Monooxygenase mutant and application thereof in synthesis of 3R, 5S-dihydroxy compound

By catalyzing the debenzyl reaction of 3R,5S-dihydroxy-6-benzyloxy compounds using CYP102A1 mutant, the problems of high cost of catalysts, high pressure hazards and poor selectivity in the prior art are solved, and the preparation of 3R,5S-dihydroxy compounds that are efficient, safe and low-cost are achieved.

CN120230725APending Publication Date: 2025-07-01CHINA PHARM UNIV
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510191130.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

In the prior art, the 3R, 5S-dihydroxy-6-benzyloxy compound has problems such as high catalyst cost, high pressure hazard and poor selectivity in the debenzyl reaction.

Method used

The monooxygenase CYP102A1 mutant was used to catalyze the debenzyl reaction of 3R,5S-dihydroxy-6-benzyloxy compound to produce 3R,5S-dihydroxy compound. Alternatively, dicarbonyl reductase is used in combination with CYP102A1 mutant to catalyze the formation of 3R,5S-dihydroxy compounds.

Benefits of technology

The preparation of 3R, 5S-dihydroxy compounds with high selectivity, safety and environmental protection, and low production costs is achieved, avoiding the problems of high-pressure equipment explosion and high cost of metal catalysts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230725A_ABST
    Figure CN120230725A_ABST
Patent Text Reader

Abstract

According to the invention, the monooxygenase CYP102A1 from Bacillus megaterium is subjected to system modification and optimization, a series of monooxygenase mutants with improved activity and improved debenzylation selectivity are obtained, the activity of the mutant with the optimal effect is improved by 93.4 times compared with that of wild type monooxygenase CYP102A1, and the selectivity is improved to 99.5% from 33.2%. The monooxygenase mutant can be applied to catalytic synthesis of 3R, 5S-dihydroxy compounds, synthesis steps are simplified, reaction selectivity is improved, reaction conditions are mild, the monooxygenase mutant is environmentally friendly and efficient, and the overall efficiency of statin drug synthesis can be improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biocatalytic enzymes. Specifically, it relates to a CYP102A1 mutant of a monooxygenase and its application in the synthesis of 3R, 5S-dihydroxy compounds. Background Art

[0002] Statins such as rosuvastatin and atorvastatin are widely used in lipid-lowering treatment. The synthesis process involves the synthesis of the chiral side chain 3R, 5S-dihydroxy compound, and the removal of the benzyl protecting group. Currently, the main method for removing the benzyl group is palladium-carbon-catalyzed hydrogenolysis debenzylation, which has problems such as explosion of high-pressure equipment, high cost of metal catalysts, and constraints on sensitive groups.

[0003] Monooxygenases include heme-dependent monooxygenases, flavin-dependent monooxygenases, and monooxygenases that utilize pterins, metal ions, or even do not rely on cofactors. They transfer electrons to oxygen to activate oxygen, and have functions such as selectively activating C-H bonds and removing alkyl groups under mild conditions, catalyzing synthetic reactions that are difficult to achieve by many traditional chemical methods, and having great application potential in fine chemistry and the synthesis of drugs and their metabolites. CYP102A1 derived from Bacillus megaterium belongs to heme-dependent monooxygenases, and its redox protein partner involved in electron transfer and the oxidase part are fused on one peptide chain. This fused recombinant structure greatly improves the electron transfer efficiency and the electron coupling efficiency of the oxidation reaction, and CYP102A1 is also one of the monooxygenases with relatively high catalytic efficiency at present.

[0004] There is currently no report on the high-efficiency and highly selective catalysis of the debenzylation reaction of 3R, 5S-dihydroxy-6-benzyloxy compounds by CYP102A1 enzyme. Summary of the Invention

[0005] Aiming at the problems of high catalyst cost, high-pressure danger, and poor selectivity in the preparation of 3R, 5S-dihydroxy compounds by the debenzylation reaction of 3R, 5S-dihydroxy-6-benzyloxy compounds in the prior art, the present invention provides a CYP102A1 mutant of a monooxygenase, a coding gene, a recombinant vector, a recombinant genetic engineering bacterium, and their application in the catalytic preparation of 3R, 5S-dihydroxy compounds. The CYP102A1 mutant of the present invention can highly selectively catalyze the debenzylation reaction of 3R, 5S-dihydroxy-6-benzyloxy compounds to prepare 3R, 5S-dihydroxy compounds. Alternatively, a diketone reductase is used in combination with the CYP102A1 mutant of the present invention to catalyze the formation of 3R, 5S-dihydroxy compounds from diketone compounds. The above applications have advantages such as high selectivity, safety, environmental protection, and low production cost.

[0006] The technical solution adopted by the present invention is as follows:

[0007] The present invention provides a monooxygenase mutant in which at least one amino acid in the amino acid region at positions 78 to 90, the amino acid region at positions 210 to 225, the amino acid region at positions 245 to 260, and positions 21, 23, 162, 164, 174, 187, 189, 425, 429, 442, 444, 445 of the amino acid sequence shown in SEQ ID NO:1 has an amino acid mutation. The mutant described in the present invention can have a mutation based on the amino acid sequence of SEQ ID NO:1 or an amino acid sequence having at least 60%, specifically at least 65%, more specifically 70%, and even more specifically 75%, 80%, 90%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the amino acid sequence of SEQ ID NO:1. Additionally, if an amino acid sequence has homology with the above sequence and has substantially the same or corresponding biological activity as the protein of SEQ ID NO:1, the amino acid sequence with deletions, modifications, substitutions, or additions should also fall within the scope of the present invention.

[0008] Specifically, in the monooxygenase mutant described in the present invention, at least one amino acid at positions 21, 23, 78, 79, 86, 87, 89, 162, 164, 174, 187, 189, 216, 217, 220, 223, 251, 252, 254, 255, 256, 258, 259, 425, 429, 442, 444, 445 of the amino acid sequence shown in SEQ ID NO:1 has an amino acid mutation.

