Application of circular RNA circVMP1 in preparation of product for predicting or treating proteinuria kidney injury of chronic kidney disease

By identifying and inhibiting circVMP1 expression, the toxic effect of blocking proteinuria on renal tubular epithelial cells in the prior art was solved, and effective prediction and treatment of proteinuria renal injury in chronic renal disease was achieved, which reduced the damage and fibrosis of renal tubular epithelial cells and protected renal function.

CN120249474APending Publication Date: 2025-07-04AFFILIATED HOSPITAL OF GUANGDONG MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510408537.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The prior art lacks effective methods to block the toxic effect of proteinuria on tubular epithelial cells, leading to the progression of chronic kidney disease, especially in patients with CKD who still have residual proteinuria after RAS treatment, with a lack of new targets and strategies to slow renal damage.

Method used

By identifying the significant upregulation of circular RNA circVMP1 under the action of human serum albumin, it is developed as a predictive marker, and its expression in renal tubular epithelial cells is reduced by inhibiting circVMP1 expression, such as siRNA, etc., to reduce cell apoptosis and renal fibrosis.

Benefits of technology

circVMP1 significantly alleviates apoptosis and tubular interstitial damage in renal tubular epithelial cells, protects renal function, and provides new targets and strategies for predicting and treating proteinuria renal injury in chronic renal disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005341914730000071
    Figure BDA0005341914730000071
  • Figure HDA0005341914740000011
    Figure HDA0005341914740000011
  • Figure HDA0005341914740000012
    Figure HDA0005341914740000012
Patent Text Reader

Abstract

The invention discloses an application of circular RNA circVMP1 in preparation of a product for predicting or treating proteinuria kidney injury of chronic kidney disease, and relates to the technical field of biological medicine.The circular RNA circVMP1 is mainly generated by reverse splicing of exons 2-5 of a VMP1 gene, the sequence of the circular RNA circVMP1 is shown as SEQ ID NO.1 or SEQ ID NO.2, and the circular RNA circVMP1 can be used for predicting or treating proteinuria kidney injury of chronic kidney disease. The product for predicting the proteinuria kidney injury of the chronic kidney disease comprises a reagent, a kit or a chip, the identification of the invention finds that the expression of circVMP1 is significantly up-regulated under the action of HSA; in-vivo and in-vitro experiments show that knock-down of the circVMP1 can significantly relieve apoptosis of renal tubular epithelial cells, so that renal tubular interstitial injury and renal fibrosis of mice with chronic kidney diseases are relieved, and research proves that the circVMP1 has application prospects in proteinuria kidney injury of chronic kidney diseases as a new predictive index and treatment target.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of circular RNA circVMP1 in the preparation of products for predicting or treating proteinuria renal injury in chronic kidney disease. Background Art

[0002] Chronic kidney disease (CKD) affects about 10% of the world's population. CKD patients have a high risk of developing end-stage renal failure. Once they develop to end-stage renal failure, patients can only rely on renal replacement therapy (kidney transplantation or dialysis) to maintain their lives. It is known as the "most expensive chronic disease". The results of the first cross-sectional epidemiological study of CKD in China in 2012 revealed that the prevalence of CKD in adults in my country was 10.8%. Proteinuria is one of the most common clinical symptoms of progressive CKD. Studies in the past two decades have shown that proteinuria is not only a sign of kidney disease, but also an independent risk factor for accelerating kidney damage. Compared with glomerular lesions, decreased renal function is more closely related to tubulointerstitial lesions. In addition, excessive urinary protein can increase the content of reactive oxygen species (ROS) in renal tubular epithelial cells, damage the function of cell mitochondria, and stimulate cell endoplasmic reticulum stress, thereby producing toxic effects on renal tubular epithelial cells.

[0003] Regarding proteinuria, currently, in addition to using renin-angiotensin system (RAS) inhibitors to reduce protein leakage from the glomerular filtration barrier, there is no effective treatment to reduce urine protein and delay the damage of urine protein to renal tubular epithelial cells leading to CKD progression. However, most CKD patients still have residual proteinuria after receiving RAS blocking treatment. Therefore, it is urgent to explore new targets and strategies to block proteinuria from causing kidney damage. Summary of the invention

[0004] In view of this, one of the purposes of the present invention is to provide an application of a circular RNA circVMP1 in the preparation of a product for predicting proteinuria and renal damage in chronic kidney disease. Through identification, it was found that the expression of circVMP1 was significantly upregulated under the action of human serum albumin (HSA), and it can be used as a new marker for predicting renal damage in patients with chronic kidney disease and proteinuria.

