Methylated biomarker combination for screening cervical cancer and precancerous lesions, kit and application

Abstract

The invention relates to the technical field of in-vitro diagnosis, and particularly discloses a methylated biomarker combination, a primer combination and a kit for screening cervical cancer and precancerous lesions and application of the methylated biomarker combination, the primer combination and the kit. According to the invention, a pyrosequencing technology is adopted, and methylation level detection is carried out on specific sites of human ZNF671, SOX1, JAM3, DLX1, HPV16-L1 and HPV18-L2; the methylation level of the cervical exfoliated cells is quantitatively evaluated, a host and virus gene combined methylation diagnosis panel is constructed, the methylation diagnosis panel can be used for screening high-risk people with precancerous lesions (CIN < 2 + >) in HPV16 and / or HPV18 positive patients, the detection sensitivity and accuracy are high, unnecessary colposcope referral treatment can be effectively reduced, and the application prospect is wide. The method has important clinical significance for optimizing the management process of HPV16 / 18 positive patients.

Description

Technical Field

[0001] The present invention relates to the field of in vitro diagnostic technologies, and particularly to a methylation biomarker, primer combination, kit and application for screening cervical cancer and precancerous lesions. Background Art

[0002] Cervical cancer is one of the most common malignant tumors in the female reproductive system, seriously threatening women's health. Most cases of cervical cancer are closely related to the infection of high-risk human papillomavirus (hr-HPV), especially HPV16 and HPV18. Currently, the primary screening of cervical lesions mainly relies on cytological examination and HPV-DNA detection. Although cytological examination is simple and effective, its sensitivity is low, subjectivity is strong, and it is prone to missed diagnosis or deviation of results. In contrast, HPV-DNA detection shows increasing advantages in primary screening due to its high sensitivity, objectivity and repeatability.

[0003] Currently, the domestic expert consensus recommends that all HPV16 / 18 positive patients do not need cytological examination and can be routinely referred for colposcopy, and there is no suggestion for rapid treatment. However, studies have shown that more than 90% of HPV16 / 18 infections are "transient" infections and can be automatically cleared within 2 years, and only less than 10% of women develop cervical intraepithelial neoplasia grade 2 / 3 (CIN2 / 3) or cervical cancer due to the conversion to a "persistent" infection state. Therefore, the low specificity and low positive predictive value of HPV-DNA detection may lead to unnecessary colposcopy referrals and potential over-treatment of low-grade lesions, thus increasing the burden on medical resources and causing patient anxiety.

[0004] DNA methylation, as an epigenetic modification that adds methyl groups to DNA, is one of the early and common events in many cancers. It does not change the DNA sequence and can be stably transmitted during cell division, thus providing a reliable target for clinical detection. Studies have found that in common hrHPV infections, host and HPV-DNA methylation are closely related to the occurrence and development of cervical cancer and precancerous lesions, and DNA methylation markers have important clinical significance in the early diagnosis of cervical cancer and the monitoring of the progression of precancerous lesions.

[0005] Therefore, it is very necessary and urgent to research and develop new DNA methylation-based biomarker combinations related to cervical cancer and precancerous lesions to perform more accurate risk stratification for HPV16 / 18 positive patients, so as to screen out high-risk populations, optimize the screening and management processes, reduce the colposcopy referral rate, and effectively reduce unnecessary medical interventions. Summary of the Invention

[0006] The object of the present invention is to provide a methylation biomarker, primer combination, kit and application for cervical cancer and precancerous lesion screening, so as to solve the problems raised in the above-mentioned background technology.

[0007] The present invention adopts pyrosequencing technology, which can detect the methylation of specific regions of host genes, HPV16-L1 and HPV18-L2. By incorporating the methylation of HPV16 and HPV18 viral DNA and performing combined detection of multi-gene methylation, the present invention can evaluate the relationship between HPV16 / 18 infection and the occurrence of cervical cancer and precancerous lesions, perform more accurate risk stratification on HPV16 / 18 positive patients, thereby screening out high-risk populations, optimizing the screening and management processes, and effectively reducing unnecessary medical interventions.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] In the first aspect, the present invention provides a methylation biomarker combination for cervical cancer and precancerous lesion screening, which is achieved by detecting the methylation status of methylation detection sites in the following gene target regions, including: nucleotide sequences within the target regions of one or more host genes of ZNF671, SOX1, JAM3, and DLX1; nucleotide sequences within at least one target region of the target gene HPV16-L1; nucleotide sequences within at least one target region of the target gene HPV18-L2;

[0010] Among them, 1) the host gene methylation detection sites are located in the target regions of the ZNF671, SOX1, JAM3, and DLX1 genes; the original nucleotide sequences of the target regions of the host genes ZNF671, SOX1, JAM3, and DLX1 are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4;

[0011] 2) the HPV16 gene methylation detection sites are respectively located in 3 target regions of HPV16-L1; the original nucleotide sequence of the target region of the target gene HPV16-L1 is one or more of SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7;

