumors, non-small cell carcinomas of the lung, small intestine cancers and esophageal cancers.
[0124] The term "cancer" is recognized in the art and refers to malignant tumors of epithelial or endocrine tissues, including cancers of the respiratory system, gastrointestinal system, urogenital system, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma. "Adenocarcinoma" refers to a cancer that originates from glandular tissue or in which the tumor cells form recognizable glandular structures.
[0125] Examples of tumor cells include, but are not limited to, AML, ALL, CML, adrenocortical carcinoma, anal cancer, aplastic anemia, bile duct cancer, bladder cancer, bone cancer, bone metastases, brain cancer, central nervous system (CNS) cancers, peripheral nervous system (PNS) cancers, breast cancer, cervical cancer, childhood non-Hodgkin lymphoma, colon and rectal cancer, endometrial cancer, esophageal cancer, Ewing's tumor family (e.g., Ewing's sarcoma), eye cancer, gallbladder cancer, gastrointestinal carcinoid, gastrointestinal stromal tumor, gestational trophoblastic disease, Hodgkin lymphoma, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, liver cancer, lung cancer, lung cancer, non-Hodgkin lymphoma, male breast cancer, malignant mesothelioma, multiple myeloma, myelodysplastic syndromes, myeloproliferative diseases, nasal and paranasal cancer, nasopharyngeal cancer, neuroblastoma, oral and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumor, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, melanoma skin cancer, non-melanoma skin cancer, stomach cancer, testicular cancer, thymic cancer, thyroid cancer, uterine cancer (e.g., uterine sarcoma), transitional cell carcinoma, vaginal cancer, vulvar cancer, mesothelioma, squamous cell or epidermoid carcinoma, bronchial adenoma, choriocarcinoma, head and neck cancer, teratocarcinoma or Waldenstrom macroglobulinemia. Any cancer in which cancer cells exhibit increased CD47 expression compared to non-cancer cells is a suitable cancer for treatment by the subject methods and compositions.
[0126] The compositions and methods of the present invention can be combined with additional therapeutic agents. For example, when the disease, condition or disorder to be treated is a tumor disease (e.g., cancer). The methods of the present invention can be combined with conventional chemotherapeutic agents or other biologic anti-cancer drugs such as checkpoint inhibitors (e.g., PD1 or PDL1 inhibitors) or therapeutic monoclonal antibodies (e.g., Avastin, Herceptin).
[0127] Examples of chemical agents identified in the art as useful for treating neoplastic diseases include, but are not limited to, abitrexate, adriamycin, doxorubicin, doxorubicin, ampicillin, asparaginase, anthracyclines, azacitidine, azathioprine, BiCNU, bleomycin sulfate, busulfan, bleomycin, camptothecin, camptothecin, carboplatin, carmustine, zorubicin hydrochloride, chlorambucil, cisplatin, cladribine, dactinomycin, cytarabine, cytosar, cyclophosphamide, cyclophosphamide, actinomycin, docetaxel, doxorubicin, daunorubicin, epirubicin, espar, epirubicin, etoposide, fludarabine, fluorouracil, fludara, gemcitabine, gemzar, methotrexate, hydrea, idamycin, idarubicin, ifosfamide, cyclophosphamide, irinotecan, ranvis, interleukin, leupeptin, procarbazine, mechlorethamine, mercaptopurine, methotrexate, mitomycin, mitoxantrone, mithramycin, mutamycin, myelosan, cytarabine, navelbine, pentostatin, mitoxantrone hydrochloride, vinblastine, oxaliplatin, paclitaxel, platinum, deoxycoformycin, cisplatin, plicamycin, procarbazine, purinethol, raltitrexed, taxotere, taxol, teniposide, thioguanine, raltitrexed, topotecan, valrubicin, vinblastine, vincaleukoblastine, vindesine, vincristine, vinorelbine, VP-16, and etoposide phosphate.
[0128] Targeted therapies that can be administered in combination may include tyrosine kinase inhibitors such as imatinib mesylate (Gleevec, also known as STI-571), gefitinib (Iressa, also known as Zd1839), erlotinib (commercially available as Tarceva), sorafenib (Nexavar), sunitinib (Sutent), dasatinib (Sprycel), lapatinib (Tykerb), nilotinib (Tasigna), and bortezomib (Velcade), ruxolitinib; Janus kinase inhibitors such as tofacitinib; ALK inhibitors such as crizotinib; Bcl-2 inhibitors such as mesylate, venetoclax, and gossypol; FLT3 inhibitors such as midostaurin (Rydapt), IDH inhibitors such as AG-221, PARP inhibitors such as Iniparib and olaparib; PI3K inhibitors such as perifosine; VEGF receptor 2 inhibitors such as apatinib; AN-152 (AEZS-108) doxorubicin conjugated with [D-Lys(6)]-LHRH; Braf inhibitors such as vemurafenib, dabrafenib, and LGX818; MEK inhibitors such as trametinib; CDK inhibitors such as PD-0332991 and LEE011; Hsp90 inhibitors such as salinomycin; and / or small molecule drug conjugates such as vinorelbine; serine / threonine kinase inhibitors such as temsirolimus (Torisel), everolimus (Afinitor), vemurafenib (Zelboraf), trametinib (Mekinist), and dabrafenib (Tafinlar).
[0129] Examples of biological agents identified in the art for treating neoplastic diseases include, but are not limited to, cytokines or cytokine antagonists such as IL-12, INFα, or anti-epidermal growth factor receptor, radiotherapy, irinotecan; tetrahydrofolate antimetabolites such as pemetrexed; antibodies against tumor antigens, monoclonal antibodies, and toxins, T cell adjuvants, bone marrow transplantation, or antigen-presenting cells (e.g., dendritic cell therapy), anti-tumor vaccines, replication-competent viruses, signal transduction inhibitors (e.g., or ) or immunomodulators to achieve additive or synergistic inhibition of tumor growth, cyclooxygenase 2 (COX-2) inhibitors, steroids, TNF antagonists (e.g., and ), interferon-β1a and interferon-β1b (Betaseron), and combinations of one or more of the above methods, which combinations are used in known chemotherapy regimens that are appreciated by skilled clinicians.
[0130] Tumor-specific monoclonal antibodies that can be administered in combination with anti-CD93 ABD polypeptides or engineered cells can include, but are not limited to, rituximab (commercially available as MabThera or Rituxan), alemtuzumab, panitumumab, ipilimumab (Yervoy), and the like.
[0131] In some embodiments, the compositions and methods of the present invention can be combined with immune checkpoint therapy. Examples of immune checkpoint therapy include inhibitors of the binding of PD1 to PDL1 and / or PDL2. Inhibitors of the binding of PD1 to PDL1 and / or PDL2 are well known in the art. Examples of commercially available monoclonal antibodies that interfere with the binding of PD1 to PDL1 and / or PDL2 include nivolumab ( BMS-936558, MDX1106, purchased from Bristol Myers Squibb, Princeton Nj), pembrolizumab ( MK-3475, lambrolizumab, purchased from Merck and Company, Kenilworth Nj), and atezolizumab ( Genentech / Roche, South San Francisco CA). Other examples of PD1 inhibitory antibodies include, but are not limited to, durvalumab (MEDI4736, Medimmune / AstraZeneca), pidilizumab (CT-011, CureTech), PDR001 (Novartis), BMS-936559 (MDX1105, Bristol-Myers Squibb) and avelumab (MSB0010718C, Merck Serono / Pfizer) as well as SHR-1210 (Incyte). Other PD1 pathway inhibitor antibodies are described in U.S. Patent No. 8,217,149 (Genentech, Inc.) issued on July 10, 2012; U.S. Patent No. 8,168,757 (Merck Sharp and Dohme Corp.) issued on May 1, 2012, U.S. Patent No. 8,008,449 (Medarex) issued on August 30, 2011, and U.S. Patent No. 7,943,743 (Medarex, Inc.) issued on May 17, 2011. In addition, small molecule PD1 and PDL1 and / or PDL2 inhibitors are well known in the art. See Sasikumar, et al as WO2016142833A1 and Sasikumar, et al WO2016142886A2, BMS-1166 and BMS-1001 (Skalniak, et al (2017) Oncotarget 8(42):72167-72181).