[0005] To achieve the above objectives, the present invention provides the use of circular RNA circVMP1 in the preparation of a product for predicting proteinuria renal injury in chronic kidney disease.

[0006] Furthermore, the circular RNA circVMP1 sequence is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0007] Its specific sequence is as follows:

[0008] >hsa_circ_0006508|NM_030938|VMP1(440nt)

[0009] CTCCTCAAGAGTTACTGATCTATGAAATGGCAGAGAATGGAAAAAATTGTGACCAGAGACGTGTAGCAATGAACAAGGAACATCATAATGGAAATTTCACAGACCCCTCTTCAGTGAATGAAAAGAAGAGGAGGGAGCGGGAAGAAAGGCAGAATATTGTCCTGTGGAGACAGCCGCTCATTACCTTGCAGTATTTTTCTCTGGAAATCCTTGTAATCTTGAAGGAATGGACCTCAAAATTATGGCATCGTCAAAGCATTGTGGTGTCTTTTTTACTGCTGCTTGCTGTGCTTATAGCTACGTATTATGTTGAAGGAGTGCATCAACAGTATGTGCAACGTATAGAGAAACAGTTTCTTTTGTATGCCTACTGGATAGGCTTAGGAATTTTGTCTTCTGTTGGGCTTGGAACAGGGCTGCACACCTTTCTGCTTTATCTG(SEQ ID NO.1).

[0010] In addition, when targeting mice, the sequence of circular RNA circVMP1 is as follows:

[0011] >mmu_circ_0003507|ENSMUST00000018315|Vmp1(440nt)

[0012] CTCCTCCAGAGTTCCTGATCTATGAAATGGCAGAGAATGGAAAAAATTGTGACCAGAGACGCATAGCAATGAGTAAGGATCAGCACAATGGAAGTCTCACAGACCCCTCTTCAGTTCATGAGAAGAAGAGAAGGGATCGGGAAGAAAGACAGAATATTGTCCTGTGGAGACAGCCACTCATTACCTTGCAGTATTTCTCTCTGGAAACTCTTGTAGTTTTGAAGGAATGGACCTCAAAATTGTGGCATCGTCAAAGCATTGTGGTGTCCTTTTTACTGCTGCTTGCTGCGCTTGTAGCTACGTATTATGTGGAAGGAGCGCACCAACAGTATGTGCAGCGGATAGAGAAGCAGTTTCTTTTGTATGCATACTGGATAGGCCTGGGGATTTTGTCCTCTGTTGGTCTTGGAACAGGACTGCACACCTTTCTGCTTTATCTG(SEQ IDNO.2).

[0013] Furthermore, the product includes reagents, reagent kits or chips.

[0014] The second object of the present invention is to provide the application of circular RNA circVMP1 in the preparation of drugs for treating proteinuria renal injury in chronic kidney disease.

[0015] Furthermore, the drug includes a reagent that inhibits the expression level of RNA circVMP1.

[0016] Furthermore, the reagent includes small molecule compounds, antibody drugs, proteins, nucleic acid molecules, polypeptides, lipids, carbohydrates or their combinations.

[0017] Furthermore, the reagent includes siRNA, and the sequence of the siRNA is SEQ ID NO.3 or SEQ ID NO.4; wherein SEQ ID NO.3 is directed against the human circVMP1 sequence, specifically CTGCTTTATCTGCTCCTCATT; SEQ ID NO.4 is directed against the mouse circVMP1 sequence, specifically CTGCTTTATCTGCTCCTCCTT.

[0018] The third object of the present invention is to provide the application of circular RNA circVMP1 as a target in screening drugs for predicting / treating proteinuria renal injury in chronic kidney disease.

[0019] The object of the present invention also lies in providing a drug, the drug comprising a substance targeting circular RNA circVMP1 and downregulating it, and the indication of the drug is chronic kidney disease proteinuria renal injury.

