GR reporter gene stably transfected cell strain construction method based on human kidney epithelial cell HEK-293T
By constructing the GR reporter gene stable transgeneration cell line of HEK-293T cells, the problem of insufficient stability and high-throughput screening efficiency of the existing screening system was solved, and high sensitivity and stable GR-active ligand molecular screening was achieved, which was suitable for drug screening and environmental endocrine disruptor evaluation.
Patent Information
- Application Number
- CN202510394236.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-04
AI Technical Summary
The existing GR screening system based on yeast and mammalian cells has insufficient stability and high-throughput screening efficiency, which is difficult to meet the needs of GR gene function research, drug screening and high-throughput screening of EDCs.
The GR reporter gene stable transgeneration cell line based on HEK-293T in human renal epithelial cells was constructed. The GAL4/USA-fluc-GFP-Puro reporter vector and the GAL4DBD-GRLBD-BSD gene overexpression vector were constructed, and lentiviral transduction and cell line drug screening were performed to establish the HEK-293T-GAL4/USA-fluc-GFP-GAL4DBD-GRLBD monoclonal stable transgeneration cell line.
High sensitivity and high stability of GR-active ligand molecular screening, the biological activity test of agonists and antagonists shows a typical dose-effect relationship, suitable for high-throughput screening and evaluation of environmental endocrine disruptors.
Smart Images

Figure CN120249211A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and environmental toxicology research, and specifically discloses a method for constructing a GR reporter gene stably transfected cell line based on human renal epithelial cells HEK-293T and its application. Background Art
[0002] Glucocorticoids (GCs) are lipophilic steroid hormones secreted by the adrenal cortex, which participate in maintaining the body's metabolic homeostasis, immune function and stress response by regulating carbohydrate, fat and protein metabolism. Its biological effects are mainly mediated by the glucocorticoid receptor (GR). GR is a ligand-dependent nuclear receptor transcription factor belonging to the nuclear receptor superfamily. By interacting with the glucocorticoid response element (GRE) in the target gene, it regulates the expression of thousands of genes, thereby realizing the physiological functions of GCs. In addition, GR also plays an important role in the negative feedback regulation of the hypothalamic-pituitary-adrenal axis, neural plasticity and tumor signaling pathways.
[0003] GR is widely expressed in mammalian cells and has subtypes such as GRα and GRβ. Its structure includes an N-terminal transcriptional activation domain, a central DNA binding domain (DBD) and a C-terminal ligand binding domain (LBD). GR has become an important drug target for anti-inflammatory, immune, metabolic and anti-tumor therapies. For example, GR agonists and antagonists have been used to treat asthma, chronic obstructive pulmonary disease, arthritis, inflammatory diseases and diabetes, etc.
[0004] In addition, GR is also an important molecular target concerned in the field of environmental toxicology. Some endocrine disrupting compounds (EDCs) can interact with the GR receptor and interfere with the normal function of the body's endocrine system. For example, bisphenol A (BPA) promotes lipid accumulation in adipocytes by activating GR. Therefore, establishing an efficient screening system for GR can not only provide support for drug research and development, but also evaluate the endocrine disrupting effects of chemical substances, providing an important basis for the application of the GR target in environmental toxicology.
[0005] At present, the in vitro screening methods for GR active ligand molecules are still in the initial development stage. Common methods include screening systems based on yeast cells and mammalian cells. The yeast cell system is widely used because of its simple operation, low cost, and suitability for high-throughput screening. However, its results may not fully reflect the physiological conditions of mammalian cells. In contrast, the screening system based on mammalian cells is closer to the in vivo environment and can be used to screen GR active ligand molecules and predict their potential effects on exposed organisms. For example, the study of CN201480075263.7 found that the activity and level of GR are closely related to the incidence of prostate cancer, and its inhibitor can reduce the incidence risk of castration-resistant prostate cancer, which helps to identify and characterize potential therapeutic reagents. However, the mammalian cell system still faces challenges in construction methods, screening steps, and cell stability, and the screening efficiency needs to be further improved.