[0012] 3) the HPV18 gene methylation detection sites are respectively located in 3 target regions of HPV18-L2; the original nucleotide sequence of the target region of the target gene HPV18-L2 is one or more of SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0013] Second aspect, the present invention provides a primer combination for screening cervical cancer and precancerous lesions. The primer composition is designed based on the target sequence after bisulfite conversion, can be used for specific PCR amplification of the transformed target gene region, and is suitable for subsequent pyrosequencing detection to achieve quantitative analysis of methylation levels; the primer combination includes: PCR primers and pyrosequencing primer combinations for detecting methylation of the ZNF671 gene, PCR primers and pyrosequencing primer combinations for detecting methylation of the SOX1 gene, PCR primers and pyrosequencing primer combinations for detecting methylation of the JAM3 gene, PCR primers and pyrosequencing primer combinations for detecting methylation of the DLX1 gene, PCR primers and pyrosequencing primer combinations for detecting methylation of HPV16-L1, and PCR primers and pyrosequencing primer combinations for detecting methylation of HPV18-L2.

[0014] Specifically, the primer composition includes:

[0015] (1) Primer compositions for the target regions of host genes ZNF671, SOX1, JAM3, and DLX1, and the primer compositions are as shown in SEQ ID NOs. 11-22.

[0016] The PCR primers and pyrosequencing primer combination for detecting ZNF671 methylation include PCR amplification primers as shown in SEQ ID NO. 11 and SEQ ID NO. 12, and a pyrosequencing primer as shown in SEQ ID NO. 13;

[0017] The PCR primers and pyrosequencing primer combination for detecting SOX1 methylation include PCR amplification primers as shown in SEQ ID NO. 14 and SEQ ID NO. 15, and a pyrosequencing primer as shown in SEQ ID NO. 16;

[0018] The PCR primers and pyrosequencing primer combination for detecting JAM3 methylation include PCR amplification primers as shown in SEQ ID NO. 17 and SEQ ID NO. 18, and a pyrosequencing primer as shown in SEQ ID NO. 19;

[0019] The PCR primers and pyrosequencing primer combination for detecting DLX1 methylation include PCR amplification primers as shown in SEQ ID NO. 20 and SEQ ID NO. 21, and a pyrosequencing primer as shown in SEQ ID NO. 22.

[0020] (2) Primer compositions for the target region of the HPV16-L1 gene, and the primer compositions are as shown in SEQ ID NOs. 23-31.

[0021] The PCR primers and pyrosequencing primer combination for HPV16-L1 methylation detection, including the PCR amplification primers shown in SEQ ID NO.23 and SEQ ID NO.24, and the pyrosequencing primer shown in SEQ ID NO.25; the PCR amplification primers shown in SEQ ID NO.26 and SEQ ID NO.27, and the pyrosequencing primer shown in SEQ ID NO.28; the PCR amplification primers shown in SEQ ID NO.29 and SEQ ID NO.30, and the pyrosequencing primer shown in SEQ ID NO.31.

[0022] (3) A primer composition for the target region of the HPV18-L2 gene, and the primer composition is shown in SEQ ID NOs. 32-41.

[0023] The PCR primers and pyrosequencing primer combination for HPV18-L2 methylation detection, including the PCR amplification primers shown in SEQ ID NO.32 and SEQ ID NO.33, and the pyrosequencing primer shown in SEQ ID NO.34; the PCR amplification primers shown in SEQ ID NO.35 and SEQ ID NO.36, and the pyrosequencing primers shown in SEQ ID NO.37 and SEQ ID NO.38; the PCR amplification primers shown in SEQ ID NO.39 and SEQ ID NO.40, and the pyrosequencing primer shown in SEQ ID NO.41.

[0024] In a third aspect, the present invention provides a kit for screening cervical cancer and precancerous lesions, and the kit contains all or part of the primer compositions of the above methylation biomarker combination.

[0025] Specifically, the kit can select and adapt part or all of the methylation markers according to the detection requirements to meet different clinical requirements for screening cervical cancer and precancerous lesions.

[0026] Furthermore, the kit further includes nucleic acid extraction reagents, bisulfite conversion reagents, PCR amplification systems, single-strand purification reagents for PCR products, pyrosequencing reagents, and gene methylation detection methods.

[0027] Furthermore, the kit is based on PCR amplification and pyrosequencing technologies to quantitatively analyze the methylation level of samples.