[0132] In other embodiments, the methods of the invention are used to treat infections. As used herein, the term "infection" refers to any state in at least one cell of an organism (i.e., a subject) that is infected by an infectious agent (e.g., the subject has an intracellular pathogen infection, such as a chronic intracellular pathogen infection). As used herein, the term "infectious agent" refers to an exogenous biological entity (i.e., a pathogen) that induces increased CD47 expression in at least one cell of an infected organism. For example, infectious agents include, but are not limited to, bacteria, viruses, protozoa, and fungi. Intracellular pathogens are of particular interest. Infectious diseases are diseases caused by infectious agents. Some infectious agents do not cause recognizable symptoms or diseases under certain conditions, but have the potential to cause symptoms or diseases under changing conditions. The subject methods can be used to treat chronic pathogen infections, such as, but not limited to, viral infections, such as retroviruses, lentiviruses, hepatitis viruses, herpes viruses, pox viruses, human papillomavirus, etc.; intracellular bacterial infections, such as mycobacteria, chlamydia, ehrlichia, rickettsia, brucella, legionella, francisella, listeria, klebsiella, neisseria, salmonella, yersinia, helicobacter pylori, etc.; and intracellular protozoan pathogens, such as plasmodium, trypanosoma, giardia, toxoplasma, leishmania, etc.
[0133] Treatment can be combined with other active agents. Antibiotic classes include penicillins, such as penicillin G, penicillin V, methicillin, oxacillin, carbenicillin, nafcillin, ampicillin, etc.; penicillins in combination with β-lactamase inhibitors, cephalosporins, such as cefaclor, cefazolin, cefuroxime, mosapramide, etc.; carbapenems; monobactams; aminoglycosides; tetracyclines; macrolides; lincomycins; polymyxins; sulfonamides; quinolones; chloramphenicols; metronidazole; spectinomycin; trimethoprim; vancomycin, etc. Cytokines, such as interferon γ, tumor necrosis factor α, interleukin 12, etc. can also be included. Antiviral agents, such as acyclovir, ganciclovir, etc. can also be used for treatment.
[0134] In other embodiments, regulatory T cells are engineered for the treatment of autoimmune diseases. The range of inflammatory diseases and diseases associated with inflammation is wide, including autoimmune diseases such as rheumatoid arthritis (Ra), systemic lupus erythematosus (SLE), multiple sclerosis (MS), and autoimmune hepatitis; insulin-dependent diabetes, degenerative diseases such as osteoarthritis (Oa), Alzheimer's disease (AD), and macular degeneration.
[0135] Many, if not most, autoimmune and inflammatory diseases involve multiple types of T cells, such as TH1, TH2, TH17, etc. Autoimmune diseases are characterized by abnormal targeting of self-proteins, polypeptides, peptides, and / or other self-molecules by T and B lymphocytes, resulting in damage and / or dysfunction of organs, tissues, or cell types in the body (e.g., pancreas, brain, thyroid, or gastrointestinal tract) that cause the clinical manifestations of the disease. Autoimmune diseases include diseases that affect specific tissues as well as diseases that can affect multiple tissues, which can depend in part on whether the reaction is against an antigen confined to a specific tissue or an antigen widely distributed in the body.
[0136] The present invention provides engineered orthogonal cytokine receptor / ligand pairs and methods of using the same. Engineered (orthogonal) cytokines specifically bind to corresponding engineered (orthogonal) receptors. Upon binding, the orthogonal receptor activates signal transduction mediated by native cellular components to provide a biological activity that mimics the native response but is specific to the engineered cells expressing the orthogonal receptor. The orthogonal receptor exhibits significantly reduced binding to endogenous corresponding cytokines, including the natural pairing of the orthogonal cytokine, while the orthogonal cytokine exhibits significantly reduced binding to any endogenous receptor, including the natural pairing of the orthogonal receptor. In some embodiments, the affinity of the orthogonal cytokine for the orthogonal receptor is comparable to the affinity of the native cytokine for the native receptor.
[0137] Orthogonal cytokine and receptor pairs can be selected from any cytokine of interest. The process of designing orthogonal cytokine receptor pairs may include the following steps: (a) engineering amino acid changes into the native receptor to disrupt binding to the native cytokine; (b) engineering amino acids at the receptor-binding contact residues into the native cytokine, (c) selecting a cytokine ortholog that binds to the orthogonal receptor; (d) discarding the orthologous cytokine that binds to the native receptor, or (e) selecting an orthologous receptor of the receptor that binds to the orthologous cytokine; (f) discarding the orthologous receptor that binds to the native cytokine. In preferred embodiments, knowledge of the cytokine / receptor complex structure is used to select the amino acid positions for site-directed or error-prone mutagenesis. Yeast display systems can be conveniently used for the selection process, although other display and selection methods are also useful.
[0138] In some cases, amino acid changes are obtained by affinity maturation. An "affinity matured" polypeptide is a polypeptide having one or more alterations in one or more residues that results in an increased affinity of the orthogonal polypeptide for a cognate orthogonal receptor as compared to a parental polypeptide that does not have such alterations, and vice versa. As compared to a "parental" polypeptide, affinity maturation can be performed to increase the binding affinity by at least about 10% to 50 - 100 - 150% or more, or 1 to 5 fold. As described above, the engineered orthogonal cytokines of the invention activate orthogonal receptors but have significantly reduced binding and activation of native receptors. For example, an orthogonal cytokine can exhibit less than about 5% inhibition in competitive inhibition with the corresponding native cytokine when evaluated in a suitable assay condition using a sufficient amount of molecules by ELISA and / or FACS analysis.
[0139] In some embodiments of the invention, the orthogonal receptor is an IL-2 receptor chain, i.e., a polypeptide selected from interleukin 2 receptor alpha (IL-2Rα; Cd25), interleukin 2 receptor beta (IL-2Rβ; CD122), and interleukin 2 receptor gamma (IL-2Rα; CD132; common gamma chain). In some specific embodiments, the orthogonal receptor is Cd132, which is involved in signal transduction from IL-2, IL-4, IL-7, and IL-15. In other specific embodiments, the orthogonal receptor is Cd122, which is involved in signal transduction from IL-2 and IL-15. The orthogonal receptor is typically paired with a corresponding orthogonal cytokine, such as IL-2, IL-4, IL-7, IL-15, etc.
[0140] In some specific embodiments, the orthogonal receptor is CD122. In some such embodiments, the orthogonal receptor is introduced into T cells or NK cells that can also express CD25 and / or CD132. Nucleic acid coding sequences and protein compositions of modified CD122 proteins are provided. In the present invention, CD122 is engineered to disrupt the binding of native cytokines by replacing the amino acids of the native sequence with non-native amino acids at positions involved in binding to native IL-2 or by deleting native amino acids. In some embodiments, the amino acids are replaced with non-conservative changes. The targeted positions for replacement or deletion include, but are not limited to, human CD122 (hCD122) R41, R42, Q70, K71, T73, T74, V75, S132, H133, Y134, F135, E136, Q214. The targeted positions for replacement or deletion include, but are not limited to, mouse CD122 (mCD122) R42, F67, Q71, S72, T74, S75, V76, S133, H134, Y135, I136, E137, R215.
[0141] In some embodiments, CD122 is substituted at one or a combination of positions selected from Q71, T74, H134, Y135 in the murine protein or Q70, T73, H133, Y134 in the human protein. In some embodiments, the engineered protein comprises amino acid substitutions at mCD122 H134 and Y135; or hCD122 H133 and Y134. In some embodiments, the amino acid substitutions are acidic amino acids such as aspartic acid and / or glutamic acid. Specific amino acid substitutions include but are not limited to mCD122 substitutions Q71Y; T74D; T74Y; H134D, H134E; H134K; Y135F; Y135E; Y135R; and hCD122 alterations Q70Y; T73D; T73Y; H133D, H133E; H133K; Y134F; Y134E; Y134R. The choice of orthogonal cytokine can vary with the choice of orthogonal receptor.
[0142] In some embodiments, the orthogonal receptor is CD122 and the orthogonal cytokine is IL-2 or IL-15. A cytokine can be selected to bind to the orthogonal receptor, for example, by yeast display evolution, error-prone or targeted mutagenesis, etc. A representative set of the selected orthogonal sequences is as Figure 6 shown.
[0143] In some embodiments, the orthogonal cytokine is IL-2. In some embodiments, one or more of the following amino acid residues are substituted with an amino acid other than the native protein or deleted at that position: any one of H27, L28, E29, Q30, M33, D34, Q36, E37, R41, N103 in murine IL-2 (mIL-2); Q13, L14, E15, H16, L19, D20, Q22, M23, G27, R81, N88 in human IL-2 (hIL-2). In some such embodiments, the group of amino acid substitutions is selected from (for mIL-2) one or more of E29, Q30, M33, D34, Q36, and E37; and for hIL-2, E15, H16, L19, D20, Q22, M23, R81.