[0006] In order to more efficiently study the function of GR and its role in target validation, drug development, and EDCs screening, it is urgent to develop a GR effector screening system with good stability, strong anti-interference ability, and suitable for high-throughput detection. The establishment of this system can not only simulate the physiological function of GR in vivo but also provide an important tool for studying the GR-mediated signal pathway and developing a high-throughput screening system, with broad application value. Summary of the Invention
[0007] The existing in vitro screening systems targeting GR have certain limitations. The GR screening system constructed with yeast as the host cell cannot fully simulate the transcriptional activation or inhibition of human-derived GR by compounds due to the simple intracellular environment of yeast cells. At the same time, the number of passages of yeast cells is relatively small, and it is difficult to maintain cell viability, which limits its application in automated high-throughput screening. On the other hand, most of the existing GR screening systems based on mammalian cells adopt a transient transfection system, with poor versatility and low stability, and it is difficult to meet the requirements of GR gene function research, drug screening, and EDCs high-throughput screening.
[0008] To solve the above problems, the present invention provides a method for constructing a GR reporter gene stable transfection cell line based on human renal epithelial cells HEK-293T, including:
[0009] S1: Construct a GAL4 / USA-ffluc-GFP-Puro reporter gene vector, and the reporter gene vector includes the upstream regulatory sequence USA5 sequence SEQ ID NO:1 that can be recognized and bound by GAL4, a mini-promoter sequence, a firefly luciferase gene, an EF1α promoter sequence, a green fluorescent protein gene, and a puromycin resistance gene;
[0010] S2: Construct a GAL4DBD-GRLBD-BSD gene overexpression vector, where the overexpression vector includes a GAL4 DNA binding domain, a GR ligand binding domain, a CMV promoter sequence, an EF1α promoter sequence, and a blasticidin resistance gene;
[0011] S3: Perform lentiviral transduction and cell line drug screening on 293T cells, including:
[0012] Introduce the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector into cells and perform screening to construct a HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD monoclonal stable transfection cell line.
[0013] Furthermore,
[0014] The S3 includes:
[0015] (1) Co-transfect the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus with a lentiviral packaging plasmid into HEK-293T cells to obtain the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus and the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus;
[0016] (2) Transduce the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells and perform puromycin resistance screening, and transduce the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus into HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells and perform blasticidin S resistance screening;
[0017] Among them, the HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells are cells obtained by transducing the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells.
[0018] Furthermore, the vector construction of S1 and S2 is carried out in mammalian cells, where,
[0019] The mammalian cells are passaged cells;
[0020] The GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector are at least partially integrated into the cell chromosome;
[0021] The reporter gene vector described above includes the green fluorescent protein gene (GFP) and firefly luciferase (ffluc).
[0022] Furthermore, during the lentiviral transduction process, the concentration of the transduction enhancer polybrene is 8 μg / mL.
[0023] Furthermore, in the puromycin resistance screening, the screening concentration is 2.5 μg / mL and the maintenance screening concentration is 1.25 μg / mL; in the blasticidin S resistance screening, the screening concentration is 15 μg / mL and the maintenance screening concentration is 7.5 μg / mL.
[0024] Furthermore, in steps S1 and S2, the construction of the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector includes steps of gene synthesis, restriction enzyme digestion, ligation, transformation, sequencing identification, and plasmid amplification.
[0025] On the other hand, the present application also requests protection for a method for screening GR-active ligand molecules, including:
[0026] (a) Contacting the test compound with the aforementioned stable transfected cell line;
[0027] (b) Detecting the expression signal of the firefly luciferase gene (LUC2) in the stable transfected cell line;
[0028] (c) Determining the transcriptional activation or antagonistic effect of the compound on GR according to the signal change.
