Application of piRNA in preparation of product for preventing and / or treating cardiomyopathy
By developing piRNAAB349597.1 inhibitors and corresponding drugs, the early diagnosis and treatment of doxorubicin-induced cardiomyopathy has been solved, and early intervention and effective treatment of cardiomyopathy have been achieved, reducing the risk of cardiomyopathy.
Patent Information
- Application Number
- CN202510407022.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art is difficult to predict and intervene in early cardiotoxicity induced by doxorubicin. Conventional testing methods can only show positive results after myocardial injury, and lack early diagnosis and intervention methods.
Using specific piRNAAB349597.1 and its inhibitors, drugs are developed to prevent and treat doxorubicin-induced cardiomyopathy by inhibiting their expression, combined with pharmaceutically acceptable excipients such as adenovirus, chitosan, liposomes, etc. for drug delivery, and the risk of cardiomyopathy is evaluated by detecting the expression level of piRNAAB349597.1.
Significantly improve doxorubicin-induced cardiac dysfunction, cardiac atrophy, cardiotoxicity and cardiomyocyte injury, reduce cardiomyocyte ferrodysfunction, reactive oxygen accumulation and mitochondrial dysfunction, and provide early cardiomyopathy risk assessment methods.
Smart Images

Figure CN120241769A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to the application of piRNA in the preparation of products for preventing and / or treating cardiomyopathy. Background Art
[0002] Doxorubicin belongs to anthracycline drugs and is one of the commonly used broad-spectrum chemotherapeutic drugs in clinical practice. It can be used to treat lymphoma, leukemia, Ewing's sarcoma, and solid tumors such as breast cancer. However, doxorubicin will produce toxic side effects such as cardiotoxicity, hepatotoxicity, and nephrotoxicity during the treatment process. Among them, cardiotoxicity is its most serious adverse reaction, which greatly limits its clinical efficacy. At present, methods for detecting asymptomatic cardiotoxicity, such as serum markers, electrocardiogram, echocardiogram, cardiac magnetic resonance imaging, etc., have been gradually applied to clinical practice. However, these conventional detection methods only show positive results after myocardial damage has occurred. Therefore, earlier prediction and intervention of doxorubicin-induced cardiotoxicity are crucial for improving the recovery rate of cancer patients and protecting them from the toxic side effects of chemotherapy.
[0003] piRNA, that is, PIWI-interacting RNA, is a class of emerging non-coding RNAs with a length of 21-35 nucleotides. It belongs to regulatory small non-coding RNAs (sncRNAs), has 2'-O-methylation at the 3' end, and shows uracil preference at the 5' end. Certain specific piRNAs are highly expressed in heart tissue and show differential expression in patients with cardiovascular diseases, and may play a key role in regulating cardiovascular physiological and pathological processes. piRNA has strong advantages as a diagnostic marker or therapeutic drug for cardiovascular diseases. First, piRNA has higher stability in blood and tissues, which is beneficial to the collection, storage, and processing of samples. Second, certain piRNAs are specifically expressed in heart tissue, which can more accurately reflect the occurrence and development of cardiovascular diseases. Finally, the expression level of piRNA may change in the early stage of the disease, which is beneficial to the early diagnosis and intervention treatment of cardiovascular diseases. Therefore, it is of great significance to study and develop the application of piRNA in the preparation of drugs for preventing and / or treating cardiomyopathy. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide the application of piRNA AB349597.1 in the preparation of drugs for preventing and / or treating cardiomyopathy.
[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:
[0006] Use of piRNA AB349597.1 in the preparation of a medicament for preventing and / or treating cardiomyopathy, wherein the nucleotide sequence of the piRNA AB349597.1 is as shown in SEQ ID NO.1.
[0007] Another object of the present invention is to provide the use of a piRNA AB349597.1 inhibitor in the preparation of a medicament for preventing and / or treating cardiomyopathy, wherein the nucleotide sequence of the piRNA AB349597.1 is as shown in SEQ ID NO.1.
[0008] Preferably, the piRNA AB349597.1 inhibitor comprises a piRNA Inhibitor that is reverse complementary to the piRNA AB349597.1, and the nucleotide sequence of the piRNA Inhibitor is as shown in SEQ ID NO.2.
[0009] Preferably, the medicament inhibits the expression of piRNA AB349597.1.
[0010] Preferably, the cardiomyopathy is doxorubicin-induced cardiomyopathy.