[0028] In a fourth aspect, the present invention also provides a non-disease diagnosis and treatment detection method for screening cervical cancer and precancerous lesions, including the following steps:

[0029] (1) Collect human samples, extract the host and viral DNA in the samples, use a DNA extraction kit to extract DNA from the exfoliated cervical cells of patients, and measure the DNA concentration and OD260 / OD280. The OD260 / OD280 value is between 1.6 and 2.2;

[0030] (2) Use a bisulfite conversion reagent to perform bisulfite conversion on the DNA of the aforementioned extracted sample to be tested;

[0031] (3) Using the DNA in step (2) as a template, use the forward / reverse primer pair in the primer combination of the present invention and a specific reaction system to amplify different target gene fragments respectively, and obtain a PCR amplification product;

[0032] (4) Take the PCR amplification product in step (3) for agarose gel electrophoresis to detect whether the amplification is successful;

[0033] (5) If the amplification is successful in step (4), then perform single-strand purification;

[0034] (6) Use the pyrosequencing primer of the target gene to perform pyrosequencing on the single-strand purified product in step (5);

[0035] (7) According to the sequencing results in step (6), obtain the methylation level of each CpG site for further analysis and risk assessment.

[0036] In the fifth aspect, the present invention also provides an application of a primer combination for cervical cancer and precancerous lesion screening as described above in the preparation of a kit for cervical cancer and precancerous lesion screening. The kit can efficiently identify high-risk populations including CIN2+ and can be further used for dynamic monitoring of the progression of precancerous lesions and evaluation of treatment effects.

[0037] In the sixth aspect, the present invention also provides an application of a methylation biomarker combination for cervical cancer and precancerous lesion screening as described above in constructing a screening model for cervical cancer and precancerous lesions. The combination is used to construct a screening model for cervical cancer and precancerous lesions and perform risk assessment and stratification through this model; the combination is used to construct a methylation panel of host genes and HPV16 and HPV18 genes.

[0038] Further, the methylation biomarker combination constructs a combined detection panel, including methylation sites in the regions of host genes and HPV16 and / or HPV18 genes. The panel can be adjusted according to actual detection needs and supports the following detection modes:

[0039] (1) Detect the host gene and HPV16 region separately;

[0040] (2) Detect the host gene and the HPV18 region separately;

[0041] (3) Detect the host gene, the HPV16 and the HPV18 regions simultaneously.

[0042] Furthermore, the methylation biomarker combination can be used to screen high-risk populations for cervical cancer and precancerous lesions, and is applicable to the early screening and stratified assessment of high-risk populations, especially patients with cervical intraepithelial neoplasia grade 2 or above (CIN2+).

[0043] Compared with the prior art, the beneficial effects of the present invention are:

[0044] By incorporating a methylation biomarker combination of the HPV16 and / or HPV18 genes, the present invention can effectively identify high-risk populations for cervical cancer and its precancerous lesions (such as CIN2+) among HPV16 / HPV18 positive patients, avoiding over-treatment of low-grade lesions and reducing the anxiety and psychological burden of patients. In addition, the primer composition and kit of the present invention are designed based on the target sequences after bisulfite conversion, with high specificity. As the gold standard for methylation level detection, pyrosequencing can accurately quantify the methylation levels of host genes and HPV genes. The kit provided by the present invention is suitable for non-invasive screening, especially for further stratification of HPV16 / 18 positive patients, helping to optimize the management process of cervical cancer and its precancerous lesions, improving the screening efficiency and reducing the consumption of medical resources. In short, it provides a new strategy for the early diagnosis and grading management of cervical cancer. Description of the Drawings

[0045] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0046] Figure 1 It is a pyrosequencing result diagram of the methylation of the host gene ZNF671;

[0047] Figure 2 It is a diagram showing the difference in the methylation level of HPV16-L1 between CIN1- / CIN2+;

[0048] Figure 3 It is an ROC curve diagram of the panel constructed in Example 3 of the present invention. Detailed Embodiments

[0049] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.

[0050] Unless otherwise specified, the experimental methods used in the following embodiments are experimental methods without specific conditions noted in the embodiments, and usually follow conventional conditions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0051] The present invention provides a methylation biomarker combination for cervical cancer and precancerous lesion screening, which is achieved by detecting the methylation status of methylation detection sites in the following gene target regions, including: nucleotide sequences within the target regions of one or more host genes of ZNF671, SOX1, JAM3, and DLX1; nucleotide sequences within at least one target region of the target gene HPV16-L1; nucleotide sequences within at least one target region of the target gene HPV18-L2.

[0052] Among them, 1) the methylation detection sites of the host genes are located in the target regions of the ZNF671, SOX1, JAM3, and DLX1 genes; the original nucleotide sequences of the target regions of the host genes ZNF671, SOX1, JAM3, and DLX1 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4.

[0053] 2) The methylation detection sites of the HPV16 gene are respectively located in 3 target regions of HPV16-L1; the original nucleotide sequences of the target regions of the target gene HPV16-L1 are one or more of SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0054] 3) The methylation detection sites of the HPV18 gene are respectively located in 3 regions of HPV18-L2; the original nucleotide sequences of the target regions of the target gene HPV18-L2 are one or more of SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10.

[0055] Specifically,

[0056] In an embodiment of the present invention, the target region for methylation detection of the ZNF671 gene is defined by the original genomic DNA sequence without bisulfite conversion, which is used to identify a specific gene fragment, and the original nucleic acid sequence of the target region is shown in SEQ ID NO.1.