[0009] A specific example of the present invention is that the mutant has at least one of the following mutations in the amino acid sequence shown in SEQ ID NO: 1: N21A, N21V, N21F, D23G, D23A, D23V, D23L, D23F, F162G, F162A, F162V, F162L, S164A, S164V, I174G, I174A, I174V, K187G, K187A, K187F, Q189G, Q189A, Q189L, Q189F, D425A, D425F, Y429A, Y429V, Y429L, Y429F, E442G, E442A, E442V, E442L, E442F, F444G, F444A, F444V, F444L, V445A, V445L, V445F, V78A, V78G, R79A, R79V, R79L, R79F, L86V, L86F, F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q, F87E, S89A, S89V, V216A, V216G, D217A, D217G, D217V, D217L, D217F, I220A, I220G, I220V, I220L, I220F, R223G, R223A, R223L, R223F, D251A, D251G, D251V, D251L, D251F, E252A, E252G, E252V, E252L, E252F, I254A, I254G, I254V, I254L, I254F, R255G, R255A, R255V, R255L, R255F, Y256A, Y256G, Y256V, Y256F, I258A, I258G, I258V, I259G, I259A, I259V, I259L.

[0010] Preferably, the monooxygenase mutant of the present invention has at least one of the following mutations in the amino acid sequence shown in SEQ ID NO: 1: F162G, F162A, F162V, I174G, I174A, V78A, V78G, V78L, V78F, R79V, R79L, R79F, L86F, F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q, F87E, V216A, V216G, D217A, D217G, D217V, D217L, D217F, I220A, I220G, I220L, I220F, R223G, R223F, D251G, I254G, I254F, R255G, R255A, R255V, R255L, R255F, Y256A, I258A, I258V, I259A, I259G.

[0011] More preferably, the monooxygenase mutant of the present invention has a mutation at the 87th amino acid in the amino acid sequence shown in SEQ ID NO: 1, selected from F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E.

[0012] More preferably, the present invention provides a monooxygenase double mutant, which further has a mutation selected from F162A, S164A, Q189G, N21F, D23F, V216A, I220F, R223G, D251F, E252G, I254F, R255V, I258A, D425A, E442A or V445A on the basis of F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E.

[0013] More preferably, the present invention provides a monooxygenase triple mutant, which has a mutation of F162A on the basis of F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E, and further has a mutation selected from V78A, S89A, S164A, I174G, Q189G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, R255V, Y256G, I258A, I259G, D425A, E442A, V445A.

[0014] Preferably, the present invention provides a monooxygenase quadruple mutant, which has mutations F162A and Q189G on the basis of F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E, and further has one of V78A, R79V, S89A, S164A, I174G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, I254F, R255V, Y256G, I258A, I259G, D425A, E442A, V445A.

[0015] Preferably, the present invention provides a monooxygenase quintuple mutant, which has mutations F162A, Q189G and E442A on the basis of F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E, and further has one of V78A, R79V, S89A, S164A, I174G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, I254F, R255V, Y256G, I258A, I259G, D425A, Y429L, V445A.

[0016] Another object of the present invention is to provide a polynucleotide sequence, which encodes the monooxygenase mutant of the present invention.

[0017] In the present invention, any polynucleotide sequence encoding a monooxygenase may fall within the scope of the present invention. For example, the polynucleotide sequence may be a polynucleotide sequence having at least 75%, specifically at least 60%, specifically at least 65%, more specifically 70%, and even more specifically 75%, 80%, 90%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher homology with the polynucleotide sequence of SEQ ID NO:2. Additionally, based on codon degeneracy or considering the preferred codons for protein expression in organisms, the polynucleotide sequence encoding the protein may have various variants in the coding region within the range of not changing the amino acid sequence of the protein expressed from the coding region.

[0018] The monooxygenase of the present invention is not specifically limited as long as it has the corresponding activity, and it may be a monooxygenase derived from the genus Bacillus, specifically such as Bacillus megaterium, but is not limited thereto.

[0019] Another object of the present invention is to provide a recombinant vector constructed by a monooxygenase or a monooxygenase mutant encoding gene, and a recombinant genetically engineered bacterium prepared by transforming the recombinant vector. The recombinant genetically engineered bacterium is prepared as follows: A monooxygenase gene (or mutant gene) is ligated with a protein expression vector pET28a to construct a heterologous expression recombinant plasmid pET28a-CYP102A1 (or pET28a-CYP102A1mut) containing the monooxygenase gene (or mutant gene); The expression recombinant plasmid pET 28a-CYP102A1 (or pET28a-CYP102A1mut) is transformed into the host cell Escherichia coli BL21(DE3) to obtain a recombinant Escherichia coli containing the recombinant plasmid pET28a-CYP102A1 (or pET28a-CYP102A1mut).

[0020] The present invention relates to a recombinant vector constructed by a dicarbonyl reductase encoding gene, and a recombinant genetically engineered bacterium prepared by transforming the recombinant vector. The recombinant genetically engineered bacterium is prepared as follows: A dicarbonyl reductase gene is ligated with a protein expression vector pET28a to construct a heterologous expression recombinant plasmid pET28a-DKR containing the dicarbonyl reductase gene; The recombinant plasmid pET28a-DKR is transformed into the host cell Escherichia coli BL21(DE3) to obtain a recombinant Escherichia coli containing the recombinant plasmid pET28a-DKR.

[0021] The present invention relates to the construction of a coenzyme recycling system. The recombinant Escherichia coli containing the recombinant plasmid pET28a-CYP102A1 (or pET28a-CYP 102A1mut) and the recombinant Escherichia coli containing the recombinant plasmid pET28a-DKR rely on coenzymes NADH (NADPH) for normal catalysis, and an efficient and low-cost coenzyme supply can be achieved by constructing a coenzyme recycling system. The coenzyme recycling system can be constructed by glucose-6-phosphate dehydrogenase, glucose-6-phosphate, NAD + (NADP + ). Glucose-6-phosphate dehydrogenase consumes glucose-6-phosphate to promote the regeneration of coenzyme NAD + (NADP + ) into NADH (NADPH). The coenzyme recycling system constructed by glucose-6-phosphate dehydrogenase, glucose-6-phosphate, NAD + (NADP + ) can be replaced by coenzyme recycling systems including but not limited to the following: 1) Glucose dehydrogenase, glucose, NAD + (NADP + ); 2) Formate dehydrogenase, formate, NAD + (NADP + ), etc.