[0011] Preferably, the doxorubicin-induced cardiomyopathy includes doxorubicin-induced cardiotoxicity, cardiac atrophy, cardiac dysfunction, cardiac fibrosis, ferroptosis of cardiomyocytes, mitochondrial dysfunction of cardiomyocytes, and accumulation of reactive oxygen species in cardiomyocytes.
[0012] Another object of the present invention is to provide a primer set for detecting the expression level of piRNA AB349597.1, the primer set comprising a reverse transcription primer for piRNA AB349597.1, a forward primer for quantitative PCR, and a reverse primer for quantitative PCR, wherein the nucleotide sequence of the piRNA reverse transcription primer is as shown in SEQ ID NO.3, the nucleotide sequence of the forward primer for quantitative PCR is as shown in SEQ ID NO.4, and the nucleotide sequence of the reverse primer for quantitative PCR is as shown in SEQ ID NO.5.
[0013] Another object of the present invention is to provide a reagent for detecting the expression level of piRNA AB349597.1, the reagent comprising the above-mentioned primer set.
[0014] Another object of the present invention is to provide the use of the above-mentioned primer set or the above-mentioned reagent in the preparation of a product for evaluating the risk of suffering from cardiomyopathy.
[0015] Another object of the present invention is to provide a drug for treating and / or preventing cardiomyopathy, the drug comprising a piRNA AB349597.1 inhibitor, and the nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] The present invention provides the use of piRNA AB349597.1 in the preparation of a drug for preventing and / or treating cardiomyopathy, and the nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1. The present invention finds through research that inhibiting the expression of piRNA AB349597.1 can significantly improve doxorubicin-induced cardiac dysfunction, cardiac atrophy, cardiotoxicity, and cardiac fibrosis, and can reduce doxorubicin-induced cardiomyocyte damage, cardiomyocyte ferroptosis, cardiomyocyte reactive oxygen species accumulation, and cardiomyocyte mitochondrial dysfunction. By detecting the expression level of piRNA AB349597.1, the risk of suffering from cardiomyopathy can also be evaluated, providing more options for the treatment of cardiomyopathy. Description of the Drawings
[0018] Figure 1 Compared with the normal saline group, the level of piRNA AB349597.1 increased in the doxorubicin-induced cardiomyopathy model, ****P < 0.0001;
[0019] Figure 2 Compared with the control group, the level of piRNA AB349597.1 increased in the doxorubicin-induced cardiomyocyte ferroptosis model, **P < 0.01;
[0020] Figure 3 Dissolution curves of the expression levels of piRNA AB349597.1 and its internal reference U6 detected by qRT-PCR in the control group and the doxorubicin group;
[0021] Figure 4 Knockdown of piRNA AB349597.1 inhibited doxorubicin-induced weight loss and reduced survival rate in mice. Among them, A is the experimental process, B is the body weight of mice, C is the survival rate of mice, *P < 0.05, ****P < 0.0001;
[0022] Figure 5 Knockdown of piRNA AB349597.1 improved doxorubicin-induced cardiac dysfunction. Among them, A is echocardiogram, B is ejection fraction, C is fractional shortening, **P < 0.01, ***P < 0.001;
[0023] Figure 6To knockdown piRNAAB349597.1 attenuates doxorubicin-induced cardiac atrophy in mice. Among them, A is the picture of the mouse heart, B is the ratio of heart weight / tibia length, C is hematoxylin-eosin staining (scale bar = 500 μm), D (left) is hematoxylin-eosin staining (scale bar = 20 μm), D (right) is the statistical result of myocardial cross-sectional area, E (left) is wheat germ agglutinin (WGA) staining (scale bar = 20 μm), E (right) is the statistical result of cardiomyocyte cross-sectional area, *P < 0.05, ****P < 0.0001;
[0024] Figure 7 To knockdown piRNAAB349597.1 inhibits doxorubicin-induced cardiac toxicity in mice. Compared with the negative control, knockdown of piRNAAB349597.1 significantly reduces the activity of lactate dehydrogenase (LDH) in the serum of mice, *P < 0.05, ****P < 0.0001;
[0025] Figure 8 To knockdown piRNAAB349597.1 attenuates doxorubicin-induced cardiac fibrosis in mice. Among them, A (left) is hematoxylin-eosin staining (scale bar = 20 μm), A (right) is the statistical result of fibrosis area, B (left) is Masson staining (scale bar = 20 μm), B (right) is the statistical result of fibrosis area, C (left) is Sirius red staining (scale bar = 20 μm), C (right) is the content of cardiac collagen, ****P < 0.0001;