[0144] In some embodiments, the amino acid substitutions of mIL-2 are one or more of the following: [H27W], [L28M,L28W], [E29D,E29T,E29A], [Q30N], [M33V,M33I,M33A], [D34L,D34M], [Q36S,Q36T,Q36E,Q36K,Q36E], [E37A,E37W,E37H,E37Y,E37F,E37A,E37Y], [R41K,R41S], [N103E,N103Q]; and the amino acid substitutions of hIL-2 are one or more of the following: [Q13W], [L14M,L14W], [E15D,E15T,E15A,E15S], [H16N,H16Q], [L19V,L19I,L19A], [D20L,D20M], [Q22S,Q22T,Q22E,Q22K,Q22E], [M23A,M23W,M23H,M23Y,M23F,M23Q,M23Y], [G27K,G27S], [R81D,R81Y], [N88E,N88Q], [T51I]. In some embodiments, the group of amino acid substitutions comprises one of the following groups of mIL-2 substitutions: [Q30N,M33V,D34N,Q36T,E37H,R41K]; [E29D,Q30N,M33V,D34L,Q36T,E37H]; [E29D,Q30N,M33V,D34L,Q36T,E37A], and [E29D,Q30N,M33V,D34L,Q36K,E37A] and the following substitutions of hIL-2: [H16N,L19V,D20N,Q22T,M23H,G27K]; [E15D,H16N,L19V,D20L,Q22T,M23H]; [E15D,H16N,L19V,D20L,Q22T,M23A] and [E15D,H16N,L19V,D20L,Q22K,M23A]; or conservative variants thereof.
[0145] In some embodiments, the amino acid substitutions of hIL-2 are one or more of the following: [E15S,E15T,E15Q,E15H]; [H16Q]; [L19V,L19I]; [D20T,D20S,D20M,D20L]; [Q22K,Q22N]; [M23L,M23S,M23V,M23T]. In some embodiments, the consensus mutation group of hIL-2 is [E15S, H16Q, L19V, D20T / S / M; Q22K; M23L / S]. In some embodiments, the consensus mutation group of hIL-2 is [E15S, H16Q, L19V, D20L, M23Q / a] and optionally Q22K.
[0146] In some embodiments, the amino acid substitute group comprises one of the following hIL-2 substitute groups: [E15S; H16Q; L19V, D20T / S; Q22K, M23L / S]; [E15S; H16Q; L19I; D20S; Q22K; M23L]; [E15S; L19V; D20M; Q22K; M23S]; [E15T; H16Q; L19V; D20S; M23S]; [E15Q; L19V; D20M; Q22K; M23S]; [E15Q; H16Q; L19V; D20T; Q22K; M23V]; [E15H; H16Q; L19I; D20S; Q22K; M23L]; [E15H; H16Q; L19I; D20L; Q22K; M23T]; [L19V; D20M; Q22N; M23S]; [E15S,H16Q,L19V,D20L,M23Q,R81D,T51I], [E15S,H16Q,L19V,D20L,M23Q,R81Y], [E15S,H16Q,L19V,D20L,Q22K,M23A], [E15S,H16Q,L19V,D20L,M23A].
[0147] A method for enhancing a cellular response is provided by engineering cells from a recipient or donor by introducing an orthogonal receptor of the invention and stimulating the orthogonal receptor by contacting the engineered cells with a cognate orthogonal cytokine. The subject method includes the step of obtaining a target cell, such as a T cell, a hematopoietic stem cell, etc., which can be isolated from a biological sample or can be derived in vitro from a progenitor cell source. Transducing or transfecting the cell with an expression vector comprising a sequence encoding the orthogonal receptor, and this step can be carried out in any suitable medium.
[0148] In some embodiments, an engineered cell is provided, wherein the cell is modified by introducing an orthogonal receptor of the invention. Any cell can be used for this purpose. In some embodiments, the cell is a T cell, including but not limited to naive CD8 + T cells, cytotoxic CD8 + T cells, naive CD4 + T cells, helper T cells, such as T H 1, T H 2, T H 9, T H 11, T H 22, T FH ; regulatory T cells, such as T R 1, natural T reg , induced Reg , induced T reg; memory T cells, such as central memory T cells, effector memory T cells, NKT cells, γδ T cells; etc. In other embodiments, the engineered cell is a stem cell, e.g., a hematopoietic stem cell, or an NK cell. In some embodiments, the cell is genetically modified in an ex vivo procedure before being transferred into a subject. The engineered cell can be provided in unit doses for treatment and can be allogeneic, autologous, etc. relative to the intended recipient.
[0149] Cells, such as cells collected from a subject, can be isolated from a mixed cell population by techniques that enrich for the desired cells. Appropriate solutions can be used to disperse or suspend. The solution is typically a balanced salt solution, e.g., saline, PBS, Hank's balanced salt solution, etc., which is appropriately supplemented with fetal bovine serum or other naturally occurring factors, and a low concentration (e.g., 5 - 25 mM) of an acceptable buffer. Convenient buffers include HEPES, phosphate buffer, lactate buffer, etc. Alternatively, engineered cell lines, expanded allogeneic cells, etc. are used for engineering.
[0150] Affinity separation techniques can include magnetic separation using antibody - coated magnetic beads, affinity chromatography, cytotoxic agents conjugated to monoclonal antibodies or used in combination with monoclonal antibodies (e.g., complement and cytotoxins), and "panning" with antibodies attached to a solid matrix (e.g., a plate), or other convenient techniques. Techniques that provide accurate separation include fluorescence - activated cell sorters, which can have varying degrees of complexity, e.g., multi - color channels, low - angle and obtuse light - scatter detection channels, impedance channels, etc. Cells can be selected against dead cells (e.g., propidium iodide) by using a dye associated with dead cells. Any technique that does not unduly damage the viability of the selected cells can be employed. The affinity reagent can be a specific receptor or ligand for the above - mentioned cell - surface molecules. In addition to antibody reagents, peptide - MHC antigens and T - cell receptor pairs; peptide ligands and receptors; effector and receptor molecules, etc. can be used.
[0151] The isolated cells can be collected in any suitable medium that maintains cell viability, typically with serum buffering at the bottom of the collection tube. A variety of media are available commercially and can be used depending on the nature of the cells, including dMEM, HBSS, DPBS, RPMI, Iscove's medium, etc., which are often supplemented with fetal bovine serum (FCS).
[0152] The collected and optionally enriched cell population can be used immediately or can be frozen and stored at liquid nitrogen temperature, thawed and the cells can be reused. Cells are typically stored in 10% DMSO, 50% FCS, 40% RPMI 1640 medium.
[0153] In some embodiments, a vector is provided that comprises a coding sequence encoding an orthogonal receptor, wherein the coding sequence is operably linked to a promoter that is active in a desired cell. A variety of vectors are known in the art and can be used for this purpose, such as viral vectors, plasmid vectors, microcirculation vectors, which vectors can integrate into the target cell genome or can be maintained episomally. The receptor-encoding vector can be provided in a kit, in combination with a vector encoding an orthogonal cytokine that binds to and activates the receptor. In some embodiments, the coding sequence of the orthogonal cytokine is operably linked to a high-expression promoter and can be optimized for production. In other embodiments, a kit is provided wherein the vector encoding the orthogonal receptor provides a purified composition of the orthogonal cytokine, e.g., in unit dose, packaged for patient administration.
[0154] In some embodiments, a method of treatment is provided that comprises introducing a population of engineered cells into a recipient in need thereof, wherein the cell population is modified by introducing a sequence encoding an orthogonal receptor of the invention. The cell population can be engineered ex vivo and is typically autologous or allogeneic relative to the recipient. In some embodiments, after administration of the engineered cells, the introduced cell population is contacted in vivo with a cognate orthogonal cytokine. An advantage of the invention is the lack of cross-reactivity between the orthogonal cytokine and the native receptor.
[0155] In the case of in vitro contact of cells with an orthogonal cytokine, the cytokine is added to the engineered cells in a dose and for a period of time sufficient to activate signal transduction from the receptor, which can utilize native cellular mechanisms, such as accessory proteins, co-receptors, etc. Any suitable medium can be used. Thus, the activated cells can be used for any desired purpose, including experimental purposes related to determining antigen specificity, cytokine profiles, etc., as well as for in vivo delivery.
[0156] When the contact is made in vivo, an effective dose of engineered cells, including but not limited to CAR-T cells modified to express an orthogonal Il-2β receptor, is combined with administration of an orthogonal cytokine (e.g., Il-2) and allowed to contact T cells in their native environment, such as in lymph nodes, etc., and the dose and frequency can vary depending on the agent, mode of administration, nature of the cytokine, etc. Those skilled in the art will understand that such guidance will be adjusted according to individual circumstances. The dose can also vary for local administration, such as intranasal, inhalation, etc., or for systemic administration, such as intramuscular, intraperitoneal, intravenous, etc. Typically at least about 10 4at least about 10 engineered cells / kg 5 engineered cells / kg; at least about 10 6 engineered cells / kg, at least about 10 7 engineered cells / kg or more.
