Nucleic acid adjuvant

Abstract

The invention relates to a nucleic acid adjuvant with excellent stability. Specifically, the present invention relates to: a nucleic acid comprising a sense strand represented by SEQ ID NO: 4 and an antisense strand represented by SEQ ID NO: 5; an adjuvant composition containing the nucleic acid; and a pharmaceutical composition for treating or preventing cancer or infectious diseases, which contains the nucleic acid.

Description

Technical Field

[0001] Related Applications:

[0002] This application claims priority based on Japanese Patent Application No. 2022-193945 (filed on December 5, 2022), the content of which is incorporated herein by reference. Technical Field

[0003] The present invention relates to a nucleic acid composed of a single-stranded oligodeoxynucleotide and double-stranded RNA, and an adjuvant composition or a pharmaceutical composition containing the above nucleic acid. Background Art

[0004] Activation of Toll-like receptor (TLR) elicits a natural immune response in dendritic cells, inducing cytokine production and activation of cellular immunity. Double-stranded RNAs such as poly(I:C) are TLR3 ligands and exhibit strong anti-cancer effects, and thus are considered promising as vaccine adjuvants. However, they have been abandoned for clinical use due to side effects such as inflammation and cytokineemia.

[0005] It is known that diRNA (defective interference RNA) derived from measles virus has an adjuvant function (Patent Document 1). The inventors reported that a nucleic acid in which an oligodeoxynucleotide (GpC ODN) containing a GpC dinucleotide that is delivered to the endosome of dendritic cells is linked to a double-stranded RNA having the sequence of the above diRNA can reach TLR3 on the endosome and has strong adjuvant activity (Patent Documents 2-4). This adjuvant nucleic acid does not induce excessive production of inflammatory cytokines and induces NK / CTL-dependent anti-cancer activity in a mouse transplanted cancer model (Non-Patent Document 2). Therefore, as a non-inflammatory nucleic acid adjuvant with few side effects, it can be expected to be used for cancer vaccines and infectious disease vaccines.

[0006] In order to provide this nucleic acid adjuvant as a drug, it is necessary to manufacture the nucleic acid by chemical synthesis in accordance with GMP standards. In order to have high adjuvant activity, it is desirable that the double-stranded RNA part has a length of about 100 bases (Patent Document 4). However, long-chain nucleic acids exceeding 100 bases are not easily synthesized, and generally, the longer they are, the more time and cost are required for synthesis. On the other hand, it is known that nucleic acids form unwanted complexes through local hydrogen bonds and the like in solution, which may cause changes in the quality and characteristics of nucleic acid drugs.

[0007] Prior Art Documents

[0008] Patent Documents

[0009] Patent Document 1: WO2008 / 065752

[0010] Patent Document 2: WO2012 / 014945

[0011] Patent Document 3: WO2016 / 088784

[0012] Patent Document 4: WO2018 / 021400

[0013] Non - Patent Literature

[0014] Non - Patent Literature 1: Itoh et al., The Journal of Immunology, 2008, vol.181,No.8, pp5522 - 5529

[0015] Non - Patent Literature 2: Matsumoto et al., Nature Communications, 2015, 6:6280

[0016] Non - Patent Literature 3: Takeda et al., Cell Rep. 2017, 19(9):1874 - 1887 Summary of the Invention

[0017] Problems to be Solved by the Invention

[0018] The main problem of the present invention is to provide a nucleic acid adjuvant with safety, effectiveness, and stability suitable for practical use.

[0019] Method for Solving the Problem

[0020] When the inventors were studying the practical application of a nucleic acid (hereinafter collectively referred to as "ARNAX") in which a GpC ODN is linked to a double - stranded RNA having a sequence of diRNA derived from the measles virus, they found that ARNAX with a specific sequence showed excellent stability compared to ARNAX of the same length.