[0022] The recombinant Escherichia coli containing the recombinant plasmid pET28a-CYP102A1 (or pET28a-CYP102A1mut) and the recombinant Escherichia coli containing the recombinant plasmid pET28a-DKR constructed above, and the recombinant plasmid used can be replaced with pET-22a(+), pET-22b(+), pET-3a(+), pET-3d(+), pET-11a(+), pET-12a(+), pET-14b, pET-15b(+), pET-16b(+), pET-17b(+), pET-19b(+), pET-20b(+), pET-21a(+), pET-23a(+), pET-23b(+), pET-24a(+), pET-25b(+), pET-26b(+), pET-27b(+), pET-28b(+), pE T-29a(+), pET-30a(+), pET-31b(+), pET-32a(+), pET-35b(+), pET-38b(+), pET-39b(+), pET-40b(+), pET-41a(+), pET-41b(+), pET-42a(+), pET-43a(+), pET-43b(+), pET-44a(+), pET-49b(+), pQE2, pQE9, pQE30, pQE31, pQE32, pQE40, pQE70, pQE80, pRSET-A, pRSET-B, pRSET-C, pGEX-5X-1, pGEX-6p-1, pGEX-6p-2, pBV220, pBV221, pBV222, pTrc99A, pTwin1, pEZZ18, pKK232-8, pUC-18, pRSFDuet1 or pUC-19. The host cell can be replaced with a prokaryotic cell or a eukaryotic cell. The prokaryotic cell is Escherichia coli BL21 cell, Bacillus subtilis or Streptomyces, and the eukaryotic cell is yeast, but not limited thereto.

[0023] The present invention provides an application of the monooxygenase mutant described in the present invention in the preparation of 3R,5S-dihydroxy compound, including: (1) using the monooxygenase enzyme mutant described in the present invention to catalyze the debenzylation reaction of 3R,5S-dihydroxy-6-benzyloxy compound to generate 3R,5S-dihydroxy compound, wherein the 3R,5S-dihydroxy-6-benzyloxy compound is shown in Formula I, and the 3R,5S-dihydroxy compound is shown in Formula II:

[0024]

[0025] wherein R1 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl; R2 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl.

[0026] Or (2) the monooxygenase enzyme mutant of the present invention is used in combination with a dicarbonyl reductase to catalyze a diketone compound to generate a 3R,5S-dihydroxy compound, wherein the diketone compound has the structure shown in Formula III:

[0027]

[0028] wherein R3 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl. Preferably, R1, R2 or R3 is selected from methyl, ethyl, propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, tert-pentyl, neopentyl, isopentyl, sec-pentyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, chloromethyl, bromomethyl, fluoromethyl, chloroethyl, bromoethyl, fluoroethyl, chloropropyl, bromopropyl, fluoropropyl, chlorocyclopropyl, bromocyclopropyl, fluorocyclopropyl, chlorocyclobutyl, bromocyclobutyl, fluorocyclobutyl, chlorocyclopentyl, bromocyclopentyl, fluorocyclopentyl, chlorocyclohexyl, bromocyclohexyl, fluorocyclohexyl, chlorocycloheptyl, bromocycloheptyl, fluorocycloheptyl, chlorocyclooctyl, bromocyclooctyl, fluorocyclooctyl.

[0029] Preferably, the 3R,5S-dihydroxy-6-benzyloxy compound is selected from tert-butyl 3R,5S-dihydroxy-6-benzyloxy-hexanoate, neopentyl 3R,5S-dihydroxy-6-benzyloxy-hexanoate, methyl 3R,5S-dihydroxy-6-benzyloxy-hexanoate or ethyl 3R,5S-dihydroxy-6-benzyloxy-hexanoate; the diketone compound is selected from tert-butyl 6-benzyloxy-3,5-dioxo-hexanoate, neopentyl 6-benzyloxy-3,5-dioxo-hexanoate, methyl 6-benzyloxy-3,5-dioxo-hexanoate, ethyl 6-benzyloxy-3,5-dioxo-hexanoate.

[0030] The present invention provides an application of biocatalytic debenzylation of a 3R,5S-dihydroxy-6-benzyloxy compound to synthesize a side chain intermediate 3R,5S-dihydroxy compound of a statin drug, specifically: using a wet cell obtained by fermentation culture of a recombinant genetic engineering bacterium (preferably recombinant Escherichia coli) containing a monooxygenase (or monooxygenase mutant) encoding gene, a cell extract obtained by ultrasonic disruption of the wet cell, or an immobilized monooxygenase (or monooxygenase mutant) as a biocatalyst, using a 3R,5S-dihydroxy-6-benzyloxy compound (ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate) as a substrate, and using NADP + (or NAD+ ) Using coenzyme, a coenzyme regeneration system composed of glucose-6-phosphate dehydrogenase and glucose-6-phosphate, and a reaction system with pH 7-8 phosphate buffer as the reaction medium. The biocatalytic reaction is carried out under the conditions of a temperature of 25-45 °C (preferably 30 °C) and a stirring speed of 100-500 r / min (preferably 350 r / min). After the reaction, the reaction solution is separated and purified to obtain the statin drug side chain intermediate 3R,5S-dihydroxy compound (ethyl 3R,5S,6-trihydroxyhexanoate); in the reaction system, the amount of wet cells used is 10-50 g / L, the amount of enzyme used is 0.01-1.0 g / L, the final concentration of the substrate added is 0.1-10 g / L, and NADP + (or NAD + ) The final concentration is 0.1-2 g / L, and the final concentration of glucose-6-phosphate added is 5-20 g / L.