[0029] On the other hand, the present application also requests protection for a kit for high-throughput screening of GR effectors, which includes the aforementioned stable transfected cell line, luciferase detection reagent, puromycin, and blasticidin screening reagent.
[0030] Furthermore, the GR effector is an environmental endocrine disruptor or a drug candidate molecule, and the kit is applicable to in vitro drug screening and environmental pollution assessment.
[0031] On the other hand, the present application also requests protection for a GR activity detection system, including:
[0032] (a) The culture system of the aforementioned stable transfected cell line;
[0033] (b) The luciferase substrate detection reagent;
[0034] (c) A data analysis module for generating a dose-effect curve based on the fluorescence signal and determining the GR activity of the test compound based on the EC 50 / IC 50 value.
[0035] Compared with the prior art, the present invention has the following advantages:
[0036] 1. A stable cell line containing the ligand-binding domain of GR was constructed based on the HEK-293T cell line, which can be used for high-throughput testing of exogenous chemicals.
[0037] 2. The present invention characterizes the GR transcriptional activity by introducing a luciferase reporter gene. The luciferase reporter gene detection method can digitalize the expression intensity data of the target gene, with extremely low background signal values and extremely high sensitivity.
[0038] 3. For the stable cell line constructed by the present invention, when performing biological activity tests of agonists and antagonists, positive agonists such as dexamethasone and mifepristone antagonists all produced good dose-effect relationships, presenting typical "S"-shaped curves or inverted "S"-shaped curves.
[0039] 4. The sensitivity of this stable cell line is relatively high. The EC 50 value of dexamethasone as an agonist is 5.7 nM, and the lowest observable effect concentration (LOEC) is 0.5 nM; the IC 50 value of mifepristone is 250 nM, and the LOEC value is 10 nM.
[0040] 5. When this stable cell line is used for in vitro screening of GR active ligand molecules, the response interval is relatively wide. The linear range of the agonist dexamethasone is 0.1 - 500 nM, and the linear range of the antagonist mifepristone is 5 - 2500 nM.
[0041] 6. When this stable cell line is used for in vitro screening of GR active ligand molecules, the data stability is relatively good. The relative standard deviations (RSD) of each concentration induced by the agonist dexamethasone and the antagonist mifepristone are both < 25%.
[0042] 7. For multiple generations of agonist response tests on this stable cell line, the EC 50 has no obvious change, indicating that this cell line has good stability and reliable data for long-term testing. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly describe the drawings required for the description of the embodiments or the prior art. It should be particularly noted that the drawings in the following description are all some embodiments of the present invention. Those skilled in the art can also obtain other drawings based on these drawings without departing from the core design concept of the present invention.Figure 1 It is the map of the lentiviral recombinant plasmid of the GAL4 / USA-ffluc-GFP-Puro reporter gene;
[0044] Figure 2 It is the map of the lentiviral recombinant plasmid of the overexpressed gene GAL4DBD-GRLBD-BSD;
[0045] Figure 3 It is the observation result after drug screening of the stable transfected cell line HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD;
[0046] Figure 4 It is the verification of the GR gene expression in the stable transfected cell line HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD;
[0047] Figure 5 It is the result of the bioactivity test of GR agonists and antagonists using the stable transfected cell line HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD. Specific implementation manners
[0048] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the accompanying drawings in the embodiments of the present invention. It should be noted that the embodiments described below are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention. Refer to Figures 1-5 , the present invention provides a method for constructing a stable transfected cell line of a GR reporter gene based on human renal epithelial cells HEK-293T, including:
[0049] S1: Construct a GAL4 / USA-ffluc-GFP-Puro reporter gene vector, and the reporter gene vector includes the upstream regulatory sequence USA5 sequence SEQ ID NO:1 that can be recognized and bound by GAL4, a mini-promoter sequence, a firefly luciferase gene, an EF1α promoter sequence, a green fluorescent protein gene, and a puromycin resistance gene;
[0050] S2: Construct a GAL4DBD-GRLBD-BSD gene overexpression vector, and the overexpression vector includes a GAL4 DNA binding domain, a GR ligand binding domain, a CMV promoter sequence, an EF1α promoter sequence, and a blasticidin resistance gene;
[0051] S3: Perform lentiviral transduction on 293T cells and screen cell lines for drugs, including:
[0052] Introduce the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector into cells and perform screening to construct the HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD monoclonal stable transfected cell line.
