A molecular marker associated with nickel ion accumulation in wheat kernels
By identifying the molecular marker SNP4008 in wheat grains, the problem of insufficient identification of genetic loci for nickel ion accumulation in wheat grains in existing technologies has been solved, enabling early prediction of nickel ion content, screening of wheat varieties resistant to nickel stress, and improving wheat yield and environmental adaptability.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2026-05-22
AI Technical Summary
Existing technologies only have limited data to identify the main genetic loci for nickel ion accumulation in wheat grains, making it difficult to screen for superior gene haplotypes and effectively breed wheat varieties tolerant to nickel stress, thus affecting wheat yield and food safety.
A molecular marker SNP4008 associated with nickel ion accumulation in wheat grains was developed, located at positions 693, 584, and 519 on wheat chromosome 6BL. Through high-density SNP microarray and genome-wide association analysis, the QTL site qNi.hnaas-6BL and the tightly linked molecular marker SNP4008 controlling nickel ion accumulation in grains were identified. Haplotype analysis was then performed using these markers to screen for the AA genotype as the dominant haplotype to reduce nickel ion content.
This study provides a method for early prediction of nickel ion content in wheat grains, helping breeders screen germplasm resources resistant to heavy metal nickel ion stress, cultivate new wheat varieties that are more resistant to nickel stress and have strong environmental adaptability, and improve wheat yield and quality.
Smart Images

Figure CN120210409B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of wheat molecular breeding technology, and more specifically, to a molecular marker and its application related to nickel ion accumulation in wheat grains. Background Technology
[0002] Nickel pollution in soil has become a serious global environmental problem. Studies have shown that high concentrations of nickel ions are carcinogenic, and long-term exposure or ingestion increases the risk of cardiovascular disease, lung disease, and various cancers. Wheat, as an important staple crop for humans, provides approximately 20% of the energy and protein in the human diet. High concentrations of nickel ions are toxic, inhibiting key physiological processes such as seed germination, nutrient absorption, and photosynthesis, leading to a decline in wheat yield and quality. Furthermore, nickel in the soil is absorbed by wheat and enters the food chain, posing a serious threat to human health. Therefore, breeding wheat varieties that can tolerate nickel stress and maintain an appropriate balance of nickel ion levels through biofortification is crucial for improving wheat yield, quality, and food security.
[0003] Like other trace element-related traits, nickel ion absorption and translocation are typical quantitative traits, controlled by multiple genes and exhibiting continuous phenotypic variation in natural populations. However, to date, only two studies have identified a small subset of QTL loci controlling nickel ion accumulation in wheat grains. This limited data severely limits the identification of major genetic loci for nickel ion accumulation in wheat grains and the screening of dominant haplotypes. Summary of the Invention
[0004] (a) Technical problems to be solved
[0005] To address the problems existing in the prior art, this invention provides a molecular marker related to the accumulation of nickel ions in wheat grains, thereby solving the technical problems mentioned in the background art.
[0006] (II) Technical Solution
[0007] To achieve the above objectives, the present invention provides the following technical solution: a molecular marker associated with nickel ion accumulation in wheat grains, wherein the molecular marker is SNP4008, located at nucleotides 693,584,519 on chromosome 6BL of the wheat “Chinese Spring” reference genome;
[0008] The molecular markers were obtained by typing wheat SNPs using the wheat 660K gene chip and by screening using the GWAS method.
[0009] The molecular marker is closely linked to the QTL site qNi.hnaas-6BL, which controls the accumulation of nickel ions in wheat grains, and its upstream and downstream nucleotide sequences are TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG.
[0010] The 36th base of this nucleotide sequence exhibits an A / G polymorphism. Haplotype analysis using SNP4008 genotyping data from a natural population and wheat grain nickel ion content data revealed that at the population level, individuals with the AA genotype had significantly lower grain nickel ion content than those with the GG genotype. When the locus was occupied by the AA genotype, the wheat grain nickel ion content was significantly lower than that of individuals with the GG genotype, indicating that the AA genotype is the dominant haplotype controlling nickel ion content in wheat grains and is a favorable allele for limiting nickel ion accumulation in wheat grains.