[0021] The present invention has been completed based on the above - mentioned findings, and relates to a nucleic acid formed by linking a double - stranded RNA shown in SEQ ID NO: 3 to a single - stranded oligodeoxynucleotide (ODN) that is delivered to the endosome of dendritic cells, for example, a single - stranded oligodeoxynucleotide containing GpC dinucleotide (GpC ODN). Specifically, the present invention relates to the following [1] to

[13] .

[0022] [1] A nucleic acid formed by linking a double - stranded RNA shown in SEQ ID NO: 3 to a single - stranded oligodeoxynucleotide shown in SEQ ID NO: 2.

[0023] In particular, a nucleic acid composed of a sense strand shown in SEQ ID NO: 4 and an antisense strand shown in SEQ ID NO: 5.

[0024] [2] The nucleic acid according to [1], wherein at least a part of the nucleotides of the single-stranded oligodeoxynucleotide constituting the sense strand is phosphorothioate-modified.

[0025] [3] An adjuvant composition comprising the nucleic acid according to [1] or [2].

[0026] [4] A pharmaceutical composition comprising the nucleic acid according to [1] or [2].

[0027] [5] The pharmaceutical composition according to [4], which is used in combination with radiotherapy.

[0028] [6] The pharmaceutical composition according to [4], which is used in combination with a cancer or infectious disease therapeutic agent, preferably an immune checkpoint inhibitor, more preferably an anti-PD-1 antibody or an anti-PD-L1 antibody.

[0029] [7] The pharmaceutical composition according to any one of [4] to [6], which further contains an antigen, such as an antigen selected from cancer antigens, bacterial antigens, protozoan antigens, and viral antigens.

[0030] [8] The pharmaceutical composition according to any one of [4] to [7], which is used for treating or preventing cancer or infectious diseases.

[0031] [9] A method for treating or preventing cancer or infectious diseases, which comprises the step of administering the nucleic acid according to [1] or [2] to a subject.

[0032]

[10] The method according to [9], which is used in combination with radiotherapy.

[0033]

[11] The method according to [9], which is used in combination with other cancer or infectious disease therapeutic agents, preferably an immune checkpoint inhibitor, more preferably an anti-PD-1 antibody or an anti-PD-L1 antibody.

[0034]

[12] The method according to [9] to

[11] , which comprises the step of administering an antigen, such as an antigen selected from cancer antigens, bacterial antigens, protozoan antigens, and viral antigens, to the subject.

[0035]

[13] Use of the nucleic acid according to [1] or [2] in the manufacture of a pharmaceutical composition for treating or preventing cancer or infectious diseases.

[0036]

[14] The use according to

[13] , wherein the pharmaceutical composition is used in combination with radiotherapy.

[0037]

[15] The use according to

[13] , wherein it is used in combination with other cancer or infectious disease therapeutic agents, preferably an immune checkpoint inhibitor, more preferably an anti-PD-1 antibody or an anti-PD-L1 antibody.

[0038]

[16] In the application according to

[13] to

[15] , the pharmaceutical composition further contains an antigen, such as an antigen selected from cancer antigens, bacterial antigens, protozoan antigens, and viral antigens.

[0039] In the present invention, as other embodiments, the following [1] to [9] are also provided.

[0040] [1] A nucleic acid, which is composed of a double-stranded RNA shown in SEQ ID NO: 3 linked to a single-stranded oligodeoxynucleotide (GpC ODN) containing GpC dinucleotides, preferably 15 to 28 bases long, more preferably 20 to 28 bases long, further preferably 24 to 26 bases long, for example, 25 bases long.

[0041] [2] The nucleic acid according to [1], wherein the GpC ODN is a 20 to 28-base-long, preferably 24 to 26-base-long ODN containing the single-stranded oligodeoxynucleotide (ODN) shown in SEQ ID NO: 2 or a continuous part of 20 bases or more thereof (for example, 20 bases or more in a row of SEQ ID NO: 2, preferably 23 bases or more, more preferably 24 bases or more).

[0042] [3] The nucleic acid according to [1] or [2], wherein the single-stranded ODN and the double-stranded RNA are linked by a linker.

[0043] [4] The nucleic acid according to [1] or [2], wherein the single-stranded ODN and the double-stranded RNA are directly linked.