[0031] The present invention provides an application of a dicarbonyl reductase and the monooxygenase (or monooxygenase mutant) in coupling to carry out a continuous dicarbonyl reduction reaction and debenzylation reaction on a diketone compound to synthesize the statin drug side chain intermediate 3R,5S-dihydroxy compound. Specifically: using the wet cells obtained by fermentation and culture of a recombinant genetic engineering bacterium (preferably recombinant Escherichia coli) containing the dicarbonyl reductase encoding gene and the oxygenase (or monooxygenase mutant) encoding gene, the cell extract after ultrasonic disruption of the wet cells, or the immobilized monooxygenase (or monooxygenase mutant) and dicarbonyl reductase as a biocatalyst, using a diketone compound (ethyl 3,5-dioxo-6-benzyloxyhexanoate) as a substrate, and using NADP + and NAD + as coenzymes, a coenzyme regeneration system 1 composed of glucose-6-phosphate dehydrogenase and glucose-6-phosphate, a coenzyme regeneration system 2 composed of glucose dehydrogenase and glucose, and a reaction system with pH 7-8 phosphate buffer as the reaction medium. The biocatalytic reaction is carried out under the conditions of a temperature of 25-45 °C and a stirring speed of 100-500 r / min. After the reaction, the reaction solution is separated and purified to obtain the statin drug side chain intermediate 3R,5S-dihydroxy compound (ethyl 3R,5S,6-trihydroxyhexanoate); in the reaction system, the amount of wet cells used is 10-50 g / L, the amount of enzyme used is 0.01-1.0 g / L, the final concentration of the substrate added is 2-50 g / L, the final concentration of NADP + is 0.1-2 g / L, the final concentration of NAD + is 0.1-2 g / L, the final concentration of glucose-6-phosphate added is 5-20 g / L, and the final concentration of glucose is 5-20 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1LCMS spectrum of ethyl 3R,5S,6-trihydroxyhexanoate, the product formed by catalyzing ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate with CYP102A1 or the mutant described in the present invention in Example 7 of the present invention.

[0033] Figure 2 LCMS spectrum of the benzene ring hydroxylation by-product formed by catalyzing ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate with CYP102A1 or the mutant described in the present invention in Example 7 of the present invention.

[0034] Figure 3 LCMS / MS spectrum for the determination of ethyl 3R,5S,6-trihydroxyhexanoate and the benzene ring hydroxylation by-product formed by catalyzing ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate with wild-type CYP102A1 (WT) and the CYP102A1 mutant (M5) described in the present invention in Example 7 of the present invention.

[0035] Figure 4 1H-NMR spectrum of ethyl 3R,5S,6-trihydroxyhexanoate, the product formed by the mutant M5 catalyzing the debenzylation of ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate in Example 8 of the present invention 1 1H-NMR spectrum.

[0036] Figure 5 13C-NMR spectrum of ethyl 3R,5S,6-trihydroxyhexanoate, the product formed by the mutant M5 catalyzing the debenzylation of ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate in Example 8 of the present invention 13 13C-NMR spectrum.

[0037] Figure 6 Conversion rate-time curve of the reaction process in which the double carbonyl reductase couples with the CYP102A1 mutant M5 to convert ethyl 3,5-dicarbonyl-6-benzyloxyhexanoate into ethyl 3R,5S,6-trihydroxyhexanoate in Example 9 of the present invention Detailed implementation mode

[0038] The following further provides implementation examples, which are helpful for understanding the present invention and are only used for illustration without limiting the application scope of the present invention.

[0039] Example 1 Construction of recombinant Escherichia coli BL21 / pET28a-CYP102A1 expressing the monooxygenase CYP102A1

[0040] Based on the CYP102A1 enzyme gene sequencing information of Bacillus megaterium from NCBI, Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize the gene. Based on the synthesized CYP102A1 enzyme gene sequence, Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize the primer sequences. Using NdeⅠ and XhoⅠ as restriction enzyme sites respectively, gene amplification primers were designed, primer CYP102A1-F: 5’GGGAATTCCATATGACCATCAAGGAGATGCCTCAGC3’, primer CYP102A1-R: 5’CCGCTCGAGTTAGCCGGCCCACACA3’ for PCR amplification. PCR reaction system (total volume 25 μL): DNA polymerase mixture (containing high-fidelity DNA polymerase, dATP, dCTP, dGTP, dTTP, Buffer) 12.5 μL, cloning primers CYP102A1-F and CYP102A1-R with a concentration of 10 μM each 2 μL, template plasmid containing CYP102A1 gene sequence 2 μL, sterile water 6.5 μL. Using a PCR instrument from Thermo, PCR reaction conditions: pre-denaturation at 94 °C for 30 s, then denaturation at 98 °C for 10 s, annealing at 60 °C for 15 s, extension at 72 °C for 90 s, a total of 30 cycles, and finally extension at 72 °C for 15 min.

[0041] The PCR reaction solution was detected by 1% agarose gel electrophoresis and the fragment was recovered and purified by gel cutting. The PCR fragment was treated with restriction enzymes NdeⅠ and XhoⅠ, and at the same time, the pET28a empty plasmid was treated with NdeⅠ and XhoⅠ. The PCR fragment and the pET28a empty plasmid treated with NdeⅠ and XhoⅠ were then detected by 1% agarose gel electrophoresis and the corresponding fragments were recovered by gel cutting. The obtained fragments were measured for nucleic acid concentration, and were mixed according to the molar concentration ratio of the PCR recovered fragment to the vector recovered fragment of 5:1, and then SolutionⅠ (Takara) containing DNA ligase was added and incubated overnight at 16 °C. The obtained recombinant plasmid pET28a-CYP102A1 was transformed into DH5α competent cells, single colonies were picked, cultured in shaking flasks and plasmids were extracted for sequencing to verify the correct construction of the recombinant plasmid pET28a-CYP102A1. The constructed recombinant plasmid pET28a-CYP102A1 was transformed into Escherichia coli BL21(DE3) to obtain recombinant Escherichia coli BL21 / pET28a-CYP102A1 containing the expression recombinant plasmid pET28a-CYP102A1.