[0026] Figure 9 The level of piRNAAB349597.1 is decreased in cardiomyocytes transfected with the piRNAAB349597.1 inhibitor, *P < 0.05;
[0027] Figure 10 To knockdown piRNAAB349597.1 alleviates doxorubicin-induced cardiomyocyte injury. Among them, A is the cardiomyocyte survival rate, B is the activity of lactate dehydrogenase (LDH) in cardiomyocytes, **P < 0.01, ***P < 0.001;
[0028] Figure 11 To knockdown piRNAAB349597.1 inhibits doxorubicin-induced ferroptosis in cardiomyocytes. Among them, A is the protein expression levels of xCT and GPX4 detected by Western blot, B is the mRNA level of PTGS2, C is the iron ion content, D is the content of malondialdehyde (MDA), E is the content of reduced glutathione (GSH), *P < 0.05, **P < 0.01, ***P < 0.001;
[0029] Figure 12To knockdown piRNA AB349597.1 to attenuate doxorubicin-induced reactive oxygen species (ROS) accumulation in cardiomyocytes. Among them, A is the observation result under a fluorescence microscope for ROS (scale bar = 50 μm), B is the statistical result of ROS fluorescence intensity, **P < 0.01;
[0030] Figure 13 To knockdown piRNA AB349597.1 to inhibit doxorubicin-induced mitochondrial dysfunction. Among them, A is the fluorescence image of JC-1 fluorescence staining (scale bar = 50 μm), B is the red / green fluorescence ratio of JC-1, *P < 0.05. Detailed implementation manners
[0031] The present invention provides an application of piRNA AB349597.1 in the preparation of a drug for preventing and / or treating cardiomyopathy. The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1: 5’-TGAGGTAGTAGTTTGTGCTGT-3’ (GenBank: AB349597.1).
[0032] The present invention also provides an application of an inhibitor of piRNA AB349597.1 in the preparation of a drug for preventing and / or treating cardiomyopathy. The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1.
[0033] In the present invention, the inhibitor of piRNA AB349597.1 includes a piRNA Inhibitor that is reverse complementary to the piRNA AB349597.1. The nucleotide sequence of the piRNA Inhibitor is shown as SEQ ID NO.2: 5’-ACAGCACAAACUACUACCUCA-3’.
[0034] In the present invention, the drug inhibits the expression of piRNA AB349597.1.
[0035] The present invention also provides a drug for treating and / or preventing cardiomyopathy. The drug includes an inhibitor of piRNA AB349597.1. The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1. The present invention studies and finds that after inhibiting the expression of piRNA AB349597.1, it can improve doxorubicin-induced cardiomyopathy, and the doxorubicin-induced cardiomyopathy includes doxorubicin-induced cardiotoxicity, cardiac atrophy, cardiac dysfunction, cardiac fibrosis, ferroptosis of cardiomyocytes, mitochondrial dysfunction of cardiomyocytes, and ROS accumulation in cardiomyocytes.
[0036] The drug described in the present invention may further include pharmaceutically acceptable excipients. The excipients include adenovirus, adeno-associated virus and lentivirus. The excipients may also be selected from chitosan, cholesterol, liposome, and nanoparticle. The drug is administered orally or by injection: the injection administration method is selected from any one of intravenous injection, intramuscular injection, intracoronary injection and intramyocardial injection. Packaging the piRNA AB349597.1 inhibitor with one or more of acceptable excipients such as chitosan, cholesterol, liposome, and nanoparticle to form a drug combination, and performing drug delivery by oral administration, intravenous injection, intramuscular injection, intracoronary injection or intramyocardial injection to achieve the prevention and / or treatment of doxorubicin-induced cardiomyopathy.
[0037] The present invention also provides a primer set for detecting the expression level of piRNA AB349597.1. The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1. The primer set includes a reverse transcription primer for piRNA AB349597.1, a forward primer for quantitative PCR and a reverse primer for quantitative PCR. The nucleotide sequence of the reverse transcription primer for piRNA is shown as SEQ ID NO.3. The nucleotide sequence of the forward primer for quantitative PCR is shown as SEQ ID NO.4. The nucleotide sequence of the reverse primer for quantitative PCR is shown as SEQ ID NO.5. Using the reverse transcription primer provided by the present invention to synthesize the first-strand cDNA, and then using the first-strand cDNA as the template DNA for quantitative PCR, the expression level of piRNA can be detected. The reaction procedure of the quantitative PCR is: 95°C for 30 - 60 s; 95°C for 15 s, 55 - 65°C for 15 s, 72°C for 30 - 60 s, for 35 - 40 cycles.