[0044] [5] The nucleic acid according to any one of [1] to [4], which has been lyophilized.

[0045] [6] The nucleic acid according to [5], which is stable at -20 °C for 12 months.

[0046] [7] The nucleic acid according to [5] or [6], wherein after being stored at -30 °C for 12 months, the TLR3-mediated IFNβ activation ability does not decrease.

[0047] [8] An adjuvant composition, which contains the nucleic acid according to any one of [1] to [7].

[0048] [9] A pharmaceutical composition, which contains the nucleic acid according to any one of [1] to [7].

[0049] Advantages of the Invention

[0050] The nucleic acid of the present invention has high stability and is easy to store and handle. The nucleic acid of the present invention does not induce the production of systemic inflammatory cytokines, specifically activates TLR3 and induces NK and CTL. Therefore, it is useful for preventing or treating cancer and infectious diseases alone or in combination with other drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Showing ARNAX120 (17-136) and ARNAX120 (1-120) structures.

[0052] Figure 2 Showing ARNAX120 (17-136) Results of SEC-HPLC of lyophilized products (A: before freezing (initial), B: stored frozen for 1 month, C: repeatedly frozen and thawed).

[0053] Figure 3 Showing ARNAX120 (1-120) Results of SEC-HPLC of lyophilized products (A: before freezing (initial), B: stored frozen for 3 months, C: stored frozen for 6 months, D: stored frozen for 12 months).

[0054] Figure 4 Showing ARNAX120 (17-136) and ARNAX120 (1-120) Results of Tm value measurement.

[0055] Figure 5 Showing ARNAX120 (17-136) luciferase activity (TLR3-mediated IFNβ activation ability). From left to right are (PBS (unstimulated), ARNAX120 (17-136) frozen and thawed product (10 μg / mL), ARNAX120 (17-136) non-frozen and thawed product (10 μg / mL)) □: control plasmid + -125-luc reporter, ■: HEK293 / TLR3 plasmid + -125-luc reporter.

[0056] Figure 6 Showing ARNAX120 (1-120) luciferase activity (TLR3-mediated IFNβ activation ability). A: immediately after dissolution (initial), B: frozen and thawed (from left to right are PBS (unstimulated), ARNAX120 (1-120) (1, 5, 10 μg / mL) dissolved in water, ARNAX120 (1-120)(1, 5, 10 μg / mL)) □: Control plasmid + -125-luc reporter gene, ■: HEK293 / TLR3 plasmid + -125-luc reporter gene.

[0057] Figure 7 Show ARNAX120 (1-120) Luciferase activity (TLR3-mediated IFNβ activation ability) after cryopreservation at -30°C (0 (initial), 6, 9, 12 months). □: Control plasmid + -125-luc reporter gene, ■: HEK293 / TLR3 plasmid + -125-luc reporter gene.

[0058] Figure 8 Show ARNAX120 (1-120) Tumor regression effect brought about. Left: Average tumor volume, Right: Individual tumor volume.

[0059] Figure 9 Show ARNAX120 (1-120) CTL induction in tumor (left) and spleen (right). ARNAX of tumor (1-120) In the ARNAX + OVA group, 1 completely regressed, so n = 3.

[0060] Figure 10 Show the result of verifying the influence of freeze-thaw on the tumor regression effect of ARNAX120 (1-120) Left: Average tumor volume, Right: Survival rate. All are 〇: PBS (control), △: ARNAX120 (1-120) Without freeze-thaw, □: ARNAX120 (1-120) With freeze-thaw.

[0061] Figure 11 Show ARNAX120 (1-120) Abscopal effect brought about. Left: Tumor volume at the treatment site (radiation-irradiated site), Center: Tumor volume at the abscopal site (non-radiation-irradiated site), Right: Survival rate. All are 〇: Non-irradiated / PBS, △: Irradiated / PBS, □: Irradiated / ARNAX120 (1-120) .