[0057] GGAGTCGGAGAAAGGGTGACTGAGGGCCCGGAGGACGCAGCACCCAC CCGCGCGGAGTCCGTTAGCTC CGCCATAGGACCGTGGGCGCGG ACAGCTGCCGGGAGCGGCAGGCGTCTCGATCGGGGACGCAGGCACTTCCGTCCCTGCAGAGCATCAGACGCGTCTCGGGACACTGGGGACAACATCTCCTCCGCGCTTTCCCAACACCTCCACCTGCGGCCCACACAAGCGTTACAGAACCCCGGCCAGGGACAGCCTGACAGAAACAAAATGT(SEQ ID NO.1)

[0058] In one embodiment of the present invention, the target region for detecting the methylation of the SOX1 gene is defined by the original genomic DNA sequence without bisulfite conversion, which is used to identify a specific gene fragment, and the original nucleic acid sequence of the target region is shown in SEQ ID NO.2.

[0059] GGCTTCCCCCGGGCACCTGGGACCAGCACA TGCCCAGCGCACGCGGCGCGCCGCCC TGCTAGAAGTTGCAGCCTCCGAGTTGGAGGC(SEQ ID NO.2)

[0060] In one embodiment of the present invention, the target region for detecting the methylation of the JAM3 gene is defined by the original genomic DNA sequence without bisulfite conversion, which is used to identify a specific gene fragment, and the original nucleic acid sequence of the target region is shown in SEQ ID NO.3.

[0061] AGGGTCCTGGCAGGCTGGGCGCATGCGCGCGGGGACTACAAGCCGCGCCGCGCTGCCGCTGGCCCCTCAGCAACCC TCGACATGGCGCTGAGGCGGCCACCGCGACTCCGGCTCTGCGCTCGGC TGCCTGACTTCTTCCTGCTGCTGCTTTTCAGGGGTGAGTTTGCGCGTTTCCGCTGTTGGGAGACTAGGGTCTGGGG(SEQ ID NO.3)

[0062] In one embodiment of the present invention, the target region for detecting the methylation of the DLX1 gene is defined by the original genomic DNA sequence without bisulfite conversion, which is used to identify a specific gene fragment, and the original nucleic acid sequence of the target region is shown in SEQ ID NO.4.

[0063] GCAGGAATGGCCCTTGGCAGACAGAGCGTGGGCCCTTGGATTCCTGTTCCTGAAGCGGGATGGAACTGCCGGCCGAACTGGAGCTCAACTCGCAAGCTTCAGTCCCGGCCAAGTAGGCCCTTGCTCTCAAATGCGCCCGTATCTCCTCTCTCTGGGACCCTCTCGGTTTCCAGAACAGCTGACGTTTGCGGCTCCTGCAGCGTGCAAGCGCGGGTCCCGATGCGAGAAGGGCCAGTCTGGGGAGGGGTCATTTT(SEQ ID NO.4)

[0064] In one embodiment of the present invention, the three target regions for HPV16-L1 gene methylation detection are defined by the original genomic DNA sequences that have not undergone bisulfite conversion, and are used to identify specific gene fragments. The original nucleic acid sequences of the target regions are shown in SEQ ID NO.5-7.

[0065] HPV16_1: AGGGTCTCCACAATATACAATTATTGCTGATGCAGGTGACTTTTATTTACATCCTAGTTATTACATG TTACGAAAACGACGTAAACG TTTACCATATTTTTTTTCAGATGTCTCTTTGGCTGCCTAGTGAGGCCACTGTCTACTTGCCT(SEQ ID NO.5)

[0066] HPV16_2: GGCCACAATAATGGCATTTGTTGGGGTAACCAACTATTTGTTACTGTTGTTGA TACTACA CGC AGTACAAATATGTCATTATGTGCTGCCATATCTACTTCAGAAACTACATATAAAAATACTAACTTTAAGGAGTACCTACGACATGGGGAGGAATATGATTTACAGTT(SEQ ID NO.6)

[0067] HPV16_3: AGCAGGATTGAAGGCCAAACCAAAATTTACATTAGGAAAACGAAAAGCTACACCCACCACCTCATCTACCTCTACAACTG CTAAACGCAAAAAACGTAAGCTGTAAGTATTGTATGTATGTTGAATTAGTGTTGTTTGTTGTGTATATGTTTGTATGTGCTTGTATGTGCTTGTAAATATTAAGTTGTATGTGTGTTTGTATGTATGGTATAATAAACACGTGTGTATGTGTTTTTAAATGCTTGTGTAACTATTGTGTCATGCAACATAAATAAACTTATTGTTTCAACACCTACTAATTGTGTTGTGGTTATTCATTGTATATAAACT(SEQ ID NO.7)

[0068] In one embodiment of the present invention, the three target regions for detecting the methylation of the HPV18-L2 gene are defined by the original genomic DNA sequence that has not been bisulfite-converted and are used to identify specific gene fragments. The original nucleic acid sequences of the target regions are shown in SEQ ID NOs. 8-10.