[0038] The present invention also provides a reagent for detecting the expression level of piRNA AB349597.1, and the reagent includes the above-mentioned primer set.
[0039] The present invention also provides the application of the above-mentioned primer set or the above-mentioned reagent in the preparation of products for evaluating the risk of cardiomyopathy. The primer set or reagent for detecting the expression level of piRNA AB349597.1 in the present invention can specifically amplify the piRNA AB349597.1. When the expression level of piRNA AB349597.1 in the sample to be tested is significantly increased compared with the healthy sample, it indicates that the patient has a high risk of cardiomyopathy.
[0040] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.
[0041] Example 1
[0042] Detection of the expression level of piRNAAB349597.1
[0043] Reverse transcription primer for piRNA AB349597.1 (SEQ ID NO.3): GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCA
[0044] Forward primer for quantitative PCR (SEQ ID NO.4): TGAGGTAGTAGTTTGTGCTGT
[0045] Reverse primer for quantitative PCR (SEQ ID NO.5): GTGCAGGGTCCGAGGT
[0046] The reverse transcription system and procedure (MR101, Nanjing Novoprotein Scientific Co., Ltd.) are as follows:
[0047] (1) Genomic DNA removal: The reaction system is: 1 μL 5×GdnaWiperMix, 100 ng total RNA, supplemented with RNase-free ddH2O to 5 μL; reaction conditions: 42°C for 2 min. Obtain the reaction solution.
[0048] (2) First-strand cDNA synthesis:
[0049] Reaction system: 5 μL reaction solution (step (1)), 0.5 μL reverse transcription primer (10 μM), 1 μL 10×RT Mix, 1 μL HiScriptII Enzyme Mix, supplemented with RNase-free ddH2O to 10 μL.
[0050] Reaction conditions: 25°C for 5 min, 50°C for 15 min, 85°C for 5 min. Obtain the template DNA.
[0051] The real-time fluorescence quantitative system and procedure (MF797, Beijing Polymerwise Biotechnology Co., Ltd.) are as follows:
[0052] Reaction system: 10 μL 2X M5 HiPerRealtime PCR Supermix with LowRox, 0.5 μL forward primer for quantitative PCR (10 μM), 0.5 μL reverse primer for quantitative PCR (10 μM), 2 μL template DNA, supplemented with ddH2O to 20 μL.
[0053] Reaction procedure: 95°C for 60 s; 95°C for 15 s, 65°C for 15 s, 72°C for 30 s, 35 cycles.
[0054] Example 2
[0055] Detection of the expression level of piRNAAB349597.1 in the adriamycin-induced cardiomyopathy model.
[0056] Animal model: Male 7-week-old C57BL / 6J mice (purchased from Beijing Speyford Biotechnology Co., Ltd.) were intraperitoneally injected with adriamycin (cumulative dose 16 mg / kg, injected once every 5 days for a total of 2 times). After that, they were anesthetized with an overdose of isoflurane (5%), euthanized by cervical dislocation, and the heart tissues of the mice were taken. The expression level of piRNAAB349597.1 was detected by qRT-PCR experiment. Total RNA in the tissues was extracted using TRIzol reagent, and piRNAAB349597.1 was specifically reverse-transcribed into cDNA using a microRNA stem-loop reverse transcription kit. Detection was carried out on a QuantStudio 3 real-time quantitative PCR instrument using 2X M5 HiPer Realtime PCR Super mix with Low Rox (the method steps were the same as in Example 1), and the expression level of piRNA was analyzed by 2 -ΔΔCT Intraperitoneal injection of adriamycin was recorded as the adriamycin group, and adriamycin was replaced with normal saline with the same remaining treatments, which was recorded as the normal saline group.
[0057] Cell model: After treating AC16 cells (purchased from Suzhou Haixing Biotechnology Co., Ltd.) with 3 μmol / L adriamycin for 24 h, the expression level of piRNAAB349597.1 was detected by qRT-PCR experiment. Total RNA in the cells was extracted using TRIzol reagent, and the remaining methods were the same as those in the animal model group, which was recorded as the adriamycin group. AC16 cells not treated with adriamycin were recorded as the control group.