[0157] In the case where the engineered cells are T cells, the enhanced immune response can be manifested as an increase in the cytolytic response of T cells to target cells present in the receptor, such as elimination of tumor cells, infected cells; reduction of symptoms of autoimmune diseases, etc.
[0158] Engineered T cells can be provided in the form of a pharmaceutical composition suitable for therapeutic use, for example, a pharmaceutical composition suitable for human therapy. Therapeutic preparations containing these cells can be frozen or prepared by mixing with a physiologically acceptable carrier, excipient or stabilizer in the form of an aqueous solution (Remington, The Science of Pharmacy, 16th Edition, Osol, A. Ed. (1980)) to prepare a therapeutic preparation, which is stored in the form of an aqueous solution. The formulation, administration and dosage of the cells should comply with good medical practice. Factors to be considered in this case include the specific disease being treated, the specific mammal being treated, the clinical condition of the individual patient, the cause of the disease, the site of drug delivery, the method of administration, the dosing schedule, and other factors known to the physician.
[0159] The cells can be administered by any suitable means, usually parenterally. Parenteral infusion includes intramuscular, intravenous (bolus or slow infusion), intraarterial, intraperitoneal, intrathecal or subcutaneous administration.
[0160] Engineered T cells can be infused into a subject in any physiologically acceptable medium, usually intravascularly, although they can also be introduced into any other convenient site where the cells can find a suitable growth site. Usually, at least 1x10 6 cells / kg, at least 1x10 7 cells / kg, at least 1x10 8 cells / kg, at least 1x10 9 cells / kg, at least 1x10 10 cells / kg or more, usually limited by the number of T cells obtained during collection.
[0161] For example, a typical range for the administration of cells for the practice of the present invention is about 1x10 5 to 5x10 8 viable cells per kg of subject body weight per treatment course. Thus, after adjustment according to body weight, the typical range for the administration of viable cells in human subjects is about 1x10 6 to about 1x10 13live cells, or about 5x10 6 to about 5x10 12 live cells, or about 1x10 7 to about 1x10 12 live cells, or from about 5x10 7 to about 1x10 12 live cells, or from about 1x10 8 to about 1x10 12 live cells, or from about 5x10 8 to about 1x10 12 live cells, or from about 1x10 9 to about 1x10 12 live cells per treatment course. In one embodiment, the cell dose per treatment course is in the range of 2.5 - 5x10 9 live cells.
[0162] A treatment course can be a single dose or multiple doses over a period of time. In some embodiments, the cells are administered as a single dose. In some embodiments, the cells are administered in two or more divided doses over 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 21, 28, 30, 60, 90, 120 or 180 days. The amount of engineered cells administered in such a split-dose regimen can be the same in each administration or can be provided at different levels. A skilled person monitoring the cell administration (e.g., a physician), taking into account the subject's response to the treatment, including the adverse reactions of the treatment as described above and their modulation, can provide a multi-day dosing regimen over time.
[0163] For example, in the current clinical practice of CAR-T cell therapy, CAR-T cells are typically administered in combination with lymphodepletion (e.g., by administering alemtuzumab (monoclonal anti-Cd52), purine analogs, etc.) to facilitate CAR-T cell expansion prior to host immune recovery. In some embodiments, CAR-T cells can be modified to resist alemtuzumab. In one aspect of the invention, the lymphodepletion currently used in combination with CAR-T therapy can be eliminated or reduced by expressing the orthologous ligand of the CAR-Ts of the present invention. As described above, lymphodepletion is typically used for CAR-T cell expansion. However, lymphodepletion is also associated with the major side effects of CAR-T cell therapy. Since the orthologous ligand provides a means for selectively expanding a particular T cell population, the need for lymphodepletion prior to administering the orthologous ligand expressing CAR-Ts can be reduced. The present invention enables the implementation of CAR-T cell therapy without or with reduced lymphodepletion prior to administering the orthologous ligand expressing CAR-Ts.
[0164] In one embodiment, the present invention provides a method for treating a subject suffering from a disease, a disorder or a condition that can be treated with CAR-T cell therapy (e.g., cancer) by administering an ortho-ligand-expressing CAR-Ts in the absence of lymphodepletion prior to administering the ortho-ligand CAR-Ts. In one embodiment, the present invention provides a method for treating a mammalian subject suffering from a disease associated with the presence of an abnormal cell population (e.g., a tumor), the cell population being characterized by the expression of one or more surface antigens (e.g., tumor antigens), the method comprising the steps of: (a) obtaining a biological sample comprising T cells from an individual; (b) enriching the biological sample for the presence of T cells; (c) transfecting the T cells with one or more expression vectors. The vector comprises a nucleic acid sequence encoding a CAR and a nucleic acid sequence encoding an orthogonal receptor, the antigen-targeting domain of the CAR being capable of binding at least one antigen present on the abnormal cell population; (d) ex vivo expanding a population of CAR-T cells expressing the orthogonal receptor; (e) administering a pharmaceutically effective amount of the CAR-T cells expressing the orthogonal receptor to the mammal; and (f) modulating the growth of the CAR-T cells expressing the orthogonal receptor using a ligand that selectively binds to the orthogonal receptor expressed on the CAR-T cells. In one embodiment, the foregoing method is associated with lymphodepletion or immunosuppression of the mammal prior to the commencement of the CAR-T cell treatment process. In another embodiment, the above method is carried out in the absence of lymphodepletion and / or immunosuppression of the mammal.
[0165] The preferred formulation depends on the intended mode of administration and therapeutic application. Depending on the desired formulation, the composition may also include a pharmaceutically acceptable non-toxic carrier or diluent, which is defined as a carrier commonly used for formulating pharmaceutical compositions for administration to animals or humans. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate buffered saline, Ringer's solution, dextrose solution and Hank's solution. Additionally, the pharmaceutical composition or formulation may also include other carriers, adjuvants or non-toxic, non-therapeutic, non-immunogenic stabilizers, etc.
[0166] In some other embodiments, the pharmaceutical composition may also include macromolecules that are slowly metabolized, such as proteins, polysaccharides such as chitosan, polylactic acid, polyglycolic acid and copolymers (e.g., latex-functionalized Sepharose TM , agarose, cellulose, etc.), polyamino acids, amino acid copolymers and lipid aggregates (e.g., oil droplets or liposomes).
[0167] Acceptable carriers, excipients or stabilizers are non-toxic to the recipient at the dosages and concentrations employed and include buffers such as phosphates, citrates and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride); hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butanol or benzyl alcohol; alkyl esters of p-hydroxybenzoic acid such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; counterions which form salts such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants such as TWEEN TM , PLURONICS TM or polyethylene glycol (PEG).
[0168] Preparations for in vivo administration are usually sterile. Sterilization of the compositions of the invention can be accomplished by filtration through sterile filtration membranes.
[0169] Generally, the compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, a liquid carrier prior to injection can also be prepared. As noted above, the formulations can also be emulsified or encapsulated in liposomes or microparticles such as poly(lactide), poly(glycolide) or copolymers to enhance adjuvant effect. Langer, Science 249:1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28:97-119, 1997. The pharmaceutical agents of the invention can be administered in the form of depot injections or implant formulations which can be formulated in such a manner as to permit sustained or pulsatile release of the active ingredient. The pharmaceutical compositions are generally formulated to be sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
[0170] Kits for the methods are also provided. The subject kits include an expression vector encoding an orthogonal cytokine receptor or a cell comprising the expression vector. The kits can further comprise a cognate orthogonal cytokine. In some embodiments, the components are provided in a liquid or solid form in any convenient packaging (e.g., stick packaging, dose packaging, etc.) in a dosage form (e.g., a therapeutically effective dosage form). Reagents for selecting or in vitro deriving cells can also be provided, such as growth factors, differentiating agents, tissue culture reagents, etc.
[0171] In addition to the above components, the subject kit may further include (in certain embodiments) instructions for practicing the subject method. These instructions may be present in the subject kit in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is printed information printed on a suitable medium or substrate (e.g., one or more sheets of paper on which information is printed), the kit packaging, package inserts, etc. Another form in which these instructions may be present is a computer-readable medium on which information has been recorded, e.g., a floppy disk, a compact disc (CD), a portable flash drive, etc. Another form in which these instructions may be present is a website address by which information on a remote website can be accessed via the Internet.
[0172] In some embodiments, the subject compositions, methods, and kits are used to enhance T cell-mediated immune responses. In some embodiments, the immune response is against a disorder that requires depletion or modulation of target cells, such as cancer cells, infected cells, immune cells involved in autoimmune diseases, etc.