[0042] Example 2 Construction of recombinant Escherichia coli BL21 / pET28a-DKR expressing diketoreductase DKR

[0043] Based on the sequencing information of the dicarbonyl reductase gene from Acinetobacter calcoaceticus ATCC33305 included in NCBI, the gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd. Based on the synthesized DKR enzyme gene sequence, Sangon Biotech (Shanghai) Co., Ltd. was commissioned to design gene amplification primers using NcoⅠ and NotⅠ as restriction sites, and synthesized primers NcoⅠ-DKR-F: 5'CATGCCATGGGCAGCAGCCATC3' and NotⅠ-DKR-R: 5'AAGGAAAAAAGCGGCCGCTCAGTACCGGTAGAAGCCCTCG3' for PCR amplification. PCR reaction system (total volume 25 μL): 12.5 μL of DNA polymerase mixture (containing high-fidelity DNA polymerase, dATP, dCTP, dGTP, dTTP, Buffer), 2 μL of cloning primers NcoⅠ-DKR-F and NotⅠ-DKR-R, both at a concentration of 10 μM, 2 μL of template plasmid containing DKR gene sequence, and 6.5 μL of sterile water. Thermo PCR instrument was used, and the PCR reaction conditions were: pre-denaturation at 94℃ for 30 seconds, then denaturation at 98℃ for 10 seconds, annealing at 60℃ for 15 seconds, extension at 72℃ for 90 seconds, a total of 30 cycles, and finally extension at 72℃ for 15 minutes.

[0044] The PCR reaction solution was detected by 1% agarose gel electrophoresis and the fragment was recovered and purified by gel excision. The PCR fragment was treated with restriction endonucleases NcoⅠ and NotⅠ, and the pET28a empty plasmid was treated with NcoⅠ and NotⅠ. The PCR fragment and the vector fragment treated with NcoⅠ and NotⅠ were detected by 1% agarose gel electrophoresis and the corresponding fragments were recovered by gel excision. The nucleic acid concentration of the obtained fragments was measured, and the PCR recovered fragment and the vector recovered fragment were mixed at a molar concentration ratio of 5:1, and SolutionⅠ (Takara) containing DNA ligase was added, and the cells were incubated at 16°C overnight. The obtained recombinant plasmid pET28a-DKR was transformed into DH5α competent cells, a single clone was picked, the cells were shaken, and the plasmid was extracted for sequencing to verify that the recombinant plasmid pET 28a-DKR was correctly constructed. The constructed recombinant plasmid pET28a-DKR was transformed into Escherichia coli BL21 (DE3) to obtain recombinant Escherichia coli BL21 / pET28a-DKR containing the expression recombinant plasmid pET28a-DKR.

[0045] Example 3 Construction of single-site mutants of monooxygenase CYP102A1

[0046] In this example, the Quickmutation method was used to construct CYP102A1 mutants. Taking N21G as an example, using the plasmid vector pET28a-CYP102A1 expressing CYP102A1 as a template, a pair of complementary primers containing the target mutation site, N21G-F: 5’GAACCTGCCGTTACTGGGCACCGACAAGCCGGTG3’ and N21G-R: 5’CACCGGCTTGTCGGTGCCCAGTAACGGCAGGTTC3’ (where the bold sequence is the mutation site), were added for PCR. PCR reaction system (total volume 25 μL): 12.5 μL of DNA polymerase mixture (containing high-fidelity DNA polymerase, dATP, dCTP, dGTP, dTTP, Buffer), 2 μL each of the cloning primers N21G-F and primer N21G-R with a concentration of 10 μM, 200 μg of the pET28a-CY P102A1 template plasmid, and sterile water was added to make up to 25 μL. Using a PCR instrument from Thermo, the PCR reaction conditions were: pre-denaturation at 94 °C for 30 s, then denaturation at 98 °C for 10 s, annealing at 60 °C for 15 s, extension at 72 °C for 9 min, for a total of 20 cycles, and finally extension at 72 °C for 15 min. The PCR product was digested with DpnⅠ at 37 °C for 1 h, and the digested product was directly transferred into DH5α competent cells. After culturing the competent cells, the plasmid was extracted and verified whether the pET28a-CYP102A1-N21G plasmid containing the N21G mutation was correctly constructed.Construct other BL21 / pET28a-CYP102A1mut plasmids (mut are N21A, N21V, N21L, N21F, D23G, D23A, D23V, D23L, D23F, F162G, F162A, F162V, F162L, S164G, S164A, S164V, S164L, S164F, I174G, I174A, I174V, I174L, I174F, K187G, K187A, K187V, K187L, K187F, Q189G, Q189A, Q189V, Q189L, Q189F, D425G, D425A, D425V, D425L, D425F, Y429G, Y429A, Y429V, Y429L, Y429F, E442G, E442A, E442V, E442L, E442F, F444G, F444A, F444V, F444L, V445G, V445A, V445L, V445F, V78G, V78A, V78L, V78F, R79G, R79A, R79V, R79L, R79F, L86G, L86A, L86V, L86F, F87G, F87A, F87V, F87L, S89G, S89A, S89V, S89L, S89F, V216G, V216A, V216L, V216F, D217G, D217A, D217V, D217L, D217F, I220G, I220A, I220V, I220L, I220F, R223G, R223A, R223V, R223L, R223F, D251G, D251A, D251V, D251L, D251F, E252G, E252A, E252V, E252L, E252F, I254G, I254A, I254V, I254L, I254F, R255G, R255A, R255V, R255L, R255F, Y256G, Y256A, Y256V, Y256L, Y256F, I258G, I258A, I258V, I258L, I258F, I259G, I259A, I259V, I259L, I259F) according to the above method and the primers shown in Table 1.

[0047] Summary Table of Primers for Constructing CYP102A1 Mutants in Table 1

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] Example 4 Induced Expression of Monooxygenase CYP102A1 and Its Mutants

[0054] Inoculate recombinant Escherichia coli BL21 / pET28a-CYP102A1 or BL21 / pET28a-CYP102A1mut into LB liquid medium containing 50 μg / ml kanamycin, culture at 37 °C and 220 rpm for 12 h, then inoculate into fresh LB liquid medium containing 50 μg / ml kanamycin at an inoculation amount of 1‰ (v / v), and culture at 37 °C and 220 rpm for about 2 h until the OD of the bacteria 600 reaches 0.6 - 0.8. Add IPTG with a final concentration of 0.5 mM, induce culture at 20 °C for 20 h, then centrifuge at 4 °C and 4000 rpm for 10 min, discard the supernatant, and collect the precipitate to obtain the wet cells of recombinant Escherichia coli BL21 / pET28a-CYP102A1 containing the expressed recombinant plasmid. These cells can be frozen and subsequently directly used as biocatalysts for whole-cell catalysis or for protein purification.