[0011] The molecular markers can be used for early prediction of nickel ion content in wheat grains, providing new marker resources and applications for breeding new wheat varieties resistant to heavy metal nickel ion stress and improving wheat biofortification breeding methods. This not only helps breeders screen germplasm resources resistant to heavy metal nickel ion stress, but also helps breed new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.
[0012] (III) Beneficial Effects
[0013] Compared with existing technologies, this invention provides a molecular marker associated with nickel ion accumulation in wheat grains, which has the following beneficial effects:
[0014] This application utilizes high-density SNP chip genotyping results, combined with genome-wide association analysis, to identify a novel, previously unreported QTL qNi.hnaas-6BL on chromosome 6BL that controls nickel ion accumulation in wheat grains, along with its closely linked molecular marker SNP4008. This provides theoretical and technical support for screening wheat germplasm resources resistant to heavy metal nickel ion stress and for breeding new wheat varieties (lines) with stronger environmental adaptability. Attached Figure Description
[0015] Figure 1 This is a schematic diagram illustrating the normal distribution of nickel ion content phenotype data in different environmental natural populations in this invention;
[0016] Figure 2 Manhattan plots and QQ-plots of genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models;
[0017] Figure 3Distribution of different allelic genotypes and their corresponding phenotypic data of the QTL site qNi.hnaas-6BL, a tightly linked molecular marker for controlling nickel ion accumulation in wheat grains, in a natural population. Detailed Implementation
[0018] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.
[0019] It should be noted that, unless otherwise specified, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0020] Example 1: Determination and Statistical Analysis of Nickel Ion Content in Wheat Grains
[0021] (1) Sample pretreatment: Mature wheat grains were harvested, dried, and ground, then sieved using a 0.15 mm sieve. 200 mg of whole wheat flour was weighed and placed in 8 ml of concentrated nitric acid solution, allowed to stand for 4-8 hours, and then digested using a microwave digester following the digestion steps of 120℃-5 minutes, 150℃-10 minutes, and 190℃-20 minutes. The digest was filtered and diluted to 50 mL with 1% nitric acid solution. After microwave digestion, the nickel ion content of the natural wheat population grains was determined using inductively coupled plasma mass spectrometry (ICP-MS).
[0022] (2) All experimental materials used in this invention were provided by the Henan Academy of Agricultural Sciences. The natural population consisted of 207 wheat varieties (lines) with rich genetic backgrounds.
[0023] (3) Establishment of standard curve: The mixed standard solution was injected into the inductively coupled plasma mass spectrometer, and the signal response values of nickel and internal standard were measured. The standard curve was plotted with the concentration of nickel as the abscissa and the ratio of the response signal values of nickel to the selected internal standard as the ordinate.
[0024] (4) Nickel ion content determination: Inductively coupled plasma mass spectrometry was used. Blank solution and sample solution were injected into the inductively coupled plasma mass spectrometer, and the signal response values of nickel and internal standard were measured. The concentration of nickel in the digestion solution was obtained according to the standard curve. The nickel ion content data in wheat grains were obtained by repeating the measurement three times (Table 1).
[0025] (5) Phenotypic data analysis of nickel ion content in wheat grains
[0026] First, using the "lem 4" package in R software version 4.2.2, the best linear unbiased prediction (BLUP) for each variety in the two planting sites was estimated according to the method Y = (1|Line) + (1|Loc) + (1|Rep%in%Line:Loc) + (1|Line:Loc) + (1|Line:Loc). This BLUP was used as one environmental data point for candidate association analysis. Second, the "psych" package was used to perform descriptive statistics on the phenotypic data of natural populations in different environments. As shown in Table 1, the nickel ion content in wheat grains varied from 23.46 ug / kg to 294.05 ug / kg in different environments. Figure 1 A, Table 2), and the phenotypic data of nickel ion content in natural populations under different environments all conform to a normal distribution ( Figure 1 B) indicates that the wheat varieties included in this population have extensive genetic diversity, making it an ideal population for subsequent GWAS analysis.