[0058] After male mice were intraperitoneally injected with adriamycin (cumulative dose 16 mg / kg), the heart tissues of the mice were taken, and the expression level of piRNAAB349597.1 was detected by qRT-PCR experiment. The results showed ( Figure 1 ) that compared with the normal saline group, the expression level of piRNAAB349597.1 in the heart tissues of the adriamycin group mice was significantly increased by about 14 times on average.
[0059] An adriamycin-induced cardiomyocyte injury model was constructed by treating AC16 cardiomyocytes with adriamycin (3 μmol / L) for 24 h, and the expression level of piRNAAB349597.1 was detected by qRT-PCR experiment. The results showed ( Figure 2 ) that compared with the control group, the expression level of piRNAAB349597.1 in the adriamycin group cells was significantly up-regulated by about 50 times on average.
[0060] The above results indicate that the expression levels of piRNAAB349597.1 were significantly increased in both the adriamycin-induced mouse cardiomyopathy model and the cardiomyocyte injury model.
[0061] As Figure 3 shown, the melting curves of the expression levels of piRNAAB349597.1 and its internal reference U6 in the control group and the adriamycin group detected by qRT-PCR experiment were single peaks, indicating that the primers and amplification procedures provided by the present invention can specifically detect piRNAAB349597.1.
[0062] Example 3
[0063] Detect the role of knocking down piRNAAB349597.1 in adriamycin-induced mouse cardiomyopathy.
[0064] The construction method of the piRNAAB349597.1 knockdown lentivirus is as follows: The piRNAAB349597.1 inhibitor sequence (i.e., the reverse complementary sequence of piRNAAB349597.1, SEQ ID NO.2: 5’-ACAG CACAAACUACUACCUCA-3’) and the pLV3-U6-MCS-shRNA-CopGFP-Puro shuttle plasmid (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product number P29436) were respectively digested with EcoRI and BamHI and then ligated to obtain the pLV3-U6-MCS-shRNA-CopGFP-Puro shuttle plasmid containing the target sequence. Add 1.5 mL of serum-free DMEM to a sterile 5 mL centrifuge tube, and then add the pLV3-U6-MCS-shRNA-CopGFP-Puro shuttle plasmid containing the target sequence, the packaging plasmid psPAX2 (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product number P0261), and the packaging plasmid pMD2.G (purchased from Wuhan Miaoling Biotechnology Co., Ltd., product number P0262) and mix well. Take another sterile 5 mL centrifuge tube, add 1.5 mL of serum-free DMEM, and then add 300 μL of RNAi-Mate transfection reagent and mix well. After standing at room temperature for 5 min, mix the two tubes, stand at room temperature for 25 min, and dropwise add to the culture dish of HEK293 cells (purchased from Suzhou Haixing Biotechnology Co., Ltd.) containing 8 mL of serum-free DMEM, gently shake the culture dish back and forth to mix the complex, and incubate in a 37 °C 5% CO2 incubator for 6 h. Aspirate the transfection solution and add 18 mL of DMEM culture medium containing 10% FBS. Continue to culture at 37 °C 5% CO2 for 72 h. Finally, collect the cell supernatant rich in lentivirus particles, concentrate it, and the concentrated virus reaches 10 8 The above titer to obtain the circ-CHACR overexpression lentivirus.
[0065] Construct a negative control lentivirus: The difference from the construction method of the piRNAAB349597.1 knockdown lentivirus is that the pLV3-U6-MCS-shRNA-CopGFP-Puro shuttle plasmid containing the target sequence is replaced with the pLV3-U6-MCS-shRNA-CopGFP-Puro shuttle plasmid without any target sequence.
[0066] After the mice were anesthetized with 2% isoflurane, tracheal intubation was performed. A longitudinal incision of about 0.5 cm was made on the skin about 2 mm to the left of the left sternal border. The chest wall muscles were bluntly dissected, the third rib was cut and the heart was exposed. The piRNAAB349597.1 knockdown lentivirus or its negative control was injected into the myocardial layer at 5 points. After the operation, doxorubicin (8 mg / kg) was intraperitoneally injected once every 5 days for 2 consecutive times (cumulative dose 16 mg / kg) ( Figure 4 in A of
[0067] 1. Detect and accumulate the body weight and survival of the mice during the drug administration period.