[0069] HPV18_1: GTATAGGTTGTTTTATACAGTGTATTGTACATTGTATATTTTGTTTTATACCTTTTATGCTTTTTGTATTTTTGTAATAAAAGTATGGTA TCCCACCGTGCCGCACGACG CAAACGGGCTTCGGTAACTGACTTATATAAAACATGTAAACAATCTGGTACATGTCCACCTGATGTTGTTCCTAAGGTGGA(SEQ ID NO.8)

[0070] HPV18_2: GTTGTTCCTAAGGTGGAGGGCACCACGTTAGCAGATAAAATATTGCAATGGTCAAGCCTTGGTATATTTTTGGGTGGACTTGGCATAGGTACTGGCAGTGGTACAGGGGGT CGTACAGGGTACATTCCATTGGGTG GGCG TTCCAATACAGTGGTGGATGTTGGTCCTACA CGTCCCCCA GTGGTTATTGAACCTGTGGGC(SEQ IDNO.9)

[0071] HPV18_3: TATATGCAGATGACATGGACCCTGCAGTGCCTGTACCAT CGCGTTCTACTACCTCCTTTGCATTTTTTAAATATTCGCCCACTATATCTTCTGCCTCTTCCTATAGTAATGTAACGGTCCCTTTAACCTCCTCTTGGGATGTGCCTGTATAC(SEQ ID NO.10).

[0072] Example 1

[0073] In this example, primers were designed for specific regions of the SOX1, JAM3, DLX1, ZNF671, HPV16-L1, and HPV18-L2 genes. For the HPV16-L1 and HPV18-L2 genes, three pairs of primers were designed for each of the three highly methylated differential regions. The amplification primers and pyrosequencing primers are as follows:

[0074] ZNF671:

[0075] Forward primer ZNF671-F: 5'-GGAGTAGGAGAAAGGGTGATTGA-3' (SEQ ID NO.11)

[0076] Reverse primer ZNF671-R: 5'-ACATTTTATTTCTATCAAACTATCCCTAAC-3' (SEQ ID NO.12)

[0077] Pyrosequencing primer ZNF671-S1: 5'-GTTAGGAGGAAGTAGTATTTAT-3' (SEQ ID NO.13)

[0078] SOX1:

[0079] Forward primer SOX1-F: 5'-GGTTTTTTTAGGGTATTTGGGATTAGTA-3' (SEQ ID NO.14)

[0080] Reverse primer SOX1-R: 5'-ACCTCCAACTCCAAAACTACAACTTCT-3' (SEQ ID NO.15)

[0081] Pyrosequencing primer SOX1-S: 5'-GGGTATTTGGGATTAGTATA-3' (SEQ ID NO.16)

[0082] JAM3:

[0083] Forward primer JAM3-F: 5'-AGGGTTTTGGTAGGTTGG-3' (SEQ ID NO.17)

[0084] Reverse primer JAM3-R: 5’-CCCCAAACCCTAATCTCCCA-3’ (SEQ ID NO.18)

[0085] Pyrosequencing primer JAM3-S: 5’-GTTGTAGTTGGTTTTTTAGTAATTT-3’ (SEQ ID NO.19)

[0086] DLX1:

[0087] Forward primer DLX1-F: 5’-GTAGGAATGGTTTTTGGTAGATAGAG-3’ (SEQ ID NO.20)

[0088] Reverse primer DLX1-R: 5’-AAAATAACCCCTCCCCAAACT-3’ (SEQ ID NO.21)

[0089] Pyrosequencing primer DLX1-S: 5’-GGGATTTTTTAGGTTTTTAGAATAG-3’ (SEQ ID NO.22)

[0090] HPV16-L1:

[0091] Forward primer HPV16_1-F: 5’-AGGGTTTTTATAATATATAATTATTGTTGA-3’ (SEQ ID NO.23)

[0092] Reverse primer HPV16_1-R: 5’-AAACAAATAAACAATAACCTCACTAAAC-3’ (SEQ ID NO.24)

[0093] Pyrosequencing primer HPV16_1-S: 5’-GATTTTTATTTATATTTTAGTTATTATATG-3’ (SEQ IDNO.25)

[0094] Forward primer HPV16_2-F: 5’-GGTTATAATAATGGTATTTGTTGGGGTAA-3’ (SEQ ID NO.26)

[0095] Reverse primer HPV16_2-R: 5’-AACTATAAATCATATTCCTCCCCATATC-3’ (SEQ ID NO.27)

[0096] Pyrosequencing primer HPV16_2-S: 5’-AATTATTTGTTATTGTTGTTGA-3’ (SEQ ID NO.28)

[0097] Forward primer HPV16_3-F: 5’-AGTAGGATTGAAGGTTAAATTAAAAT-3’ (SEQ ID NO.29)