[0027] Table 1. Nickel ion content in wheat grains from natural populations under different environments
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038] Table 2. Descriptive statistics of nickel ion content in natural populations in different environments.
[0039]
[0040] 1SD, standard deviation;
[0041] 2. Kurtosis, a characteristic number that represents the height of the peak value at the mean of a probability density distribution curve.
[0042] 3. Skewness: A measure of the direction and degree of skewness in the distribution of statistical data; it is a numerical characteristic of the degree of asymmetry in the distribution of statistical data.
[0043] Example 2: Genotype Detection
[0044] (1) Extraction of genomic DNA from wheat leaves using the CTAB (Cetyl trimethylammonium bromide) method
[0045] Take 0.5g of fresh wheat leaves and freeze them in liquid nitrogen for 30 seconds, then quickly grind and crush them.
[0046] Add 5000 μL of CTAB extraction buffer at 65℃, incubate in a water bath for 30 min, and perform lysis.
[0047] After cooling to room temperature, add 500 μL of chloroform:isoamyl alcohol (24:1) solution and extract.
[0048] Centrifuge at room temperature for 5 min (12000 rpm / min), aspirate 400 μL of supernatant and transfer to a 1.5 mL centrifuge tube;
[0049] Add an equal volume of frozen isopropanol, centrifuge for 5 min (12000 rpm / min), discard the supernatant, and obtain DNA precipitate;
[0050] Rinse successively with 75% ethanol solution and 100% ethanol solution. After air drying, dissolve the DNA in 200 μL of deionized water for later use.
[0051] Pipette 2 μL of the dissolving solution and use NanoDrop. TM The One system is used for concentration and purity testing.
[0052] (2) Genotyping using SNP chips
[0053] Utilizing Wheat Breeders 660K The microarray gene chip was used to identify the genotypes of 207 varieties (lines) in a natural population. This physical chip contains more than 630,000 specific SNP loci evenly distributed throughout the wheat genome, providing a sufficient number of SNP markers for genotype identification.
[0054] (3) Genotype quality control
[0055] Using PLINK v2.0 software (https: / / www.cog-genomics.org / plink / 2.0 / ), quality control was performed on the genotype data of 207 natural population materials according to the criteria of allele frequency (MAF) greater than 0.05 and genotype data missing rate less than 10%. A total of 224,706 valid marker loci were screened out for subsequent genome-wide association analysis.
[0056] Example 3: Identification and Utilization of SNP4008 Molecular Marker
[0057] (1) Genome-wide association analysis
[0058] We employed a multi-model analysis approach, including GLM (General Linear Model), MLM (Mixed Linear Model), and FarmCPU (Unified Cyclic Probability Model with Fixed and Random Models), and combined phenotypic and genotypic data of nickel ion content in grains from 207 wheat varieties (lines) under various environmental conditions. We then used GAPIT software to conduct association analysis to identify stable genetic loci controlling nickel ion accumulation in wheat grains at the whole-genome level.
[0059] (2) Genetic locus identification
[0060] Under multiple environmental conditions, three analytical models jointly identified a genetic locus qNi.hnaas-6BL that is significantly associated with nickel ion content in wheat grains, and obtained an SNP marker SNP4008 that is closely linked to it under multiple environmental conditions. This locus is located at nucleotides 693, 584, and 519 of chromosome 6BL. Figure 2 ).