[0068] To detect the role of piRNAAB349597.1 in doxorubicin-induced cardiomyopathy, after injecting the piRNAAB349597.1 knockdown lentivirus or its negative control lentivirus into the mouse heart in situ, normal saline or doxorubicin was intraperitoneally injected once every 5 days for 2 consecutive times, and the body weight and survival of the mice were monitored and recorded at the same time. The results showed ( Figure 4 in B - C of
[0069] 2. After the film formation was completed, a Vevo 770 imaging system was used to collect echocardiograms of the mice, and cardiac function indexes (left ventricular ejection fraction and fractional shortening) were calculated. The heart was isolated, photographed, and weighed, the tibia length was measured, and the heart mass / tibia length ratio was analyzed; the heart tissue was fixed with 4% paraformaldehyde, dehydrated, cleared, infiltrated with wax, embedded, sectioned (4 μm thick), dewaxed to water, and then used for histochemical staining experiments. Hematoxylin-eosin staining (the kit was purchased from Beijing Leagene Biotechnology Co., Ltd., product number DH0006), Masson trichrome staining (the kit was purchased from Beijing Solarbio Science & Technology Co., Ltd., product number G1340), Sirius red staining (the kit was purchased from Beijing Leagene Biotechnology Co., Ltd., product number BD1150), and wheat germ agglutinin (WGA) staining (the kit was purchased from Sigma-Aldrich, product number L4895) were performed according to the kit instructions. An optical microscope or an upright fluorescence microscope was used for observation and photography, and cardiac remodeling indexes (cardiac cross-sectional area and cross-sectional area of cardiomyocytes) and cardiac fibrosis indexes (fibrosis area and collagen content) were analyzed.
[0070] To detect the role of piRNAAB349597.1 in doxorubicin-induced cardiac function in mice, the cardiac function of the mice was evaluated by echocardiography. The results showed ( Figure 5 A–C in []) that compared with the negative control group, knockdown of piRNAAB349597.1 significantly inhibited the decrease in ejection fraction and fractional shortening. The above results indicate that knockdown of piRNAAB349597.1 significantly improved doxorubicin-induced cardiac dysfunction.
[0071] To detect the role of piRNAAB349597.1 in doxorubicin-induced structural changes in the mouse heart, the heart volume, mass, and tibia length of the mice were measured and recorded, and the cardiac cross-sectional area and cross-sectional area of cardiomyocytes were detected by hematoxylin-eosin staining and wheat germ agglutinin staining. The results showed ( Figure 6 A–E in []) that compared with the negative control group, knockdown of piRNAAB349597.1 significantly inhibited the decrease in the heart volume, the decrease in the heart mass / tibia length ratio, and the decrease in the cardiac cross-sectional area and cross-sectional area of cardiomyocytes induced by doxorubicin in mice. The above results indicate that knockdown of piRNAAB349597.1 significantly improved doxorubicin-induced cardiac atrophy and cardiomyocyte shrinkage in mice.
[0072] To detect the role of piRNAAB349597.1 in doxorubicin-induced myocardial injury in mice, the degree of fibrosis of the mouse heart tissue was detected by hematoxylin-eosin staining and Masson staining, and the collagen content of the mouse heart tissue was detected by Sirius red staining. The results showed ( Figure 8In A-C), compared with the negative control group, after knockdown of piRNA AB349597.1, the degree of doxorubicin-induced cardiac fibrosis was significantly inhibited, and the cardiac fibrosis area and collagen content were significantly reduced. The above results indicate that knockdown of piRNA AB349597.1 significantly attenuates doxorubicin-induced cardiac fibrosis.
[0073] Anesthetize mice with 5% excess isoflurane and euthanize them by cervical dislocation, and collect serum to detect the activity of lactate dehydrogenase (LDH) in mouse serum.
[0074] To detect the role of piRNA AB349597.1 in doxorubicin-induced cardiotoxicity, collect mouse serum for lactate dehydrogenase (LDH) activity detection. The results showed ( Figure 7 ), compared with the negative control group, after knockdown of piRNA AB349597.1, the enhancement of doxorubicin-induced LDH activity was significantly inhibited. This result indicates that knockdown of piRNA AB349597.1 significantly attenuates doxorubicin-induced cardiotoxicity in mice.
[0075] Example 4
[0076] Detect the role of knockdown of piRNA AB349597.1 in doxorubicin-induced cardiomyocyte injury.
[0077] The construction of the piRNA AB349597.1 inhibitor and its negative control was completed by Shanghai GenePharma Co., Ltd. The piRNA AB349597.1 inhibitor is a piRNA Inhibitor that is reverse complementary to the piRNA AB349597.1 sequence. The inhibitor sequence is 5'-ACAGCACAAACUACUACCUCA-3' (SEQ ID NO.2). The piRNA AB349597.1 negative control is a universal negative control that has no homology with the piRNA AB349597.1 sequence, and the sequence is 5'-CAGUACUUUUGUGUAGUACAA-3' (SEQ ID NO.6).