[0020] Compared with the prior art, the present invention has the following advantages:

[0021] Through high-throughput sequencing combined with bioinformatics analysis, it was identified and found that the expression of circVMP1 was significantly upregulated under the action of HSA; in vitro and in vivo experiments showed that knocking down circVMP1 significantly alleviated apoptosis of renal tubular epithelial cells, renal tubular interstitial injury and renal fibrosis; the research of the present invention proves that circVMP1 has application prospects as a new predictive index and therapeutic target in the treatment of chronic kidney disease proteinuria renal injury, and provides a new target for the preparation of products for predicting and treating chronic kidney disease proteinuria renal injury. Description of the Drawings

[0022] Figure 1 It is the expression situation and sequencing of circular RNA circVMP1 provided by the embodiment of the present invention. A-B. The clustering heat map shows the expression of 729 differentially expressed circRNAs in two immortalized human proximal tubular epithelial cell lines HK2 and HKC8. C. Sanger sequencing identifies the sequence of the head-to-tail connection region of circVMP1. D. The qRT-PCR results show the expression levels of circVMP1 at different times under the action of HSA. *, P<0.05, **, P<0.01, ***, P<0.001.

[0023] Figure 2 It is the comparison diagram of human and mouse circVMP1 and the expression and localization diagram of circVMP1 in renal tubular epithelial cells provided by the embodiment of the present invention. A. The sequence comparison of human and mouse circVMP1 shows that the biological conservation between the two is 91%. B. The qRT-PCR results show that the expression of circVMP1 in the kidneys of adriamycin nephropathy mice is increased. C. The qRT-PCR results show that the expression of circVMP1 in the kidneys of albumin-overloaded model mice is increased. D. The RNA FISH results show that the expression of circVMP1 in the kidneys of adriamycin nephropathy and albumin-overloaded nephropathy model mice is increased, and it is mainly expressed in proximal tubular epithelial cells. **, P<0.01, ***, P<0.001.

[0024] Figure 3 It is the diagram that knocking down circVMP1 significantly alleviates apoptosis of renal tubular epithelial cells provided by the embodiment of the present invention. A&B. The flow cytometry detection results show that knocking down circVMP1 reduces the apoptosis number of renal tubular epithelial cells under HSA stimulation. **, P<0.01, ***, P<0.001.

[0025] Figure 4 Knockdown of circVMP1 provided by the embodiment of the present invention significantly alleviates the tubulointerstitial injury and renal fibrosis in adriamycin nephropathy mice. A. The results of PAS staining showed that knockdown of circVMP1 alleviated the tubulointerstitial injury in adriamycin nephropathy mice. B. The results of Masson staining indicated that knockdown of circVMP1 alleviated the renal fibrosis in adriamycin nephropathy mice. C. Serum creatinine detection showed that knockdown of circVMP1 protected the renal function of adriamycin nephropathy mice. Detailed implementation manners

[0026] Many specific details are set forth in the following description in order to provide a thorough understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific implementations disclosed below.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs. The terms used in the description of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0028] Example 1 Screening of circRNAs

[0029] Configure HSA (Solarbio) into a culture medium solution with a concentration of 10 mg / mL and co-incubate it with human renal tubular epithelial cell lines HK2 and HKC8 for 24 hours. After the incubation is completed, extract the total RNA, and the extraction steps are as follows:

[0030] 1) Try to suck out the culture medium as much as possible and place the culture dish on ice.

[0031] 2) For a 10 cm 2 culture bottle or a culture dish with a diameter of 3.5 cm, add 1 mL of Trizol and pipette repeatedly until the cell lysate changes from viscous to clear and there are no obvious cell clumps.

[0032] 3) Transfer the cell lysate to a 1.5 mL RNase-free centrifuge tube and let it stand at room temperature for 3 - 5 minutes.

[0033] 4) Add 0.2 mL of chloroform and shake the centrifuge tube vigorously up and down for 15 seconds to fully mix the chloroform with the cell lysate, and let it stand on ice for 3 minutes.

[0034] 5) Centrifuge at 12000 × rpm at 4°C for 15 minutes. After centrifugation, it can be seen that the solution is divided into three phases: the upper layer is a transparent aqueous phase, the middle layer is protein, and the lower layer is red chloroform and the phenolic component in Trizol. The RNA is in the aqueous phase.

[0035] 6) Carefully aspirate 400 μL of the aqueous phase and transfer it to a new RNase-free 1.5 mL centrifuge tube.

[0036] 7) Add 500 μL of pre-chilled isopropanol to the centrifuge tube, pipette to mix well with the aqueous phase, and let it stand on ice for 10 minutes.

[0037] 8) Centrifuge at 12000×rpm at 4 °C for 10 minutes. A white precipitate can be seen adhering to the bottom and side walls of the centrifuge tube.

[0038] 9) Discard the supernatant. Add 1 mL of 75% alcohol prepared with RNase-free water and absolute ethanol to each centrifuge tube. Pipette to wash the RNA. Then centrifuge at 7500×rpm at 4 °C for 5 minutes.