[0173] In some embodiments, the disorder is a chronic infection, i.e., an infection that has not been cleared by the host immune system for a period of up to 1 week, 2 weeks, etc. In some cases, chronic infection involves integration of pathogen genetic elements into the host genome, such as retroviruses, lentiviruses, hepatitis B virus, etc. In other cases, chronic infection, such as certain intracellular bacteria or protozoan pathogens, is caused by pathogen cells within host cells. Additionally, in some embodiments, the infection is in a latent stage, such as with herpesviruses or human papillomaviruses.
[0174] The methods of the invention provide for more efficient killing of infected cells by T effector cells of a host organism relative to removal in the absence of treatment and thus can be directed against the intracellular stage of the pathogen life cycle. The method may further include monitoring the therapeutic efficacy in a patient. Monitoring may measure clinical indicators of the infection, such as fever, white blood cell count, etc., and / or directly monitor for the presence of the pathogen.
[0175] In some embodiments, the disorder is cancer. As used herein, the term "cancer" refers to various disorders caused by the abnormal, uncontrolled growth of cells. Cells capable of causing cancer, called "cancer cells," possess characteristics such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rates, and / or certain typical morphological features. Cancer can be detected in a variety of ways, including but not limited to detecting the presence of a tumor or tumors (e.g., by clinical or radiological means), examining cells within a tumor or other biological samples (e.g., from a tissue biopsy), measuring blood markers indicative of cancer, and detecting genotypes indicative of cancer. However, a negative result in one or more of the above detection methods does not necessarily indicate the absence of cancer; for example, as demonstrated by subsequent recurrence, patients who have shown a complete response to cancer treatment may still have cancer.
[0176] The present invention has now been fully described, and it will be apparent to those of ordinary skill in the art that various changes and modifications can be made without departing from the spirit or scope of the invention.
[0177] Experiment
[0178] Orthogonal IL-2 and IL-2Rβ
[0179] Here, we describe an invention involving engineered cytokines and receptors that are capable of selectively expanding desired cell subsets in the context of ex vivo adoptive cell therapy. The invention describes the cytokine interleukin-2 (IL-2) and its receptor IL-2Rβ chain (IL-2Rβ), which are capable of specifically expanding T cells in adoptive cell therapy, thus addressing an unmet need in immunotherapy. The methods described herein can be generalized to any setting of adoptive cell therapy where cells are stimulated by a specific receptor-ligand pair, including bone marrow and stem cell transplantation, and many other ways.
[0180] Orthogonal IL-2 and IL-2Rβ ligand-receptor pairs are specifically described. A direct homolog version of IL-2 and a direct homolog version of IL-2Rβ that specifically bind to each other but not to the wild-type counterparts are provided. Multiple orthogonal IL-2 variant sequences with different degrees of affinity for orthogonal IL-2Rβ are provided. Orthogonal IL-2-dependent signal transduction and T cell proliferation of T cells engineered to express orthogonal IL-2Rβ are shown.
[0181] IL-2 has emerged as an attractive biologic for the treatment of cancer and autoimmunity due to its ability to promote the expansion of effector T cells and regulatory T cells, respectively. However, this pleiotropy of IL-2, along with off-target toxicity, limits its use in the clinic. The ability to decouple the immunostimulatory and immunosuppressive properties of IL-2 could provide an improved form of IL-2 immunotherapy.
[0182] This article demonstrates the ability of engineered T cells to express an orthogonal IL-2Rβ. It shows that these engineered T cells respond to orthogonal Il-2, resulting in phosphorylation of downstream signaling molecules (such as STAT5) and T cell proliferation. Compared with the activity of wild-type IL-2, the activity of orthogonal IL-2 against wild-type T cells is completely eliminated or significantly weakened. Therefore, selective T cell expansion using the orthogonal IL-2 / IL-2 receptor pair is demonstrated.
[0183] Applications of the orthogonal IL-2 / IL-2 receptor pair include, but are not limited to, selective expansion of tumor-reactive cytotoxic T cells for cancer treatment, selective expansion of NK cells for infectious diseases and / or cancer, and selective expansion of regulatory T cells for autoimmune diseases.
[0184] Since the mutation disrupts but does not completely eliminate binding to IL-2Rβ, IL-2 variants with a blunted affinity for the intermediate (IL-2Rβ and IL-2Rγ) or the high-affinity wild-type Il-2 receptor (IL-2Rα, Rβ, Rγ) can also be used to selectively target the activity of the direct homolog IL-2 against IL-2Rα-high cells, such as for treating autoimmune diseases. IL-2 variants with an abolished affinity for the IL-2Rβ chain but retaining binding to IL-2Rα and thus acting as competitive antagonists of wild-type IL-2 by inhibiting the formation of the high-affinity IL-2R can be used to treat autoimmune or graft-versus-host diseases.
[0185] The general concept of generating and utilizing the orthogonal IL-2 / IL-2 receptor pair to control T cell expansion is as Figure 1 shown in the schematic diagram. Figure 2 A workflow is provided, including steps for generating a direct homolog of IL-2Rβ lacking binding to wild-type IL-2 using structure-guided mutagenesis. Mutations predicted to disrupt the binding of IL-2Rβ to wild-type IL-2 were experimentally confirmed using a yeast-based screening assay and further verified using purified recombinant proteins by surface plasmon resonance. Using this method, many point mutations in IL-2Rβ that disrupt binding to wild-type IL-2 were described, and each of these receptor variants can act as an orthogonal receptor. Single point mutations can also be combined with one, two, or more additional point mutations to generate a larger library of IL-2Rβ direct homologs.
[0186] The sequences of the orthogonal mouse IL-2Rβ variants are shown in Figure 3 . When combined mutations disrupt the binding of wild-type IL-2 to these mutations, these mutations can be used as single point mutations or any combination thereof to generate IL-2Rβ direct homologs with 1, 2, 3, or more point mutations.
[0187] Figure 4Shows the characteristics of the mIL-2Rβ variant, which contains the amino acid changes H134D and Y135F that eliminate wild-type mIL-2 binding. These two residues are known IL-2 interaction hotspots (Ring A et al., Nat Immunol (2012) 13:1187-95), and we confirmed that this mutation disrupted the binding of wild-type IL-2 by surface plasmon resonance (SPR).
[0188] Figure 5 Illustrates the workflow of engineering orthogonal IL-2 / IL-2Rβ pairs. A direct homolog library of the resulting IL-2 was randomized for residues that are proximal to or in contact with the orthogonal direct homolog amino acid residues of IL-2Rβ. Using yeast display, IL-2 variants that bind the direct homolog IL-2Rβ and discard clones that bind wild-type IL-2Rβ were selected. This process can be repeated using site-directed mutagenesis or error-prone mutagenesis to generate IL-2 variants with different binding characteristics to the ortholog rather than wild-type IL-2Rβ. Using this method, we generated a library of IL-2 direct homologs: 1) retained binding to the IL-2Rα chain (green curve), indicating the intact structural integrity of the orthogonal IL-2 variants displayed by yeast, 2) bound to the orthogonal IL-2Rβ (orange curve), but 3) did not bind to wild-type IL-2Rβ (blue curve).
[0189] The sequences of the characterized orthogonal mouse IL-2 variants are shown in Figure 6 . Figure 15 Shows the alignment of mouse IL-2 and IL-2Rβ with their human counterparts. These 4 sequences provide a reference for the native or wild-type sequences. The amino acid residues that were altered to generate the orthogonal mouse IL-2 / IL-2Rβ pair are mainly conserved in humans. Thus, the orthogonal mouse IL-2 and IL-2Rβ sequences can be translated into human IL-2 and IL-2Rβ proteins.
[0190] As Figure 7 shown, the orthogonal IL-2 variant binds to the orthogonal IL-2Rβ with an affinity similar to or greater than that of wild-type IL-2 and IL-2Rβ interaction. Soluble orthogonal IL-2 or wild-type IL-2 protein was flowed over a sensor chip coated with wild-type or orthogonal IL-2Rβ. Binding was determined by surface plasmon resonance (SPR), and the curves were fit using a 1:1 binding model. As Figure 8 shown, the orthogonal IL-2 variant exhibited blunted activity (phosphoSTAT5) against wild-type CD25-positive and CD25-negative splenocytes.
[0191] The generation of mouse CTLL-2 T cells expressing primary IL-2Rβ is shown in Figure 9In this study, we created an immortalized mouse T cell line (CTLL-2) that expresses orthogonal IL-2Rβ (orthogonal CTLL-2) by lentiviral transduction with a gene encoding a full-length orthogonal receptor. Transduced cells were selected with puromycin, a toxin to untransduced cells, to generate a stable CTLL-2 cell line that expresses both wild-type and orthogonal IL-2Rβ. This cell line was also positive for CD25 and CD132 and thus represents T cells expressing the high-affinity IL-2 receptor complex. Antibodies used to detect cell surface IL-2Rβ (CD122) do not distinguish between wild-type and orthogonal IL-2Rβ. Thus, an increase in mean fluorescence intensity between wild-type and orthogonal IL-2Rβ CTLL-2 cells indicates that these cells express the orthogonal receptor. Their resistance to puromycin, which is encoded by the same vector used to express orthogonal IL-2Rβ, further supports this.