[0053] Furthermore,
[0054] The said S3 includes:
[0055] (1) Co-transfect the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus with the lentiviral packaging plasmid into HEK-293T cells to obtain the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus and the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus;
[0056] (2) Transduce the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells and perform puromycin resistance screening, and transduce the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus into HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells and perform blasticidin S resistance screening;
[0057] Among them, the HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells are the cells obtained by transducing the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells.
[0058] Furthermore, the vector construction of S1 and S2 is both carried out in mammalian cells, among which,
[0059] The said mammalian cells are passage cells;
[0060] The said GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector are at least partially integrated into the cell chromosome;
[0061] The said reporter gene vector includes the green fluorescent protein gene (GFP) and firefly luciferase (ffluc).
[0062] The GAL4 / USA-ffluc-GFP-Puro reporter gene of the present invention comprises a target gene upstream regulatory sequence (UAS sequence) recognizable and bindable by GAL4, a promoter, a reporter gene, and a first selection marker gene, which are operably linked in sequence from 5' to 3';
[0063] In a specific embodiment, the present invention provides a method for constructing a HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD stable cell line, and the construction steps are as follows:
[0064] S1: Prepare a GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus and a GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus
[0065] (1) Respectively transform the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant plasmid and the GAL4DBD-GRLBD-BSD overexpression recombinant plasmid into stbl3 competent cells for plasmid amplification. Then, perform a large-scale endotoxin removal extraction to make the final plasmid concentration > 500 ng / μL;
[0066] (2) Co-transfect the GAL4 / USA-ffluc-GFP-Puro reporter gene plasmid and the GAL4DBD-GRLBD-BSD overexpression plasmid with packaging plasmids into lentivirus packaging cells. Then, collect the virus supernatant, filter it, and collect the filtrate containing the virus. Obtain the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus and the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus.
[0067] S2: Lentivirus transduction and screening of stable cell lines
[0068] (1) After resuscitating HEK-293T cells, culture them in a 37°C cell culture incubator containing 5% carbon dioxide (CO2), and the culture medium is DMEM high-glucose complete medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin;
[0069] (2) Transduce the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T target cells, and obtain a reporter gene stable cell line after puromycin resistance screening. Then, transduce the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus into the reporter gene stable cell line, and obtain the HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD stable cell line after drug screening with blasticidin.
[0070] Further, the GAL4DBD-GRLBD-BSD overexpression plasmid contains a fusion gene expression cassette of a GR ligand binding domain (GRLBD) and a GAL4 DNA binding domain (GAL4DBD) and a blasticidin resistance gene sequence.
[0071] Further, the GAL4 / USA-ffluc-GFP-Puro reporter gene plasmid contains an upstream regulatory sequence binding element (UAS sequence) recognizable and bindable by GAL4, a mini-promoter, a green fluorescent protein gene, a LUC2 luciferase gene, and a puromycin resistance gene.
[0072] Further, in step 2) of S1, the lentivirus packaging cells used are HEK-293T cells.
[0073] Further, in step 2) of S1, when co-transfecting the reporter gene plasmid and the overexpression plasmid with the packaging plasmid into HEK-293T cells, the transfection reagent used is Lipofectamine 3000.
[0074] Further, in step 2) of S1, the reporter gene plasmid and the GR gene expression plasmid are co-transfected with the packaging auxiliary plasmid into HEK-293T cells. After 8 h, the fresh medium is replaced to terminate transfection. After 48 h and 72 h, the supernatant is collected respectively, and after filtration through a 0.45 μm filter membrane, the lentivirus is concentrated and purified with a lentivirus concentrate.