[0055] Example 5 Induced Expression of Dicarbonyl Reductase

[0056] Inoculate recombinant Escherichia coli BL21 / pET28a-DKR into LB liquid medium containing 50 μg / ml kanamycin, culture at 37 °C and 220 rpm for 12 h, then inoculate into fresh LB liquid medium containing 50 μg / ml kanamycin at an inoculation amount of 1‰ (v / v), and culture at 37 °C and 220 rpm for about 2 h until the OD of the bacteria 600 reaches 0.6 - 0.8. Add IPTG with a final concentration of 0.5 mM, induce culture at 20 °C for 20 h, then centrifuge at 4 °C and 4000 rpm for 10 min, discard the supernatant, and collect the precipitate to obtain the wet cells of recombinant Escherichia coli BL21 / pET28a-DKR containing the expressed recombinant plasmid. These cells can be frozen and subsequently directly used as biocatalysts for whole-cell catalysis or for protein purification.

[0057] Example 6 Isolation and Purification of Monooxygenase CYP102A1 and Its Mutants

[0058] The wet cells obtained in Example 4 were resuspended in a buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl, 10 mM imidazole), sonicated in an ice bath, centrifuged at 15,000 rpm for 10 min, and the supernatant was taken. The obtained supernatant was centrifuged at 15,000 rpm for 10 min again to take the supernatant. The supernatant obtained by the secondary centrifugation was incubated with nickel affinity chromatography resin equilibrated with the above binding buffer, and then rinsed with a washing buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl, 50 mM imidazole) until there was basically no impurity protein. Subsequently, it was eluted with an elution buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl, 250 mM imidazole), and the eluate was collected to obtain the target protein. After the purity was identified by electrophoresis, the target proteins were combined and the protein was replaced into a buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl) through a desalting column, which was the purified monooxygenase CYP102A1 or its mutant enzyme solution.

[0059] Example 7 Screening and Modification of Monooxygenase CYP102A1 Mutants

[0060] Escherichia coli containing the plasmid pET28a-CYP102A1mut encoding the monooxygenase mutant was induced to express. The obtained wet cells containing the monooxygenase mutant were resuspended in a buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl), sonicated in an ice bath, centrifuged at 15,000 rpm for 10 min, and the supernatant was taken to obtain a cell extract containing the monooxygenase mutant. Then, the mutant screening was carried out according to the following system: 30 μL of the cell extract containing the monooxygenase mutant, the concentration of the substrate ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate was 1 mM, and NADP + (or NAD + ) was used as a coenzyme with a final concentration of 2 mM, glucose-6-phosphate dehydrogenase 1 U, and glucose-6-phosphate 10 mM to form a coenzyme regeneration system. A buffer (100 mM, pH 7 phosphate buffer, containing 50 mM NaCl) was used as the reaction medium, and the final volume was 200 μL. The reaction was carried out at 30 °C and 350 r / min for 30 min. After the reaction was completed, an equal volume of acetonitrile was added and vortexed to terminate the reaction. The reaction solution was centrifuged at 12,000 rpm for 10 min, and the supernatant was filtered through a 0.22 μM organic filter membrane and then detected for the product using LCMS. The detection instrument was Shimadzu LCMS 8045, and the mobile phase elution program conditions were as shown in Table 1, where mobile phase A was water containing 1‰ formic acid, and mobile phase B was acetonitrile containing 1‰ formic acid. In the MS part, m / z = 193 was used as the parent ion and m / z = 55 was used as the daughter ion, and the ethyl 3R,5S,6-trihydroxyhexanoate after debenzylation of the product was detected by multiple reaction monitoring. The LC / MS results of the compound were as Figure 1As shown, the hydroxylation product catalyzed by the monooxygenase or monooxygenase mutant is a hydroxylation by-product on the benzene ring. The LC / MS results of the compound are as follows Figure 2 As shown, during the ionization process of the mass spectrometry, the benzyl group hydroxylated on the benzene ring will fall off, and a parent ion with m / z = 193 will also be formed. Similarly, with m / z = 193 as the parent ion and m / z = 55 as the daughter ion, quantification is carried out by multiple reaction monitoring. The reaction characteristics of the mutant are shown in Table 3, the catalytic equation is shown in (1), and the calculation formulas for activity and selectivity are shown in (2).

[0061]

[0062] (2) Multiplication factor of debenzylation activity improvement = amount of debenzylation product formed by the mutant / amount of debenzylation product formed by the wild type.

[0063] Debenzylation selectivity = (amount of debenzylation product formed / amount of substrate decreased) × 100%.

[0064] Table 2 Elution program of the high-performance liquid phase mobile phase

[0065]

[0066] Table 3 Summary table of the multiplication factor of debenzylation activity improvement and selectivity of CYP102A1 single-site mutants compared with the wild type in catalyzing the substrate

[0067]

[0068]

[0069]

[0070] As can be seen from Table 3, the activities or selectivities of mutants N21A, N21V, N21F, D23G, D23A, D23V, D23L, D23F, F162G, F162A, F162V, F162L, S164A, S164V, I174G, I174A, I174V, K187G, K187A, K187F, Q189G, Q189A, Q189L, Q189F, D425A, D425F, Y429A, Y429V, Y429L, Y429F, E442A, E442L, E442F, F444G, F444A, F444V, F444L, V445A, V445L, V445F, V78A, V78G, R79A, R79V, R79L, R79F, L86V, L86F, F87A, F87V, F87M, F87P, F87N, F87Q, S89A, S89V, V216A, V216G, D217A, D217G, D217V, D217L, D217F, I220A, I220G, I220V, I220L, I220F, R223G, R223A, R223L, R223F, D251A, D251G, D251V, D251L, D251F, E252A, E252G, I254A, I254G, I254V, I254L, I254F, R255G, R255A, R255V, R255L, R255F, Y256A, Y256G, Y256V, Y256F, I258A, I258G, I258V, I259G, I259A, I259V, I259L are significantly improved compared with the wild type. Among them, the activity of F87A in catalyzing the debenzylation reaction of ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate is increased by 2.6 times, and the selectivity is much higher than that of other mutants, reaching 98.1%.