[0192] As Figure 10 shown, the first set of orthogonal IL-2 variants is selective for orthogonal T cells. To interrogate orthogonal IL-2 signaling, we utilized the CTLL-2 cell model, either unmanipulated (wild-type) or transduced to also express orthogonal IL-2Rβ (orthogonal). We then determined the ability of wild-type or various orthogonal IL-2 clones to induce STAT5 phosphorylation (a quantitative readout of IL-2-dependent signal transduction). We identified many orthogonal IL-2 variants that induced selective STAT5 phosphorylation on orthogonal IL-2Rβ-expressing cells compared to wild-type cells. Dose-response curves for selected clones are shown as Figure 11 shown.
[0193] T cells derived from primary lymph nodes were engineered to express orthogonal IL-2Rβ (H134D Y135F). In addition to our immortalized mouse T cell model, we also generated orthogonal IL-2Rβ-expressing primary mouse T cells by isolating mouse lymph node and spleen cells, activating them with CD3 / CD28, and then retroviral transduction with a gene encoding a full-length orthogonal receptor. This construct also contained an IRES followed by the fluorescent protein YFP, allowing confirmation of transduction by FACS analysis of YFP expression. Mouse T cells also express the high-affinity IL-2 receptor complex (e.g., CD25, CD122, and Cd132), as Figure 12 shown
[0194] Orthogonal IL-2 variants induced selective STAT5 phosphorylation on orthogonal IL-2Rβ-expressing primary mouse T cells, as Figure 13 shown.
[0195] Orthogonal IL-2 variants that signal selectively through orthogonal IL-2Rβ compared to wild-type CTLL-2 cells ( Figure 11) also induces selective expansion of CTLL-2 cells expressing orthogonal IL-2Rβ( Figure 14 ).
[0196] The orthogonal IL-2 engineering approach was also applied to human IL-2 and human IL-2Rβ. We introduced the H133D Y134F mutations used to create the murine orthogonal IL-2Rβ into human IL-2Rβ because these residues are highly conserved between mouse and human. Indeed, wild-type hIL-2Rβ binding yeast showed wild-type Il-2, while the hIL-2Rβ H133D Y134F mutant (orthogonal-hIL-2Rβ) lacked detectable binding to wild-type IL-2( Figure 15 ). We created a library of human IL-2 mutants displayed on the yeast surface by randomizing residues predicted to contact or be proximal to the H133D Y134F mutations and selected IL-2 variants that bound the ortholog but not wild-type human IL-2Rβ. This protocol was the same as that used to engineer the murine IL-2 orthogonal pair and was successful for the human pair. The method is shown in Figure 16. A set of common mutations was identified, indicating convergence of the ortho-hIL-2 sequences capable of binding the ortho-hIL-2Rβ, as Figure 16C shown.
[0197] The polypeptides of the invention are also active in vivo. A murine model was used to demonstrate selective expansion or increased survival of T cells expressing orthogonal IL-2Rb in mice, as Figures 17-19 shown. The orthogonal IL-2 clone 1G12 / 149 was shown to selectively expand orthogonal but not wild-type murine T cells. Treatment with wild-type IL-2 led to expansion of both wild-type and orthogonal T cells compared to the PBS control, while treatment with the orthogonal IL-2 clone 1G12 / 149 selectively expanded orthogonal T cells that had limited activity against wild-type T cells.
[0198] Example 2
[0199] Human IL-2 direct ortholog
[0200] Materials and Methods
[0201] Protein production. The DNA encoding wild-type human IL-2 was cloned into the insect expression vector pAcGP67-A, which contains an 8xHIS tag at the C-terminus for affinity purification. The DNA encoding mouse serum albumin (MSA) was purchased from Integrated DNA Technologies (IDT, Coralville, Iowa 52241) and cloned into pAcGP67-A as a fusion between the N-terminus of hIL-2 and the C-terminus of MSA. Variants of orthogonal human Il-2 isolated from activity screening were synthesized as Gblocks (IDT) and cloned into the pAcGP67-A-MSA vector by overlap extension cloning.
[0202] Using the baculovirus expression system (BD Biosciences), the insect expression DNA construct was transfected into Trichoplusia ni (High ) cells (Invitrogen), purified by Ni-NTA, and then subjected to size exclusion chromatography on a Superdex-200 column, and sterile phosphate-buffered saline (PBS) was formulated. The protein was concentrated and stored at -80 °C.
[0203] Mammalian expression vectors. The full-length human CD25 was cloned into the lentiviral vector pCDH-CMV-MSC-EF1-Puro (System Biosciences). Using mutagenic primers introducing H133D and Y134F mutations, the cDNA encoding full-length human IL-2Rβ was used as a template by overlap extension PCR to clone full-length orthogonal IL-2Rβ. The resulting PCR product was cloned into the retroviral vector pMSCV-MCS-IRES-YFP.
[0204] Cell culture. The YT-NK-like cell line was generously provided by Dr. Yodoi Junji of Kyoto University. YT-cells were transduced with pCDH-CMV-MSC-EF1-Puro-hCD25 lentivirus and selected in 10 μg / mL puromycin to obtain YT cells stably expressing full-length human CD25 (YT+). YT+ cells were transduced with a retrovirus containing pMSCV-MCS-IRES-YFP-orthogonal-human-Rβ, and the YFP+ (orthogonal) population was enriched in purity by FACS sorting. HEK293T cells were generously provided by the laboratory of Dr. Irving Weissman of Stanford University. HEK293T cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 1% L-glutamine (L-glu), and 1% penicillin and streptomycin (P / S). YT cells were maintained in RPMI complete (RPMI+GlutaMax+10% FBS, 1% L-Glu, 1% NaPyr, 1% NEAA, 18 mM HEPES, and 1% pen / strep).
[0205] Lentivirus and retrovirus production. Lentiviruses were produced in HEK293T cells using third-generation packaging vectors. Briefly, HEK293T cells were seeded at a density of 5x10 6 cells per 10 cm tissue culture dish and allowed to adhere in complete medium (DMEM, 10% FBS, 1% L-Glu, 1% Pen / Strep) for 5 - 7 hours. The supernatant was removed and replaced with low FBS (5%) DMEM (10 mL), and the cells were transfected with pCDH:psPAX2:pMD2G at a ratio of 4:2:1 according to the manufacturer's instructions of the HP DNA transfection reagent (Sigma-Aldrich) and cultured overnight in complete medium at 37°C. The medium was removed and replaced with 7.5 mL low FBS DMEM (DMEM, 5% FBS, 1% L-Glu, 1% P / S). Lentiviruses were collected from the supernatant 24 and 48 hours later, pooled, clarified through a 0.45 μm filter, precipitated with PEG-it virus precipitation solution (System Bio), resuspended in 1 / 100 volume of the original medium, snap-frozen in liquid nitrogen, and stored at -80°C. Retroviruses were produced in HEK293T cells. Briefly, HEK293T cells were seeded at a density of 5x10
[0206] cells per 10 cm tissue culture dish and allowed to adhere in complete medium (DMEM, 10% FBS, 1% L-Glu, 1% Pen / Strep) for 5 - 7 hours. The supernatant was removed and replaced with low FBS (5%) DMEM (10 mL), and the cells were transfected with pCDH:psPAX2:pMD2G at a ratio of 4:2:1 according to the manufacturer's instructions of the HP DNA transfection reagent (Sigma-Aldrich) and cultured overnight in complete medium at 37°C. The medium was removed and replaced with 7.5 mL low FBS DMEM (DMEM, 5% FBS, 1% L-Glu, 1% P / S). Lentiviruses were collected from the supernatant 24 and 48 hours later, pooled, clarified through a 0.45 μm filter, precipitated with PEG-it virus precipitation solution (System Bio), resuspended in 1 / 100 volume of the original medium, snap-frozen in liquid nitrogen, and stored at -80°C. 6Cells were seeded at a density of, and allowed to adhere in complete medium (DMEM, 10% FBS, 1% L-Glu, 1% P / S) for 5 - 7 hours. The supernatant was removed and supplemented with low FBS DMEM (10 mL), and the cells were transfected with a 1.5:1 ratio of pMSCV retroviral vector and pCL10A packaging vector (Novus Biologicals) (a gift from Dr. Melissa McCracken of Stanford University), according to the recommendations of the HP manufacturer, and cultured overnight in low FBS DMEM. The medium was removed and supplemented with 7.5 mL of low FBS DMEM, and cultured for an additional 24 hours. The medium was collected, clarified using a 0.45 μm filter, and snap-frozen in liquid nitrogen for storage at -80 °C. The medium was supplemented (low FBS DMEM) and the cells were cultured for an additional 24 hours, and the virus was collected and stored as above.