[0075] Further, in step 2) of S1, the virus titer of the obtained GR gene recombinant lentivirus is not less than 10 8 TU / mL.
[0076] Further, in S2, the penicillin-streptomycin concentrations are 100 U / mL and 100 μg / mL respectively.
[0077] Further, step 2 of S2 is specifically as follows:
[0078] The reporter gene recombinant lentivirus is transduced into HEK-293T target cells. The transduction enhancer used is polybrene, and the concentration is 8 μg / mL. After 8 h of transduction, the culture medium is replaced to terminate virus transduction. 48 h after cell transduction, 2.5 μg / mL puromycin is added for screening to obtain reporter gene stably transfected cells. Then the GAL4DBD-GRLBD-BSD gene overexpression lentivirus is transduced into the reporter gene stably transfected cells. After 8 h of transduction, the culture medium is replaced to terminate virus transduction. 48 h after cell transduction, 15 μg / mL blasticidin is added for screening to obtain a GR reporter gene stably transfected cell line.
[0079] The following further introduces the present application in combination with examples:
[0080] Example 1 Construction of Recombinant Cells for Screening GR Active Ligand Molecules
[0081] Step 1: Construct the GAL4 / USA-ffluc-GFP-Puro reporter gene vector as shown in Figure 1 Figure
[0082] Design the GAL4 / USA-ffluc-GFP-Puro reporter gene vector 43C2_pLenti-USA5 / GAL4DBD-mini-LUC2-EF1α-GFP-Puro as shown in Figure 1 Figure. Among them, "pLenti" represents the pLenti backbone vector, "USA5 / GAL4DBD" represents the upstream regulatory sequence (USA5 sequence) of the target gene that can be recognized and bound by GAL4, "mini" represents the mini-promoter sequence, "LUC2" represents the firefly luciferase gene, "EF1α" represents the EF1α promoter sequence, "GFP" represents the green fluorescent protein gene, and "Puro" represents the puromycin resistance gene. The USA5 sequence is as shown in SEQ ID NO:1: GGAGCACTGTCCTCCGAACGTCGGAGCACTGTCCTCCGAACGTCGGAGCACTGTCCTCCGAACGTCGGAGCACTGTCCTCCGAACGGAGCATGTCCTCCGAACGTCGGAGCACTGTCCTCCGAACG
[0083] Step 2: Construct the GAL4DBD-GRLBD-BSD gene overexpression vector as shown in Figure 2 Figure
[0084] According to the reference, log in to NCBI to query and obtain the required GR gene sequence. Synthesize the transcript sequence NM_005693.4 (SEQ ID NO:2) of the human GR receptor by gene synthesis, and amplify the target gene by PCR.
[0085] (1) Digest the vector 3MA7_pCDH-CMV-GAL4DBD-GRLBD-EF1α-BSD with restriction endonucleases, and recover the vector fragment by 1% agarose gel electrophoresis.
[0086] (2) Use the In-Fusion ligation system to recombinantly ligate the vector fragment and the target gene GR to form the GAL4DBD-GRLBD-BSD overexpression plasmid 33A7_pCDH-CMV-GAL4DBD-GRLBD-EF1α-BSD. Among them, "pCDH" represents the pCDH backbone vector, "CMV" represents the CMV promoter sequence, "GAL4DBD" represents the inclusion of the GAL4 DNA binding domain, "GRLBD" represents that the plasmid contains the GR ligand binding domain, "EF1α" represents the EF1α promoter sequence, and "BSD" represents the blasticidin resistance gene sequence (denoted as the BSD gene sequence). Transform the ligation product into stbl3 competent cells. Perform sequencing identification on the grown monoclonal colonies, conduct comparative analysis on the sequencing results, and those with completely correct sequences are considered successfully constructed, and then plasmid amplification is carried out.