[0061] Analysis revealed a genetic locus qNi.hnaas-6BL on chromosome 6BL that controls nickel ion accumulation in wheat grains. The upstream and downstream nucleotide sequences are shown in SEQ IN NO:1. An allelic mutation of 36A-36G exists at the 36th base of this sequence.
[0062] (3) Application of SNP4008 molecular marker
[0063] The upstream and downstream nucleotide sequences of this marker are TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG. A 36A-36G allelic mutation exists at position 36, resulting in nucleotide polymorphism. Haplotype analysis, combining natural population wheat grain nickel ion phenotypic data and genotype data of this mutation site, revealed that individuals with the AA genotype had significantly lower nickel ion content in their wheat grains than those with the GG genotype (Table 3). This indicates that the AA genotype is the dominant haplotype controlling nickel ion accumulation in wheat grains and is a favorable allele for reducing nickel ion toxicity in wheat grains and improving tolerance to heavy metal nickel ion stress. Figure 3 ).
[0064] Table 3. Effects of different SNP4008 marker genotypes on nickel ion accumulation in wheat grains.
[0065]
[0066] 1. The number of varieties (lines) with different alleles in a natural population;
[0067] 2. Analysis of variance was used to analyze the differences in nickel ion content in wheat grains from different allelic populations. P-value < 0.05 was considered statistically significant, and P-value < 0.01 was considered highly statistically significant.
[0068] Figure 2 Manhattan plots and QQ-plots are shown for genome-wide association analysis of nickel ion content in wheat grains using GLM, MLM, and FarmCPU models. The red solid line represents the threshold line of -log10P = 4, indicating that SNP sites above the threshold line are significantly associated with nickel ion content in wheat grains. The red circle represents SNP4008, a SNP site significantly associated with nickel ion content in wheat grains, identified using all three analysis models.
[0069] Figure 3 Distribution of SNP4008, a tightly linked molecular marker at the QTL site qNi.hnaas-6BL controlling nickel ion accumulation in wheat grains, across different alleles and their corresponding phenotypic data in a natural population. Orange represents the distribution of BLUP values in AA genotype varieties (lines), and green represents the distribution of BLUP values in GG genotype varieties (lines). The nickel ion content in wheat grains of AA genotype varieties (lines) is significantly lower than that of GG genotype varieties (lines), indicating a favorable allele.
[0070] sequence
[0071] SEQ IN NO:1
[0072] TACCGAGATAAACAGTGAGTGGTGGGACCCATACC[A / G]AGATATTTCTGGTCTAAATTGGCGCACGACAGTTG
[0073] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. The application of the molecular marker SNP4008 in the early prediction of nickel ion content in wheat grains, characterized by: The molecular marker SNP4008 is associated with the QTL site controlling nickel ion accumulation in wheat grains. qNi.hnaas-6BL The SNP locus is tightly linked and located at nucleotides 693,584,519 on chromosome 6B of the wheat "Chinese Spring" reference genome. Its upstream and downstream sequences are TACCGAGATAAACAGTGAGTGGTGGGACCCATACCGAGATATTTCTGGTCTAAATTGGCGCACGACAGTTG, where the 36th base of this nucleotide sequence exhibits A / G polymorphism. Haplotype analysis using natural population SNP4008 genotyping data and wheat grain nickel ion content data revealed that at the population level, individuals with the AA genotype had significantly lower grain nickel ion content than individuals with the GG genotype. When the locus is occupied by the AA genotype, the wheat grain nickel ion content is significantly lower than that of individuals with the GG genotype. This indicates that the AA genotype is the dominant haplotype controlling nickel ion content in wheat grains and is a favorable allele for limiting nickel ion accumulation in wheat grains.
2. The application according to claim 1, characterized in that: It can be used for early prediction of nickel ion content in wheat grains, which is beneficial not only for breeders to screen germplasm resources that are resistant to heavy metal nickel ion stress, but also for breeding new wheat varieties that are more resistant to nickel ion stress and have stronger environmental adaptability.