[0207] Yeast display of IL-2. Human IL-2 was displayed on the surface of the yeast Saccharomyces cerevisiae strain EBY100 along with an N-terminal cMyc epitope tag by fusing it to the C-terminus of Aga2 using the pCT302 vector that has a 3C protease cleavage site between the C-terminus of Aga2 and the N-terminus of IL-2. Briefly, competent EBY100 was electroporated with a plasmid encoding yeast displaying hIL-2 and recovered overnight in SDCAA selection medium at 30 °C. The transformed yeast was passaged once in SDCAA, the logarithmic-phase yeast culture was pelleted, and resuspended at an OD600 of 1.0 in SGCAA induction medium containing 10% SDCAA and cultured at 20 °C for 24 hours. By using Alexa Fluor® 488-labeled anti-cMyc mAb (1:100 dilution; Cell Signaling) and Streptavidin (SA) tetramer of Alexa Fluor® 647-labeled wild-type hIL-2Rβ (500 nM SA) to stain the yeast, surface expression of functional hIL-2 was confirmed by FACS.
[0208] Generation of a human IL-2 mutant yeast display library.
[0209] Create a site-directed library by assembled PCR using primers with the following degenerate codons: Library 3 (E15, H16, L19, D20, Q22, M23): (SEQ ID NO:10) 5’-CAAGTTCTACAAAGAAAACACAGCTACAACTGNHKNHKTTACTTNHKNHKTTANHKNHKATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTC-3’ Library 4 (E15, H16, L19, D20, M23, N88): (SEQ ID NO:11) 5’-GTTCTACAAAGAAAACACAGCTACAACTGNHK NHKTTACTTNHKNHKTTACAGNHKATTTTGAATGGAATTAATAATTACAAGAATCC-3’, (SEQ ID NO:12) 5’-CCCAGGGACTTAATCAGCNHKATCAACGTAATAGTTCTGGAACTAAAGGG-3’.
[0210] The following primers are used for all libraries: (SEQ ID NO:13) 5’-CGGTAGCGGTGGGGGCGGTTCTCTGGAAGTTCTGTTCCAGGGTCCGAGCGGCGGA-3’, (SEQ ID NO:14) 5’-GTAGCTGTGTTTTCTTTGTAGAACTTGAAGTAGGTGCGGATCCGC CGCTCGGACCCTGG-3’, (SEQ ID NO:15) 5’-CTTAAATGTGAGCATCCTGGTGAGTTTGGGATTCTTGTAATTATTAATTCCATTCAAAAT-3’, (SEQ ID NO:16) 5’-CCAGGATGCTCA CATTTAAGTTTTACATGCCCAAGAAGGCCACAG-3’, (SEQ ID NO:17) 5’-GAGGTTTGAGTT CTTCTTCTAGACACTGAAGATGTTTCAGTTCTGTGGCCTTCTTGGGC-3’, (SEQ ID NO:18) 5’-CAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGC-3’, (SEQ ID NO:19) 5’-GATTAAGTCCCTGGGTCTTAAGTGAAAGTTTTTGCTTTGAGCTAAATT TAGCACTTCCTC-3’, (SEQ ID NO:20) 5’-CAGCATATTCACACATGAATGTTGTTTCAGATC CCTTTAGTTCCAGAACTATTACGTTG-3’, (SEQ ID NO:21) 5’-GAAACAACATTCATGTGTGAA TATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAAC-3’, (SEQ ID NO:22) 5’-GAGATG ATGCTTTGACAAAAGGTAATCCATCTGTTCAGAAATTCTACAATGGTTGCTG-3’, (SEQ IDNO:23) 5’-GATTACCTTTTGTCAAAGCATCATCTCAACACTAACTGCGGCCGCTTCTGGTGG CGAAC-3’, (SEQID NO:24) 5’-GATCTCGAGCAAGTCTTCTTCGGAGATAAGCTTTTGTTC GCCACCAGAAGCGG-3’.
[0211] The mutant IL-2 gene PCR products were assembled using Pfu Ultra DNA polymerase (Agilent) and an equimolar mixture of each primer. The DNA products were further PCR amplified using Phusion DNA polymerase (NEB) with primers (SEQ ID NO:25) 5’-CGGTAGCGGTGGGGGCGGTTC-3’ and (SEQ ID NO:26) 5’-CGAAGAAGACTTGCTCGAGATC-3’. The resulting assembled PCR products were gel purified and electroporated into EBY-100 yeast with the linearized pCT302 vector to generate a library of ~2x10 8 transformants.
[0212] Evolution of orthogonal IL-2. The selection of yeast clones specifically binding to orthogonal IL-2R was performed using a combination of magnetic-activated cell sorting (MACS) and FACS. The first round of selection was performed with 2x10 9 yeasts, approximately 10-fold of the library diversity, to ensure 100% coverage of all transformants. The overall strategy employed was to first enrich the library of all full-length hIL-2 variants binding to orthogonal IL-2R (rounds 1-3), and then use negative selection to remove IL-2 clones binding to wild-type IL-2R, reduce the concentration of orthogonal IL-2R, and enrich the affinity of IL-2 clones binding to orthogonal IL-2R.
[0213] Yeast-based binding and functional screening. Single yeast clones were isolated by culturing on SDCAA plates and single colony extraction or single cell FACS into 96-well round-bottom tissue culture plates containing 100 μL of SDCAA and cultured overnight at 30 °C in an orbital shaker. The yeast clones were further amplified in 1.5 mL of SDCAA per well in a 96-well deep-well V-bottom plate at 30 °C for 24 h, and then induced in SGCAA medium containing 10% SDCAA in an orbital shaker at 20 °C for 72 h, starting with an OD600 of 1.0, also in 1.5 mL and 96-well deep-well V-bottom plates. The induced yeast was pelleted, washed once with PBS, and resuspended in cleavage medium (RPMI containing 25 mM HEPES, 0.2 mM TCEP, 20 μg / mL 3C protease) at 200 μL / well and incubated with stirring at room temperature for 5 min and overnight at 4 °C without stirring. The yeast was pelleted and passed through a 96-well 0.45 μm cellulose acetate filter plate (cat. no. 7700-2808, GE Healthcare). Yt+ (wild-type and ortholog-expressing) and Yt- were inoculated as described in the IL-2R signaling method section, 50 μl of clarified yeast supernatant containing mutant IL-2 clones was added, and incubated at 37 °C for 20 min. The reaction was terminated and pSTAT5 was quantified as described below. Using (TreeStar Inc., Ashland OR) Quantify the percentage of wild-type or orthogonal-YT cells that are pSTAT5+, and use it to select clones with selective or specific activity against orthogonal-YT+ cells.
[0214] Retroviral transduction of human peripheral blood mononuclear cells (PBMCs). The leukoreduction chamber was obtained from Stanford Blood Center. Blood was drained into a sterile 50 ml conical tube (∼7 mL), and PBS + 2% FBS was added to a total of 34 mL. The density gradient medium (15 ml, Ficoll-Paque Plus, GE Healthcare, 17-1440-03) was loaded into two -50 tubes (Stemcell, 15450), and 17 mL of the diluted cells was gently pipetted on top. The tubes were spun at 1200 x g for 15 minutes at room temperature. The top layer containing PBMCs was poured into a new tube and RPMI was added to 50 mL. The cells were spun at 1200 rpm for 5 minutes to pellet. The pellet was resuspended in 10 mL of ACK lysis buffer (Gibco A10492-01) for 4 minutes and quenched to 40 mL with RPMI complete. The cells were pelleted again, resuspended completely in 15 mL of RPMI and counted. The cells (1x10 6 ) were seeded into each well of a 24-well tissue culture plate, and 25 ul of HumanT-Activator CD3 / CD28 (cat. no. 11131D) and 100 U / ml hIL-2 were added to each well. The cells were activated in an incubator at 37 °C for 48 hours.
[0215] Transduce activated human PBMCs by spinfection (see Berggren WT, Lutz M, Modesto V. General spinfection Protocol December 10, 2012. In: StemBook [Internet]. Cambridge (MA): Harvard Stem Cell Institute; 2008) using un-concentrated retroviral supernatant (∼2 mL per well) containing 10 μg / mL polybrene and 100 IU / mL hIL-2, placed at 32 °C and 2500 RPM for 1.5 hours. The viral supernatant was gently aspirated and replaced with fresh RPMI complete medium containing 100 IU / mL hIL-2, and cultured at 37 °C for 24 hours. The cells were collected by gentle pipetting and removed with a magnet Pellet the cells by centrifugation and resuspend at 1x10 6Resuspended at a density of cells / mL in fresh RPMI complete medium containing 100 IU / mL hIL-2 and amplified overnight at 37 °C, followed by further downstream cell assays.