[0087] (3) Perform a large-scale endotoxin-free extraction of the GAL4DBD-GRLBD-BSD overexpression plasmid to make the final concentration of the plasmid > 500 ng / μL;
[0088] Step 3: Lentiviral transduction and cell line drug screening
[0089] (1) Inoculate 293T cells with good growth status into a 15-cm cell culture dish. After 24 hours, co-transfect the two plasmids, GAL4 / USA-ffluc-GFP-Puro and GAL4DBD-GRLBD-BSD, with the lentiviral packaging plasmid into 293T cells. Replace the fresh medium 8 hours later to terminate the transfection. Collect the viral supernatants at 48 hours and 72 hours after transfection respectively. After filtering through a 0.45-μm filter, concentrate and purify the lentivirus with a lentivirus concentrate to obtain the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus (containing the mini-promoter, green fluorescent protein gene, LUC2 luciferase gene, and puromycin resistance gene, named 43C2_pLenti-USA5 / GAL4DBD-mini-LUC2-EF1α-GFP-Puro) and the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus (containing the blasticidin resistance gene expression cassette, named 33A7_pCDH-CMV-GAL4DBD-GRLBD-EF1α-BSD) concentrates, and store them at -80 °C for later use.
[0090] (2) Transduce HEK-293T cells with lentivirus GAL4 / USA-ffluc-GFP-Puro at a polybrene concentration of 8 μg / mL as a transduction enhancer. Replace the medium 8 h later to terminate transduction. Screen the HEK-293T-GAL4 / USA-ffluc-GFP-Puro cell line for puromycin resistance at a screening concentration of 2.5 μg / mL. Replace the medium and passage the cells 72 h later, maintaining a drug screening concentration of 1.25 μg / mL until all the control cell lines that were not transduced with the virus are completely dead. Then slowly reduce the drug concentration to expand the cells.
[0091] (3) Transduce HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells with lentivirus pLenti-GAL4DBD-GRLBD-BSD at a polybrene concentration of 8 μg / ml as a transduction enhancer. Replace the medium 8 h later to terminate transduction. Screen the HEK-293T-GAL4 / USA-ffluc-GFP-Puro-GAL4DBD-GRLBD-BSD cell line for blasticidin S resistance at a screening concentration of 15 μg / mL. Replace the medium and passage the cells 72 h later, maintaining a drug screening concentration of 7.5 μg / mL until all the control cell lines that were not transduced with the virus are completely dead. Then slowly reduce the drug concentration to expand the cells.
[0092] Figure 3 A and Figure 3 B are respectively the bright field detection (white field) and fluorescence detection (GFP field) under the same field of view. The results show that the fluorescence rate of the cell line can reach 100%, that is, the transfection rate of the stable transfected cell line is 100%. Use the mycoplasma detection kit (PCR method) of Hangzhou Hua'an Biotechnology to detect the mycoplasma contamination of the stable transfected cell line. The results show that the constructed stable transfected cell line is free of mycoplasma contamination.
[0093] (4) Collect cells from each group respectively: Extract total cellular RNA, and perform qPCR analysis of the overexpression level of the target gene after reverse transcription.
[0094] Example 2: Verification of the expression of GR gene in the HEK-293T-GAL4 / USA-ffluc-GFP-Puro-GAL4DBD-GRLBD-BSD stable transfected cell line by qPCR
[0095] In this experiment, two experimental groups were set up, specifically: untransfected wild-type HEK-293T cells and HEK-293T-GAL4 / USA-ffluc-GFP-Puro-GAL4DBD-GRLBD-BSD stable transfected cells.
[0096] (1) Design specific primer sequences:
[0097] GAL4DBD - GRLBD upstream sequence: TGCCGTCACAGATAGATTGGCT
[0098] GAL4DBD - GRLBD downstream sequence: GTGGTGTCGACGGAATCGCT
[0099] (2) Total RNA was extracted from cell pellets using Trizol (Takara), and then the total RNA was reverse - transcribed into cDNA using the reverse transcription kit primescript RT Master Mix (Takara).