[0039] 10) Remove the supernatant, open the tube cap, allow the RNA precipitate to air-dry approximately, and dissolve the RNA in less than 20 μL of RNase-free water. Incubating at 55 °C - 60 °C on a constant temperature heater for 10 minutes helps dissolve the RNA.

[0040] 11) Take 1 μL of the RNA solution and perform concentration quantification on a NanoDrop ND-1000 spectrophotometer. The remaining RNA should be immediately reverse transcribed or stored at -80 °C in the refrigerator for later use.

[0041] The total RNA extracted was subjected to circRNA sequencing. The results showed that a total of 729 dysregulated circRNAs were co-regulated by HSA in the two cell lines (clustering heatmap of the sequencing, Figure 1 A - B). Among the 729 dysregulated circRNAs, it was identified that circVMP1 increased simultaneously in the two cell lines stimulated by HSA. Through bioinformatics analysis, it was found that circVMP1 was mainly generated by the back-splicing of exons 2 to 5 of the VMP1 gene. Sanger sequencing showed that circVMP1 contained the junction sequence ( Figure 1 C).

[0042] In addition, qRT-PCR analysis was performed on the expression level of circVMP1 in renal tubular epithelial cells after HSA incubation. The steps are as follows:

[0043] (1) Primer design and synthesis

[0044] Search for the sequence of the circRNA to be detected in the circBase database (https: / / circbase.org / ), and design a back primer specific for the circular RNA. Send the designed primer sequence to Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. for synthesis. The primer sequences are as follows:

[0045] Reverse primer sequences for human circVMP1:

[0046] F: TGTCTTCTGTTGGGCTTGGAA (SEQ ID NO.5)

[0047] R: GCTACACGTCTCTGGTCACAA (SEQ ID NO.6)

[0048] Reverse primer sequences for mouse circVMP1:

[0049] F: GTGCAGCGGATAGAGAAGCA (SEQ ID NO.7)

[0050] R: ACTGAAGAGGGGTCTGTGAGA (SEQ ID NO.8)

[0051] (2) cDNA synthesis

[0052] Synthesize cDNA of total RNA according to the HiScript II 1st Strand cDNA Synthesis Kit instructions for qPCR reaction.

[0053] (3) qPCR reaction

[0054] Perform qPCR reaction according to the Taq Pro Universal SYBR qPCR MasterMix instructions. Set 3 replicates for each index of each sample, and the qPCR reaction system for each well is as follows:

[0055]

[0056] Set the qPCR reaction program: Stage1: Pre-denaturation, 95°C, 30 seconds, 1 cycle; Stage2: Cycling reaction, 95°C, 5 seconds → Annealing and extension, 60°C, 30 seconds, 40 cycles; Stage3: Melting curve, 95°C, 15 seconds → 60°C, 60 seconds → 95°C, 15 seconds. The data results adopt the relative quantification method, i.e., 2 -△△Ct method.

[0057] qRT-PCR results show that the expression of circVMP1 in renal tubular epithelial cells increases under HSA treatment ( Figure 1 D).

[0058] Example 2 Bio-conservatism analysis of circVMP1 between humans and mice

[0059] In order to detect the biological conservation of circVMP1 between humans and mice, the sequences of human and mouse circVMP1 were compared using the Blast database. The results showed that both were 440 nucleotides in length and had a homology of up to 91% ( Figure 2 A). Further construct a mouse model of hyperproteinuria nephropathy and collect urine, blood and kidney tissues from mice, the steps are as follows:

[0060] ① Adriamycin nephropathy model: Male BALB / c mice received a single tail vein injection of adriamycin (Sigma-Aldrich) at a dose of 10 mg / kg body weight, and urine, blood and kidney tissues were collected from the mice at 2, 6 and 8 weeks after injection. The control group mice received the same dose of normal saline injected into the tail vein.

[0061] ②Albumin high-load model: Female FVB / N mice underwent left nephrectomy at 12 weeks of age, and then low-endotoxin bovine serum albumin (Sigma-Aldrich) was intraperitoneally injected at a dose of 25 mg / g body weight for 5 consecutive days per week. The urine, blood and kidney tissue of the mice were collected at 4, 8 and 12 weeks after modeling. The mice in the control group received an intraperitoneal injection of the same dose of normal saline.