[0071] Referring to the methods of Examples 3, 4, and 6, site-saturation mutagenesis was performed on the F87 site, and the degenerate primers are shown in Table 4.

[0072] Table 4 Summary of primers for constructing CYP102A1 mutants

[0073]

[0074] Note: N represents a mixture of the four bases A, T, C, and G; D represents a mixture of the three bases A, G, and T; V represents a mixture of the three bases A, C, and G; H represents a mixture of the three bases A, C, and T.

[0075] The variants were screened according to the above method. The results are shown in Table 5. Except for F87A, the debenzylation selectivity of mutants F87G, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E was significantly improved compared with that of the wild type. Among them, the selectivity of F87P reached as high as 99.1%, and the activity was increased by 3.1 times.

[0076] The mutant F87P was defined as mutant M1. Based on M1, iterative combinatorial mutagenesis was carried out in combination with the best mutations at other sites determined in Table 3 (the bold mutants in Table 3) V78A, R79V, S89A, F162A, S164A, I174G, Q189G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, I254F, R255V, Y256G, I258A, I259G, F444A, D425A, Y429L, E442A, V445A to construct multi-site mutants, and screening was carried out. The results are shown in Table 6. A series of mutants with further improved activity and selectivity were obtained. Among them, mutant M5 contains the mutant sites F87P / F162A / Q189G / E442A / E252G, and its activity was increased by 93.4 times compared with that of wild-type CYP102A1, and the selectivity was increased from 33.2% to 99.5%. The LCMS / MS results of the wild type and mutant M5 catalyzing the formation of the product ethyl 3R, 5S, 6-trihydroxyhexanoate and the benzene ring hydroxylation by-product are as Figure 3 shown.

[0077] Table 5 Summary table of the improvement multiples of debenzylation activity and selectivity of the F87 site saturation mutation of CYP102A1 compared with the wild type for the catalytic substrate

[0078] Mutant Name Multiples of Increased Debenzylation Activity Debenzylation Selectivity % WT 1.0 33.2 F87G 0.8 98.3 F87A 2.6 98.1 F87V 6.6 81.6 F87L 0.1 18.5 F87I 0.8 64.4 F87M 1.0 83.1 F87W 0.1 38.9 F87P 3.8 99.1 F87S 0.9 95.1 F87T 1.1 93.7 F87C 0.1 85.0 F87Y 0.1 54.6 F87N 1.7 96.0 F87Q 3.5 96.8 F87D 0.1 76.6 F87E 0.2 89.7 F87K 0.1 38.8 F87R 0.1 46.7 F87H 0.8 55.3

[0079] Table 6 Summary table of the improvement multiples of debenzylation activity and selectivity of the iterative combinatorial mutants of the beneficial mutation sites of CYP102A1 compared with the wild type for the catalytic substrate

[0080]

[0081]

[0082]

[0083] Example 8 Application of the monooxygenase mutant M5 in the preparation of the side chain intermediate ethyl 3R, 5S, 6-trihydroxyhexanoate of statin drugs

[0084] The wet cells obtained by fermenting and culturing Escherichia coli containing the coding gene of the monooxygenase mutant M5 were resuspended in a pH 7 phosphate buffer. The cell extract after ultrasonic disruption of the cell suspension was used as a biocatalyst. The final amount of wet cells used was 15 g / L, 0.2 g / L of ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate was added as a substrate, and 0.7 g / L of NADP + and the crude extract of Escherichia coli cells containing glucose-6-phosphate dehydrogenase with a final wet cell amount of 5 g / L and 1.5 g / L of glucose-6-phosphate constituted a coenzyme regeneration system. Using a pH 7 phosphate buffer as the reaction medium, a biocatalytic reaction was carried out at 30 °C and a stirring speed of 350 r / min for 3 h. After the reaction ended, LC-MS detection showed that the substrate conversion rate reached 99% and the selectivity reached 99%. The product ethyl 3R,5S,6-trihydroxyhexanoate formed by the mutant M5 catalyzing the debenzylation of ethyl 3R,5S-dihydroxy-6-benzyloxyhexanoate 1 1H-NMR spectrum is as Figure 4 shown, and the 13 13C-NMR spectrum of the product ethyl 3R,5S,6-trihydroxyhexanoate is as Figure 5 shown.

[0085] Example 9 Application of the preparation of ethyl 3R,5S,6-trihydroxyhexanoate, an intermediate of the side chain of statins, by coupling a dicarbonyl reductase with a monooxygenase mutant M5

[0086] The catalytic equation involved in this example is as shown in (3). In this example, the wet cells obtained by fermenting and culturing Escherichia coli containing the coding gene of the dicarbonyl reductase were resuspended in a pH 7 phosphate buffer. The cell suspension was used as a biocatalyst. The final amount of wet cells of the dicarbonyl reductase used was 2 g / L, 0.3 g / L of ethyl 3,5-dioxo-6-benzyloxyhexanoate was added as a substrate, and 0.4 g / L of NAD + and 1 g / L of glucose and Escherichia coli containing glucose dehydrogenase with a wet cell amount of 2 g / L constituted a coenzyme regeneration system. Using a pH 7 phosphate buffer as the reaction medium, after reacting at 30 °C and a stirring speed of 350 r / min for 10 min, the crude extract of Escherichia coli cells containing the CYP102A1 mutant M5 with a final wet cell amount of 15 g / L was added, and 0.7 g / L of NADP +, the crude extract of Escherichia coli cells containing glucose-6-phosphate dehydrogenase with a final wet cell dosage of 5 g / L and 1.5 g / L of glucose-6-phosphate were used for continuous reaction for 3 h. After the reaction ended, LC-MS detection showed that the substrate conversion rate reached 99% and the selectivity reached 99%. The curve of the conversion rate over time during the reaction of the dicarbonyl reductase-coupled CYP102A1 mutant M5 converting ethyl 3,5-dioxo-6-benzyloxyhexanoate to ethyl 3R,5S,6-trihydroxyhexanoate is as Figure 6 shown.