[0100] (3) qPCR was performed using the SYBR Green I dye method to detect the expression of GR in two groups of cells and perform relative quantitative analysis. There were 3 parallel samples in each group. The qPCR results of the stable transfected cell line obtained in Example 1 and the blank control are as Figure 4 shown.
[0101] It can be seen from the results that after over - expression lentivirus infection of GAL4DBD - GRLBD, the expression level of GAL4DBD - GRLBD was significantly increased, while there was no amplification in wild - type HEK - 293T cells.
[0102] Example 3 Compound Exposure and Reporter Gene Detection
[0103] (1) Compound exposure: The HEK - 293T - GAL4 / USA - ffluc - GFP - Puro - GAL4DBD - GRLBD - BSD stable transfected cell line was seeded into a clear - bottom 96 - well white plate at a density of 40,000 cells / well. The cells were exposed to the test compounds at different concentrations with no obvious cytotoxicity (cell viability > 80%) for 6 h. The exposure medium was DMEM high - glucose complete medium containing 10% FBS and 1% penicillin - streptomycin. The compound stock solution prepared with dimethyl sulfoxide (DMSO) was diluted into a series of concentrations using the exposure medium.
[0104] a. To detect the agonist activity of Dexamethasone, the transfected cells were directly exposed to the diluted agonist (DMSO content ≤ 0.1%). The compound concentration gradients were 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000 nM, and 0.1% DMSO was used as the control group; at least 3 wells were set as replicates for each concentration gradient.
[0105] b. To detect the antagonistic activity of Mifepristone, 2 μM of Dexamethasone should be included in each concentration of the antagonist, and the exposure concentrations of Mifepristone are 1, 5, 10, 50, 100, 500, 1000, 2500, 5000, 10000 nM.
[0106] (2) Firefly luciferase activity detection: The luciferase activity after 6 h of compound exposure was measured using a detection kit, and the detection method was the mono - luciferase reporter gene assay (mono - Luc assay).
[0107] Result analysis: The in vitro screening methods for molecules with GR agonist or antagonist activity were evaluated using the known positive agonist Dexamethasone and antagonist Mifepristone respectively. As Figure 5 shown, under the mono - Luc assay detection, both the positive agonist Dexamethasone and the positive antagonist Mifepristone showed good dose - effect relationships, presenting typical "S" - shaped curves or inverted "S" - shaped curves. With high sensitivity, the half - maximal effective concentration (EC 50 ) of Dexamethasone was 5.7 nM, the IC 50 value of Mifepristone was 250.0 nM, and the lowest observable effect concentration (LOEC) of Dexamethasone and the antagonist Mifepristone were 0.5 nM and 10.0 nM respectively; this method had a wide response range, and the linear ranges of Dexamethasone and Mifepristone were 0.1 - 500 nM and 5 - 2500 nM respectively. This method had good reproducibility, and the relative standard deviation (RSD) of the effect values at each concentration of Dexamethasone and Mifepristone was < 25%.
[0108] In the present invention, using HEK - 293T cells as the host, through lentivirus - mediated transfection technology, the firefly luciferase (Luciferase) reporter gene vector and the human - derived GR expression vector were co - introduced into the cells, and a GR - overexpressing stable cell line was successfully constructed. The recombinant cells can truly simulate the physiological function of GR, be used to evaluate the activation or inhibition of exogenous compounds on GR, and are applicable to fields such as GR gene function research, drug screening, and endocrine disruptor screening, with broad application prospects. The GR - overexpressing stable cell line constructed in the present invention has the advantages of simple operation, short experimental period, high sensitivity, and strong accuracy in the actual application process, and is particularly suitable for high - throughput screening, providing an efficient, convenient, and accurate model for drug screening for related diseases and the evaluation of the endocrine disrupting effects of environmental pollutants.