[0098] Reverse primer HPV16_3-R: 5’-AATTTATATACAATAAATAACCACAACACA-3’ (SEQ ID NO.30)

[0099] Pyrosequencing primer HPV16_3-S: 5’-ATTATTTTATTTATTTTTATAATTG-3’ (SEQ ID NO.31)

[0100] HPV18-L2:

[0101] Forward primer HPV18_1-F: 5’-GTATAGGTTGTTTTATATAGTGTATTGT-3’ (SEQ ID NO.32)

[0102] Reverse primer HPV18_1-R: 5’-TCCACCTTAAAAACAACATCAAATAA-3’ (SEQ ID NO.33)

[0103] Pyrosequencing primer HPV18_1-S: 5’-TGTATTTTTGTAATAAAAGTATGGTA-3’ (SEQ IDNO.34)

[0104] Forward primer HPV18_2-F: 5’-GTTGTTTTTAAGGTGGAGGGTATTA-3’ (SEQ ID NO.35)

[0105] Reverse primer HPV18_2-R: 5’-ACCCACAAATTCAATAACCACTAAA-3’ (SEQ ID NO.36)

[0106] Pyrosequencing primer HPV18_2-S1: 5’-TTGGTAGTGGTATAGGGGGT-3’ (SEQ ID NO.37)

[0107] Pyrosequencing primer HPV18_2-S2: 5’-TGGTGGATGTTGGTTTTATA-3’ (SEQ ID NO.38)

[0108] Forward primer HPV18_3-F: 5’-TATATGTAGATGATATGGATTTTGTAGTGT-3’ (SEQ ID NO.39)

[0109] Reverse primer HPV18_3-R: 5’-ATATACAAACACATCCCAAAAAAAA-3’ (SEQ ID NO.40)

[0110] Pyrosequencing primer HPV18_3-S: 5’-TTTTGTAGTGTTTGTATTAT-3’ (SEQ ID NO.41)

[0111] The 5'-ends of the reverse primers are all biotin-labeled.

[0112] Example 2

[0113] Experimental specimens: Patients who were (1) positive for HPV16 and / or HPV18, (2) had undergone colposcopy and biopsy within the past 3 months, and (3) had an intact cervix were collected from the Clinical Pharmacy Department, Gynecology Department, and Clinical Laboratory of the General Hospital of the Eastern Theater Command. Cervical exfoliated cells were collected. Those with a pathological result of CIN2+ were selected as the precancerous lesion risk group, and those with a result of CIN1- were the control group.

[0114] Sample DNA extraction: DNA was extracted from the patients' cervical exfoliated cells using a DNA extraction kit. The specific experimental operations refer to the manufacturer's instructions. The DNA concentration and OD260 / OD280 were measured using a OneDrop TM spectrophotometer. The OD260 / OD280 value should be between 1.6 and 2.2.

[0115] DNA bisulfite conversion: The DNA of the aforementioned extracted test samples was subjected to bisulfite conversion using a bisulfite conversion kit. The specific experimental operations refer to the kit instructions.

[0116] Pyrosequencing template PCR amplification: Using the bisulfite-converted DNA as a template, PCR reaction systems were prepared respectively using the ZNF671, HPV16_1, and HPV18_1 gene methylation amplification primers in Example 1 for PCR amplification of the target genes to obtain amplification products. The PCR reaction system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0117] Table 1 PCR reaction system

[0118]

[0119] Table 2 PCR reaction conditions

[0120] Reaction steps ZNF671 HPV16_1 HPV18_1 Pre-denaturation for 3 min 95℃ 95℃ 95℃ Denaturation for 30 s 95℃ 95℃ 95℃ Annealing for 30 s 53℃ 53℃ 56℃ Extension for 30 s 72℃ 72℃ 72℃ Full extension for 7 min 72℃ 72℃ 72℃ Permanent storage ∞ 4℃ 4℃ 4℃ Number of cycles 40 45 45

[0121] Pyrosequencing: On the QIAGEN PyroMark Q24 platform in Germany, the amplified products obtained above were subjected to pyrosequencing using the ZNF671, HPV16_1, and HPV18_1 gene methylation pyrosequencing primers in Example 1, and the specific steps were carried out according to the instrument instruction manual. The instrument sequencing results are as Figure 1 shown. The methylation peaks of the ZNF671 gene in normal and high-grade lesion (CIN3) samples were significantly different, indicating that the pyrosequencing method can sensitively detect different methylation levels at different pathological grades. Figure 2 Describes the average methylation levels of the methylation detection sites CpG5602, 5608, 5611, and 5617 to be detected in the HPV16_1 target region in CIN1- and CIN2+ patients. Statistical analysis (P<0.0001) shows that there is a significant difference between the two, suggesting that the methylation level at this site can be used as a biomarker for the diagnosis of CIN2+.