[0216] IL-2R signaling is carried out through phosphorylation of STAT5. IL-2 and orthogonal IL-2 signal transduction are quantified by intracellular pSTAT5. Pellet the actively growing YT+ and Yt+ orthogonal cells, combine them in a 50 / 50 ratio, and seed them at a density of 5 x 10 5 cells per well in an ultra-low binding 96-well round-bottom plate (Cat. No.: 7007; Costar) in 50 μL of warm medium. Stimulate the cells by adding 50 μL of medium containing serial dilutions of wild-type or orthogonal IL-2 at 37 °C for 20 minutes, and terminate the reaction by fixing with 1.5% paraformaldehyde for 10 minutes at room temperature (RT) with agitation. Pellet the cells, decant, and permeabilize with 200 μL of 100% ice-cold methanol on ice for at least 30 minutes, or incubate overnight at -80 °C. Wash the fixed and permeabilized cells three times with FACS buffer and detect intracellular phosphorylated STAT5 with Alexa Fluor 647-conjugated anti-STAT5pY694 (BD Biosciences) diluted 1:50 in FACS buffer, and incubate at 4 °C in the dark for 1 hour. Wash the cells and analyze them on a flow cytometer equipped with a high-throughput autosampler (Beckman Coulter). The data represent the mean fluorescence intensity, and the points are fitted to a log(agonist) vs response (three-parameter) model using Prism (GraphPad). All data are expressed as mean (n = 3) ± standard deviation. Primary human PBMC proliferation assay in vitro. Human peripheral blood mononuclear cells containing a mixture of wild-type and ortho-transduced T cells were collected by centrifugation, resuspended in RPMI complete medium lacking hIL-2, and seeded at a density of 50,000 cells per hole (50 μL) in a 96-well round-bottom tissue culture plate (Day 1). Stimulate cell growth by adding serial dilutions of wild-type or orthogonal IL-2 (50 μL) to a total volume of 100 μL and culture at 37 °C for 2 days. On Day 3, the cells were additionally supplemented with fresh cytokines and cultured for another 2 days in a 100 μL volume. On Day 5, 50 μL of DAPI was added to a final concentration of 0.5 μg / mL, and the cell count of each test population was quantified by FACS using a
[0217] flow cytometer equipped with a high-throughput sampler. After gating on live cells based on FSC and SSC and DAPI negativity, the total number of live cells in a set volume was determined. Using (Tree Star Inc.) analyzed the data. The data represent the total live cell count plotted against cytokine concentration, or the ratio of orthotopic cells to total live cells plotted against cytokine concentration. The data are presented as mean (n = 4) ± SD.
[0218] As shown in Figure 22, orthogonal human IL-2 signals in vitro through the orthogonal IL-2R expressed in YT cells. As shown in Figure 23, orthogonal human IL-2 preferentially expands human PBMCs expressing the orthogonal IL-2R. Human PBMCs were isolated, activated, and transduced with a retrovirus containing orthogonal human IL-2Rβ with an IRES YFP (YFP+). The initial ratio of YFP+ cells to total live cells was 20%. Plated 5 x 10 5 cells on day 1 with the indicated concentrations of MSA-human IL-2 (circles) or orthotopic variants MSA-SQVLKA (diamonds), MSA-SQVLqA (squares), or MSA-1A1 (black triangles), and re-fed with the same concentrations on day 3. On day 5, the plates were read by flow cytometry. (A) The ratio of YFP+ (orthogonally-expressing) cells to total live cells was calculated, and the mean (n = 4) ± SD was plotted against concentration (left). (B) The total live cell count (mean (n = 4) ± SD) was plotted against cytokine concentration (right). At the same concentrations, the orthogonal cytokine does not support as much total cell growth as wild-type MSA-hIL-2, but is selective in strongly expanding orthotopically-expressing T cells.
[0219] The amino acid substitutions in the orthogonal hIL-2 protein are shown in Table 1 below.
[0220] Table 1
[0221]
Claims
1. An engineered human IL-2 polypeptide, which (i) has a significantly reduced binding to natural human CD122; (ii) contains at least one amino acid substitute at residues T51 and R81 instead of the amino acids of the natural protein, or contains the amino acid substitute M23A; (iii) contains amino acid substitutes at each of E15, H16, L19, and D20.
2. The engineered human IL-2 polypeptide according to claim 1, wherein the polypeptide contains one or more amino acid substitutes selected from: [E15D, E15T, E15A, E15S], [H16N, H16Q], [L19V, L19I, L19A], [D20L, D20M], [Q22S, Q22T, Q22E, Q22K, Q22E], [M23A, M23W, M23H, M23Y, M23F, M23Q, M23Y], [G27K, G27S], [R81D, R81Y], [N88E, N88Q], [T51I].
3. The engineered human IL-2 polypeptide according to claim 1 or 2, wherein the polypeptide contains the amino acid substitutes E15S, H16Q, L19V, and D20L.
4. The engineered human IL-2 polypeptide according to any one of claims 1-3, which further contains the amino acid substitute Q22K.
5. The engineered human IL-2 polypeptide according to any one of claims 1-4, which contains the amino acid substitute T51I.
6. The engineered human IL-2 polypeptide according to any one of claims 1-5, which contains the amino acid substitute R81D or R81Y.
7. The engineered human IL-2 polypeptide according to claim 1, which contains a set of amino acid substitutes [E15D, H16N, L19V, D20L, Q22T, M23A].
8. The engineered human IL-2 polypeptide according to claim 1, which contains a set of amino acid substitutes [E15D, H16N, L19V, D20L, Q22K, M23A].
9. The engineered human IL-2 polypeptide according to claim 1, which contains a set of amino acid substitutes [E15S, H16Q, L19V, D20L, M23Q, R81D, T51I].
10. The engineered human IL-2 polypeptide according to claim 1, which contains a set of amino acid substitutes [E15S, H16Q, L19V, D20L, M23Q, R81Y].
11. The engineered human IL-2 polypeptide according to any one of claims 1-10, wherein the polypeptide binds to and activates an orthogonal human CD122 protein.
12. The engineered human IL-2 polypeptide according to claim 11, wherein the orthogonal human CD122 protein is modified at one or more residues selected from R41, R42, Q70, K71, T73, T74, V75, S132, H133, Y134, F135, E136, Q214.
13. The engineered human IL-2 polypeptide according to claim 12, wherein the orthogonal human CD122 protein is modified at H133 and Y134.
14. The engineered human IL-2 polypeptide according to claim 13, wherein the orthogonal human CD122 protein comprises the amino acid substitutions H133D and Y134F.
15. A system for selectively activating a receptor in a cell, the system comprising: (a) an orthogonal human CD122 receptor comprising amino acid substitutions at H133 and Y134; and (b) the engineered human IL-2 polypeptide according to any one of claims 1-10.
16. The system according to claim 15, wherein the orthogonal receptor is expressed by a mammalian cell.
17. The system according to claim 16, wherein the cell is an immune cell or a stem cell.
18. The system according to claim 17, wherein the immune cell is a T cell.
19. The system according to claim 18, wherein the T cell is a CAR-T cell.
20. A pharmaceutical composition comprising the engineered human IL-2 polypeptide according to any one of claims 1-10; and a pharmaceutically acceptable excipient.
21. A nucleic acid encoding the engineered human IL-2 polypeptide according to any one of claims 1-10.
22. An expression vector comprising the nucleic acid according to claim 21.
23. A cell genetically engineered to comprise the vector according to claim 22.
24. A method of treating an individual, the method comprising introducing an immune effector cell expressing an orthogonal human CD122 receptor comprising amino acid substitutions at H133 and Y134, and selectively activating the cell by contacting it with the engineered human IL-2 polypeptide according to any one of claims 1-10.
25. The method according to claim 24, wherein the immune effector cell is a T cell.
26. The method according to claim 25, wherein the T cell is a CAR-T cell.
27. The method according to any one of claims 24-26, wherein the individual is undergoing cancer treatment.
28. The method according to any one of claims 24-26, wherein the individual is undergoing treatment for an autoimmune disease.
29. The method according to any one of claims 24-26, wherein the individual is undergoing treatment for an infection.
30. A kit comprising the system according to claim 15.
Citation Information
Patent Citations
Improvement in attaching hubs to axles
US173206A
Method for generating high affinity, bivalent binding agents
US20150315566A1
craig
US388398A
Machine for making iron fences
US423426A
Liposomes with enhanced circulation time
US5013556A