[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for constructing a GR reporter gene stably transfected cell line based on human renal epithelial cells HEK-293T, characterized in that, Including: S1: Construct a GAL4 / USA-ffluc-GFP-Puro reporter gene vector, which includes the upstream regulatory sequence USA5 sequence SEQ ID NO:1 that can be recognized and bound by GAL4, the mini-promoter sequence, the firefly luciferase gene, the EF1α promoter sequence, the green fluorescent protein gene, and the puromycin resistance gene; S2: Construct a GAL4DBD-GRLBD-BSD gene overexpression vector, which includes the GAL4 DNA binding domain, the GR ligand binding domain, the CMV promoter sequence, the EF1α promoter sequence, and the blasticidin S resistance gene; S3: Perform lentiviral transduction and cell line drug screening on 293T cells, including: Introduce the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector into the cells and perform screening to construct a HEK-293T-GAL4 / USA-ffluc-GFP-GAL4DBD-GRLBD monoclonal stable transfected cell line.
2. The construction method according to claim 1, wherein The S3 includes: (1) Co-transfect the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus with the lentiviral packaging plasmid into HEK-293T cells to obtain the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus and the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus; (2) Transduce the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells and perform puromycin resistance screening, and transduce the GAL4DBD-GRLBD-BSD overexpression recombinant lentivirus into HEK-293T-GAL4 / USA-ffluc-GFP-Puro cells and perform blasticidin S resistance screening; Among them, the HEK-293T-GAL4 / USA-ffluc-GFP-Puro cell is a cell obtained by transducing the GAL4 / USA-ffluc-GFP-Puro reporter gene recombinant lentivirus into HEK-293T cells.
3. The construction method according to claim 1, wherein The vector construction of S1 and S2 is carried out in mammalian cells, wherein: The mammalian cells are passage cells; The GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector are at least partially integrated into the cell chromosome; The reporter gene vector includes the green fluorescent protein gene (GFP) and the firefly luciferase (ffluc).
4. The construction method according to claim 1, characterized in that, During the lentiviral transduction process, the concentration of the transduction enhancer polybrene is 8 μg / mL.
5. The construction method according to claim 1, wherein In puromycin resistance screening, the screening concentration is 2.5 μg / mL, and the maintenance screening concentration is 1.25 μg / mL; in blasticidin S resistance screening, the screening concentration is 15 μg / mL, and the maintenance screening concentration is 7.5 μg / mL.
6. The construction method according to claim 1, characterized in that In steps S1 and S2, the construction of the GAL4 / USA-ffluc-GFP-Puro reporter gene vector and the GAL4DBD-GRLBD-BSD gene overexpression vector includes steps of gene synthesis, restriction enzyme digestion, ligation, transformation, sequencing identification, and plasmid amplification.
7. A method for screening GR active ligand molecules, characterized in that, Comprising: (a) Co-incubating the test compound with the stable cell line described in claim 1; (b) Detecting the expression signal of the firefly luciferase gene (LUC2) in the stable cell line; (c) Determining the transcriptional activation or antagonistic effect of the compound on GR according to the signal change.
8. A kit for high-throughput screening of GR effectors, characterized in that, Comprising the stable cell line described in claim 1, a luciferase detection reagent, puromycin, and a blasticidin screening reagent.
9. The kit according to claim 8, characterized in that, The GR effector is an environmental endocrine disruptor or a drug candidate molecule, and the kit is applicable to in vitro drug screening and environmental pollution assessment.
10. A GR activity detection system, characterized in that, Comprising: (a) The culture system of the stable cell line described in claim 1; (b) A luciferase substrate detection reagent; (c) Data analysis module, configured to generate a dose-response curve based on fluorescence signals and determine the GR activity of the compound to be tested based on the EC 50 / IC 50 value.
Citation Information
Patent Citations
Glucocorticoid inhibitors for treatment of prostate cancer
CN105979780A