[0122] Example 3

[0123] A total of 141 cervical exfoliated cell specimens were collected. Among them, 101 were positive for HPV16, including 45 normal cases, 19 cases of CIN1, 10 cases of CIN2, 16 cases of CIN3, and 11 cases of cancer; 40 were positive for HPV18, including 24 normal cases, 3 cases of CIN1, 4 cases of CIN2, 4 cases of CIN3, and 5 cases of cancer. All specimens were subjected to methylation detection of the SOX1, JAM3, DLX1, ZNF671, HPV16-L1, and HPV18-L2 genes according to the present invention (the primers were the same as in Example 1, and the specific detection process was the same as in Example 2) to obtain the methylation status of multiple sites, and the average values of the pyrosequencing results of different genes and fragments were taken for statistical analysis.

[0124] Indicators such as the age of the patients were collected, and the patients were divided into a high-risk group CIN2+ and a low-risk group CIN1- according to the pathological grade. Subsequently, the patients were randomly divided into a training set and a test set at a ratio of 8:2. Among them, there were 73 cases of CIN1- and 40 cases of CIN2+ in the training set, and 18 cases of CIN1- and 10 cases of CIN2+ in the test set. As can be seen from Table 3, there were no significant differences in the sample characteristics between the training set and the test set statistically.

[0125] Table 3 Sample characteristics of the training set and the test set

[0126] Variable Total (N = 141) Test set (N = 28) Training set (N = 113) P value Age 45.00[34.00,52.00] 43.18±11.49 45.00[34.00,51.00] 0.955 Pathological grade (%) 0.588 Normal / Inflammation 69(48.94) 13(46.43) 56(49.56) CIN1 22(15.60) 5(17.86) 17(15.04) CIN2 14(9.93) 3(10.71) 11(9.73) CIN3 / AIS 20(14.18) 2(7.14) 18(15.93) SCC / ADC 16(11.35) 5(17.86) 11(9.73) HPV type (%) 0.659 HPV16 101(71.63) 21(75.0) 80(70.80) HPV18 40(28.37) 7(25.0) 33(29.20) Methylation marker (%) SOX1 6.30[4.5,10.60] 5.33[4.53,10.13] 6.50[4.43,10.66] 0.458 JAM3 3.36[2.68,5.27] 3.09[2.54,4.41] 3.51[2.70,5.36] 0.293 ZNF671 4.36[3.59,7.20] 4.30[3.35,7.16] 4.44[3.62,7.84] 0.465 DLX1 9.69[8.03,13.17] 9.46[7.76,13.81] 9.69[8.14,13.17] 0.613 HPV16_1 9.46[3.83,22.37] 16.53[3.80,40.39] 8.61[3.78,21.34] 0.382 HPV16_2 10.14[5.85,22.66] 12.74[5.26,31.05] 9.93[5.97,21.82] 0.566 HPV16_3 6.12[4.65,12.26] 6.29[3.98,17.55] 6.12[4.71,11.81] 0.776 HPV18_1 8.03[5.25,29.62] 7.83[3.02,15.15] 8.07[5.81,36.23] 0.319 HPV18_2 7.86[4.70,17.60] 10.76[3.68,43.23] 7.15[4.79,16.89] 0.656 HPV18_3 25.63[14.05,55.16] 32.81±29.09 25.22[14.06,61.76] 0.817 outcome (%) 0.975 CIN1- 91(64.54) 18(64.29) 73(64.60) CIN2+ 50(35.46) 10(35.71) 40(35.40)

[0127] Through logistic regression analysis based on lasso screening of the average methylation levels of the above genes, draw Figure 3For the ROC curve, the methylation panel incorporating the ZNF671, HPV16_1, and HPV18_1 loci demonstrated good diagnostic performance for CIN2+, with an AUC of 0.865 (95% CI: 0.784 - 0.945), and this diagnostic ability was verified in the test set samples. The sensitivity and specificity of this methylation panel were 80.0% and 86.3% respectively. In the analysis of the training set data, compared with the current standard process of directly referring based on HPV16 / 18 positivity, the methylation panel could reduce unnecessary referrals by 62.83%. This indicates that while screening for CIN2+, the methylation panel can effectively reduce unnecessary colposcopies, optimize the allocation of medical resources, and alleviate the psychological and economic burden on patients.

[0128] This embodiment provides a methylation panel based on the combination of host genes and viral genes, which significantly improves the early screening ability for cervical cancer and precancerous lesions, and particularly demonstrates excellent triage performance in the HPV16 / 18 positive population. This panel is not only applicable to the stratified diagnosis of high-risk populations, but also can be used for subsequent follow-up management and treatment effect evaluation, providing a potential clinical tool for cervical cancer screening strategies.

[0129] It should be noted that in this article, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or elements inherent to such process, method, article or device.

[0130] It should be noted that the above content only illustrates the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. For those of ordinary skill in the art in this technical field, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements all fall within the protection scope of the claims of the present invention.