[0062] The expression of circVMP1 in the kidney tissues of the two mice was detected, and the results showed that the expression of circVMP1 was gradually upregulated after modeling ( Figure 2 B, 2C). At the same time, RNA fluorescence in situ hybridization (RNAFISH) was performed using Cy3-labeled RNA probes to detect the main expression location of circVMP1. The experimental steps are as follows:

[0063] Freshly prepared paraffin sections were used, and after dewaxing and rehydration, antigen repair and fixation, prehybridization, fluorescent probe hybridization, elution, nuclear counterstaining and other steps, the slides were fully washed and sealed with anti-fluorescence quenching mounting media, nail polish was sealed and fixed, and stored in the dark, observed and photographed under a fluorescence microscope. The experimental results further showed that circVMP1 was mainly expressed in the renal tubules, and highly overlapped with the LTL protein specifically expressed by the proximal tubular epithelial cells, indicating that circVMP1 was mainly located in the proximal tubular epithelial cells ( Figure 2 D).

[0064] The probe sequence for human circVMP1 is:

[0065] CTCTTGAGGAGCAGATAAAGCA(SEQ ID NO.9)

[0066] The probe sequence for mouse circVMP1 is:

[0067] CTCTGGAGGAGCAGATAAAGCA (SEQ ID NO.10).

[0068] Example 3: Knockdown of circVMP1 significantly reduces apoptosis of renal tubular epithelial cells

[0069] To study the effect of circVMP1 on renal tubular epithelial cells, specific siRNA targeting the circVMP1 circularization site was designed, with the sequence SEQ ID NO.3, specifically CTGCTTTATCTGCTCCTCATT (targeting the human circVMP1 sequence).

[0070] Specific siRNA targeting circVMP1 was transfected into HK2 cells, and flow cytometry was used to detect the effect of circVMP1 knockdown on apoptosis under HSA stimulation.

[0071] The results showed that knockdown of circVMP1 reduced apoptosis of renal tubular epithelial cells treated with HSA in vitro ( Figure 3 A&B).

[0072] Example 4: Knockdown of circVMP1 significantly alleviates renal tubular interstitial injury and renal fibrosis in adriamycin-induced nephropathy mice

[0073] To study the effect of in vivo intervention of circVMP1 on adriamycin-induced nephropathy mice. Two weeks before establishing the adriamycin-induced nephropathy model, AAV9 virus carrying sicircVMP1 was injected via the tail vein. At different time points, blood, urine, and kidney tissues of the mice were collected, and the serum creatinine level was detected using a creatinine assay kit (Nanjing Jiancheng Bioengineering Institute); PAS staining kit (Beijing Solarbio) was used to detect mouse kidney sections; Masson staining kit (Beijing Solarbio) was used to stain mouse kidneys to evaluate renal fibrosis and perform chronic renal interstitial fibrosis scoring, and the scoring details are shown in Table 1.

[0074] Table 1 Scoring details for the severity of renal interstitial fibrosis

[0075] Staining result Scoring result No renal interstitial fibrosis 0 <25% renal interstitial fibrosis 1 25 - 50% renal interstitial fibrosis 2 >50% renal interstitial fibrosis 3

[0076] The results showed that in vivo intervention of circVMP1 could effectively alleviate kidney injury in mice with chronic kidney disease proteinuria ( Figure 4 A), reduce renal fibrosis ( Figure 4 B), and protect renal function ( Figure 4 C).

[0077] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope recorded in this specification.

[0078] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. Use of circular RNA circVMP1 in the preparation of a product for predicting proteinuria renal injury in chronic kidney disease.

2. The application according to claim 1, wherein The sequence of circular RNA circVMP1 is as shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The application according to claim 1, wherein The product includes a reagent, a kit or a chip.

4. Use of circular RNA circVMP1 in the preparation of a drug for treating proteinuria renal injury in chronic kidney disease.

5. The application according to claim 4, wherein The drug includes a reagent that inhibits the expression level of RNA circVMP1.

6. The application according to claim 5, characterized in that, The reagent includes a small molecule compound, an antibody drug, a protein, a nucleic acid molecule, a polypeptide, a lipid, a carbohydrate or a combination thereof.

7. The application according to claim 5, wherein The reagent includes siRNA, and the sequence of the siRNA is: SEQ ID NO.3 or SEQ ID NO.

4.

8. Use of circular RNA circVMP1 as a target in screening drugs for preventing and treating proteinuria renal injury in chronic kidney disease.

9. A drug, characterized in that, It includes a substance that targets circular RNA circVMP1 and downregulates it, and the indication of the drug is proteinuria renal injury in chronic kidney disease.