[0087]

Claims

1. A monooxygenase mutant, characterized in that An amino acid mutation occurs in at least one of the amino acids at positions 21, 23, 78, 79, 86, 87, 89, 162, 164, 174, 187, 189, 216, 217, 220, 223, 251, 252, 254, 255, 256, 258, 259, 425, 429, 442, 444, and 445 of the amino acid sequence shown in SEQ ID NO:

1.

2. The monooxygenase mutant according to claim 1, characterized in that The amino acid sequence of SEQ ID NO: 1 has at least one of the following mutations: N21A, N21V, N21F, D23G, D23A, D23V, D23L, D23F, F162G, F162A, F162V, F162L, S164A, S164V, I174G, I174A, I174V, K187G, K187A, K187F, Q189G, Q189A, Q189L, Q189 9F, D425A, D425F, Y429A, Y429V, Y429L, Y429F, E442A, E442L, E442F, F444G, F444A, F444V, F44 4L, V445A, V445L, V445F, V78A, V78G, R79A, R79V, R79L, R79F, L86V, L86F, F87G, F87A, F87V, F8 7M, F87P, F87S, F87T, F87C, F87N, F87Q, F87E, S89A, S89V, V216A, V216G, D217A, D217G, D217V, D217L, D217F, I220A, I220G, I220V, I220L, I220F, R223G, R223A, R223L, R223F, D251A, D251G, D251V, D251L, D251F, E252A, E252G, I254A, I254G, I254V, I254L, I254F, R255G, R255A, R255V, R255L, R255F, Y256A, Y256G, Y256V, Y256F, I258A, I258G, I258V, I259G, I259A, I259V, I259L.

3. The monooxygenase mutant according to claim 1, characterized in that The amino acid sequence of SEQ ID NO: 1 has at least one of the following mutations: F162G, F162A, F162V, I174G, I174A, V78A, V78G, V78L, V78F, R79V, R79L, R79F, L86F, F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q, F87E, V216 A. V216G, D217A, D217G, D217V, D217L, D217F, I220A, I220G, I220L, I220F, R223G, R223F, D2 51G, I254G, I254F, R255G, R255A, R255V, R255L, R255F, Y256A, I258A, I258V, I259A, I259G.

4. The monooxygenase mutant according to claim 3, characterized in that A mutation occurs at amino acid position 87 of the amino acid sequence shown in SEQ ID NO: 1, selected from F87G, F87A, F87V, F87M, F87P, F87S, F87T, F87C, F87N, F87Q or F87E.

5. The monooxygenase mutant according to claim 4, characterized in that The mutant further has one of the mutations F162A, S164A, Q189G, N21F, D23F, V216A, I220F, R223G, D251F, E252G, I254F, R255V, I258A, D425A, E442A or V445A.

6. The monooxygenase mutant according to claim 5, characterized in that The mutant has mutations F162A, and one of V78A, S89A, S164A, I174G, Q189G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, R255V, Y256G, I258A, I259G, D425A, E442A, and V445A.

7. The monooxygenase mutant according to claim 6, characterized in that The mutant has mutations F162A and Q189G, and one of V78A, R79V, S89A, S164A, I174G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, I254F, R255V, Y256G, I258A, I259G, D425A, E442A, V445A.

8. The monooxygenase mutant according to claim 7, characterized in that The mutant has mutations F162A, Q189G and E442A, and one of V78A, R79V, S89A, S164A, I174G, N21F, D23F, K187G, V216A, D217L, I220F, R223G, D251F, E252G, I254F, R255V, Y256G, I258A, I259G, D425A, Y429L, V445A.

9. Use of the monooxygenase mutant according to any one of claims 1 to 8 in catalyzing the preparation of 3R, 5S-dihydroxy compounds.

10. The use according to claim 9, characterized in that The monooxygenase mutant according to any one of claims 1 to 8 catalyzes a debenzylation reaction of a 3R, 5S-dihydroxy-6-benzyloxy compound to generate a 3R, 5S-dihydroxy compound, wherein the 3R, 5S-dihydroxy-6-benzyloxy compound is as shown in Formula I, and the 3R, 5S-dihydroxy compound is as shown in Formula II: Wherein R1 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl; R2 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl. Alternatively, the monooxygenase mutant according to any one of claims 1 to 8 is used in combination with a dicarbonyl reductase to catalyze the production of 3R, 5S-dihydroxy compounds from diketone compounds, wherein the structure of the diketone compound is as shown in Formula III: Wherein R3 is selected from C1-C8 alkyl, C3-C8 cycloalkyl, C1-C8 haloalkyl or C3-C8 halocycloalkyl.

11. The use according to claim 10, characterized in that The 3R,5S-dihydroxy-6-benzyloxy compound is selected from 3R,5S-dihydroxy-6-benzyloxy-tert-butyl hexanoate, 3R,5S-dihydroxy-6-benzyloxy-neopentyl hexanoate, 3R,5S-dihydroxy-6-benzyloxy-methyl hexanoate or 3R,5S-dihydroxy-6-benzyloxy-ethyl hexanoate; the diketone compound is selected from 6-benzyloxy-3,5-dioxo-tert-butyl hexanoate, 6-benzyloxy-3,5-dioxo-neopentyl hexanoate, 6-benzyloxy-3,5-dioxo-methyl hexanoate and 6-benzyloxy-3,5-dioxo-ethyl hexanoate.

Citation Information

Cited By

  • Monooxygenase mutant for generating (4R)-4-hydroxyisophorone and preparation method thereof

    CN121065119A

  • A monooxygenase mutant producing (4r)-4-hydroxyisophorone and a method for preparing the same

    CN121065119B