[0078] Cell transfection: When the confluence of normally cultured AC16 cells reaches 40% - 50%, change the medium to serum-free medium for transfection. Add Opti-MEM serum-reduced medium and LipofectamineTM 3000 transfection reagent into a 1.5 mL sterile EP tube, and add Opti-MEM serum-reduced medium and piRNAAB349597.1 inhibitor (or its negative control) into another 1.5 mL sterile EP tube. After mixing the two tubes respectively, let them stand at room temperature for 5 min. Add the transfection reagent mixture to the piRNAAB349597.1 inhibitor mixture, mix well and let it stand at room temperature for 15 min, then immediately transfect. After 6 h, change to complete medium. After 48 h, collect the cells and detect the expression level of piRNAAB349597.1 by qRT-PCR experiment to clarify the knockdown effect of piRNAAB349597.1.
[0079] Inoculate normally cultured AC16 cells into a 96-well plate. When the confluence reaches 40% - 50%, transfect with piRNAAB349597.1 inhibitor or its negative control. After 48 h, add 3 μmol / L adriamycin and treat for 24 h. Then add 10 μL CCK-8 solution to each well, and incubate in the dark at 37°C and 5% CO2 for 1 h. Use an enzyme-linked immunosorbent assay (ELISA) reader to detect the cell viability; according to the kit instructions (the kit is purchased from Nanjing Jiancheng Bioengineering Institute, product number A020-2), collect the cell culture medium, add the corresponding working solution, incubate at 37°C for the corresponding time, and then use an ELISA reader to detect the LDH activity.
[0080] To detect the role of piRNAAB349597.1 in adriamycin-induced cardiomyocyte injury, a piRNAAB349597.1 specific inhibitor and its negative control were synthesized and transfected into AC16 cardiomyocytes respectively. The results of qRT-PCR experiment showed ( Figure 9 ) that the piRNAAB349597.1 specific inhibitor significantly reduced the expression level of piRNAAB349597.1, indicating that piRNAAB349597.1 was successfully knocked out in vitro.
[0081] In this example, further exploration was carried out through CCK-8 and LDH activity experiments. The results showed ( Figure 10 A - B in), compared with the negative control group, knockdown of piRNAAB349597.1 significantly inhibited the decrease in cell viability and the increase in LDH activity induced by adriamycin. The above results indicate that inhibition of piRNAAB349597.1 alleviates adriamycin-induced cardiomyocyte toxicity.
[0082] Example 5
[0083] Detect the role of knocking down piRNAAB349597.1 in doxorubicin-induced ferroptosis of cardiomyocytes.
[0084] After transfecting the piRNAAB349597.1 inhibitor or its negative control into AC16 cells for 48 h (the same steps as in Example 4), 3 μmol / L doxorubicin was added and the cells were treated for 24 h. Then the cells were collected, and the protein expression levels of ferroptosis markers cystine / glutamate reverse transport solute carrier family 7 member 11 (xCT) and glutathione peroxidase 4 (GPX4) were detected by Western blot; the mRNA expression level of ferroptosis marker prostaglandin-endoperoxide synthase 2 (PTGS2) was detected by real-time fluorescence quantitative PCR; the iron ion content in the cells was detected according to the instructions of the total cell iron colorimetric assay kit (the kit was purchased from Wuhan Elabscience Biotechnology Co., Ltd., product number E-BC-K880-M); the malondialdehyde (MDA) content in the cells was detected according to the instructions of the MDA assay kit (the kit was purchased from Nanjing Jiancheng Bioengineering Institute, product number A003-1); the reduced glutathione (GSH) content in the cells was detected according to the instructions of the GSH kit (the kit was purchased from Nanjing Jiancheng Bioengineering Institute, product number A006-2).
[0085] The results showed ( Figure 11 A-E in), compared with the negative control group, knocking down piRNAAB349597.1 significantly up-regulated the expression levels of xCT and GPX4 in the cells, down-regulated the mRNA expression level of PTGS2, reduced the contents of total iron ions and malondialdehyde in the cells, and increased the content of reduced glutathione in the cells. The above results indicate that knocking down piRNAAB349597.1 significantly inhibits doxorubicin-induced ferroptosis of cardiomyocytes.