Claims

1. A methylation biomarker panel for cervical cancer and pre-cancerous lesion screening, characterized in that, Comprising: 1) Nucleotide sequences within the target regions of one or more host genes among ZNF671, SOX1, JAM3, and DLX1; 2) target genes Nucleotide sequences within at least one target region of HPV16-L1; 3) nucleotide sequences within at least one target region of the target gene HPV18-L2; Among them, the original nucleotide sequences of the target regions of the host genes ZNF671, SOX1, JAM3, and DLX1 are as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4; The original nucleotide sequences of the target regions of the HPV16-L1 gene are one or more of SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7; The original nucleotide sequences of the target regions of the HPV18-L2 gene are one or more of SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.

10.

2. A primer combination for screening cervical cancer and precancerous lesions, characterized in that, Comprising: PCR primer and pyrosequencing primer combinations for detecting the methylation of the ZNF671 gene, PCR primer and pyrosequencing primer combinations for detecting the methylation of the SOX1 gene, PCR primers and pyrosequencing primer combinations for detecting the methylation of the JAM3 gene, PCR primers and pyrosequencing primer combinations for detecting the methylation of the DLX1 gene, PCR primer and pyrosequencing primer combinations for detecting the methylation of HPV16-L1, and PCR primer and pyrosequencing primer combinations for detecting the methylation of HPV18-L2; The PCR primer and pyrosequencing primer combination for detecting the methylation of ZNF671 includes PCR amplification primers as shown in SEQ ID NO.11 and SEQ ID NO.12, and a pyrosequencing primer as shown in SEQ ID NO.13; The PCR primer and pyrosequencing primer combination for detecting the methylation of SOX1 includes PCR amplification primers as shown in SEQ ID NO.14 and SEQ ID NO.15, and a pyrosequencing primer as shown in SEQ ID NO.16; The PCR primer and pyrosequencing primer combination for detecting the methylation of JAM3 includes PCR amplification primers as shown in SEQ ID NO.17 and SEQ ID NO.18, and a pyrosequencing primer as shown in SEQ ID NO.19; The PCR primer and pyrosequencing primer combination for detecting the methylation of DLX1 includes PCR amplification primers as shown in SEQ ID NO.20 and SEQ ID NO.21, and a pyrosequencing primer as shown in SEQ ID NO.22; PCR primers and pyrosequencing primer combinations for HPV16-L1 methylation detection, including PCR amplification primers shown in SEQ ID NO.23 and SEQ ID NO.24, and pyrosequencing primers shown in SEQ ID NO.25; PCR amplification primers shown in SEQ ID NO.26 and SEQ ID NO.27, and pyrosequencing primers shown in SEQ ID NO.28; PCR amplification primers shown in SEQ ID NO.29 and SEQ ID NO.30, and pyrosequencing primers shown in SEQ ID NO.

31. PCR primers and pyrosequencing primer combinations for HPV18-L2 methylation detection, including PCR amplification primers shown in SEQ ID NO.32 and SEQ ID NO.33, and pyrosequencing primers shown in SEQ ID NO.34; PCR amplification primers shown in SEQ ID NO.35 and SEQ ID NO.36, and pyrosequencing primers shown in SEQ ID NO.37 and SEQ ID NO.38; PCR amplification primers shown in SEQ ID NO.39 and SEQ ID NO.40, and pyrosequencing primers shown in SEQ ID NO.

41.

3. A kit for screening cervical cancer and precancerous lesions, characterized in that, One or more of the primer combinations as described in claim 2.

4. A kit for screening cervical cancer and precancerous lesions according to claim 3, characterized in that, The kit further includes nucleic acid extraction reagents, bisulfite conversion reagents, PCR amplification systems, single-strand purification reagents for PCR products, and pyrosequencing reagents.

5. A non-disease diagnosis and treatment detection method for cervical cancer and precancerous lesions, characterized in that, Including the following steps: (1) Extract DNA from the patient's cervical exfoliated cells using a DNA extraction kit, and measure the DNA concentration and OD260 / OD280, where the OD260 / OD280 value is between 1.6 and 2.

2. (2) Use bisulfite conversion reagents to perform bisulfite conversion on the DNA of the aforementioned extracted sample to be tested. (3) Use the corresponding forward and reverse primers to perform PCR amplification on the bisulfite-converted DNA. (4) Use pyrosequencing technology to detect the methylation level of the PCR amplification product obtained in (3).

6. The non-disease diagnosis and treatment detection method for cervical cancer and precancerous lesions screening according to claim 5, characterized in that, In step (3), the corresponding forward and reverse primers are one or more of the primer combinations as described in claim 2.

7. Use of a primer combination for cervical cancer and precancerous lesion screening as described in claim 2 in the preparation of a kit for cervical cancer and precancerous lesion screening.

8. Use of a primer combination for cervical cancer and precancerous lesion screening as described in claim 2 in the construction of a screening model for cervical cancer and precancerous lesions.

Images