[0086] Example 6
[0087] Detect the role of knocking down piRNAAB349597.1 in doxorubicin-induced oxidative stress and mitochondrial dysfunction of cardiomyocytes.
[0088] The normally cultured AC16 cells were seeded into 24-well plates. When the confluence reached 40%-50%, after transfecting the piRNAAB349597.1 inhibitor or its negative control for 48 h (the same steps as in Example 4), 3 μmol / L doxorubicin was added and the cells were treated for 24 h. Then, according to the instructions of the kit (the kit was purchased from Nanjing Jiancheng Bioengineering Institute, product number E004-1), the cells were treated with DCFH-DA probe, incubated at 37 °C in the dark for 20 min, observed and photographed under an inverted fluorescence microscope, and the green fluorescence intensity was analyzed to evaluate the intracellular reactive oxygen species (ROS) level.
[0089] To detect the role of piRNA AB349597.1 in doxorubicin-induced reactive oxygen species (ROS) accumulation in cardiomyocytes, the DCFH-DA fluorescent probe was used to detect the ROS level. The results showed ( Figure 12 as shown in A–B of
[0090] ), compared with the negative control group, knockdown of piRNA AB349597.1 significantly inhibited doxorubicin-induced ROS level accumulation in cardiomyocytes. The JC-1 staining working solution was prepared according to the kit instructions (the kit was purchased from Beyotime Biotechnology Co., Ltd., product number C2006). The cells were treated at 37 °C in the dark for 20 min, observed and photographed under an inverted fluorescence microscope, and the red fluorescence intensity and green fluorescence intensity were analyzed. The ratio reflected the mitochondrial membrane potential level of the cells.
[0091] To detect the role of piRNA AB349597.1 in doxorubicin-induced mitochondrial dysfunction in cardiomyocytes, the mitochondrial membrane potential level was detected by the JC-1 fluorescent probe. The results showed ( Figure 13 as shown in A–B of
[0092] ), compared with the negative control group, knockdown of piRNA AB349597.1 significantly enhanced the decrease in mitochondrial membrane potential induced by doxorubicin. The above results indicate that knockdown of piRNA AB349597.1 significantly improved doxorubicin-induced mitochondrial dysfunction. The above is only the preferred embodiment of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.
Claims
1. Use of piRNA AB349597.1 in the preparation of a drug for preventing and / or treating cardiomyopathy, characterized in that, The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.
1.
2. Use of a piRNA AB349597.1 inhibitor in the preparation of a drug for preventing and / or treating cardiomyopathy, characterized in that, The nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.
1.
3. The application according to claim 2, characterized in that, The inhibitor of piRNA AB349597.1 includes a piRNA Inhibitor that is reverse complementary to the piRNA AB349597.1, and the nucleotide sequence of the piRNA Inhibitor is shown as SEQ ID NO.
2.
4. The application according to any one of claims 1 to 3, characterized in that, The drug inhibits the expression of piRNA AB349597.
1.
5. The application according to any one of claims 1 to 3, characterized in that The cardiomyopathy is doxorubicin-induced cardiomyopathy.
6. The application according to claim 5, characterized in that, The doxorubicin-induced cardiomyopathy includes doxorubicin-induced cardiotoxicity, cardiac atrophy, cardiac dysfunction, cardiac fibrosis, ferroptosis of cardiomyocytes, mitochondrial dysfunction of cardiomyocytes, and accumulation of reactive oxygen species in cardiomyocytes.
7. A primer set for detecting the expression level of piRNA AB349597.1, characterized in that, The primer set includes a reverse transcription primer for piRNA AB349597.1, a forward primer for quantitative PCR, and a reverse primer for quantitative PCR. The nucleotide sequence of the reverse transcription primer for piRNA AB349597.1 is shown as SEQ ID NO.3, the nucleotide sequence of the forward primer for quantitative PCR is shown as SEQ ID NO.4, and the nucleotide sequence of the reverse primer for quantitative PCR is shown as SEQ ID NO.
5.
8. A reagent for detecting the expression level of piRNA AB349597.1, characterized in that, The reagent includes the primer set recited in claim 7.
9. Use of the primer set recited in claim 7 or the reagent recited in claim 8 in the preparation of a product for assessing the risk of suffering from cardiomyopathy.
10. A drug for treating and / or preventing cardiomyopathy, characterized in that, The drug includes an inhibitor of piRNA AB349597.1, and the nucleotide sequence of the piRNA AB349597.1 is shown as SEQ ID NO.1.