[0062] Figure 12 Show ARNAX120 (1-120) Cytokine induction (IL-6, TNF-α, IL-12p40, IP-10) caused by subcutaneous administration of ARNAX120. In the figure, the amount of cytokines in serum (pg / ml) at 3 hours and 6 hours later, all are from left to right saline, poly(I:C) (PolyI:C), ARNAX120 (1-120) (ARNAX).

[0063] Figure 13 Show ARNAX120 (1-120) Cytokine induction (IL-6, TNF-α, IL-12p40, IP-10) caused by intraperitoneal administration of. In the figure, the cytokine amounts (pg / ml) in serum after 3 hours and 6 hours are, from left to right, saline, poly(I:C) (PolyI:C), ARNAX120 (1-120) (ARNAX). Detailed implementation mode

[0064] 1. Nucleic acid (ARNAX) of the present invention

[0065] The nucleic acid (ARNAX) with adjuvant activity of the present invention is composed of double-stranded RNA based on diRNA from measles virus and single-stranded oligodeoxynucleotide (single-stranded ODN) delivered to endosomes. The present invention relates to ARNAX120 in the above ARNAX, especially containing double-stranded RNA composed of 120 bases long from positions 1 to 120 of SEQ ID NO: 1 (1-120) .

[0066] (1) Double-stranded RNA

[0067] Double-stranded RNA from microorganisms is known to activate innate immunity as a ligand for TLR3. In the case of artificially synthesized double-stranded RNA, the same phenomenon can also be observed (Matsumoto M., and T. Seya. 2008. TLR3: Interferon induction by double-stranded RNA including poly(I:C). Adv. Drug Del. Rev. 60: 805-812.). TLR is a type I membrane protein that recognizes components from viruses and bacteria and triggers a biological defense response. TLR3 is a member of the TLR family, and uses extracellular double-stranded RNA as a ligand to induce diverse cellular responses via TICAM-1. TLR3 is locally present in endosomes in myeloid dendritic cells, and is locally present on the cell surface and in endosomes in a part of epithelial cells and macrophages. In any cell, the signal mediated by TLR3 is transmitted from endosomes, so it is necessary to make double-stranded RNA enter the cell

[0068] Double-stranded RNA from microorganisms does not act on human genes, so it has also been studied to be used as a vaccine adjuvant by controlling innate immunity as a TLR3 ligand. The "double-stranded RNA" used in the present invention is such an exogenous double-stranded RNA that does not affect human endogenous genes and activates TLR3 and innate immunity

[0069] DiRNA (SEQ ID NO: 1) derived from the attenuated measles virus strain Edmonston (ED) has been included in vaccines (Shingai et al., J Immunol. 2007; 179: 6123-6133), and its safety for humans has been established. The inventors found that the diRNA derived from this ED strain has adjuvant functions (Itoh et al., The Journal of Immunology, 2008; Matsumoto et al., Nat. Commun. 2015). By linking double-stranded RNAs 59 bases to 140 bases in length prepared based on this to the single-stranded ODN described below, it was efficiently delivered to endosomes, and it was confirmed that it inactivated RIG-I and MDA5, which are intracellular RNA sensors, and only activated TLR3, showing a tumor regression effect (WO2012 / 014945, WO2016 / 088784). Since this double-stranded RNA specifically activates TLR3, there is no worry about inducing systemic inflammatory cytokines, and it is excellent as a vaccine adjuvant.

[0070] Regarding the length of the "double-stranded RNA", it is preferably about 50 base pairs or more for TLR3 activation ability, and preferably about 100 bases or more, and as much as about 120 bases or more for bringing about effective tumor regression. However, currently, nucleic acids longer than 100 bases are not easily synthesized. Therefore, from the viewpoint of synthesis, it is more advantageous for the nucleic acid to be short.

[0071] It is known that the GC content affects thermal stability. The inventors prepared various double-stranded RNAs containing the GC-rich region of SEQ ID NO: 1 and confirmed their activities. In addition, it was confirmed that nucleic acids containing 58 or more consecutive bases in the base sequence of positions 1 to 140 of SEQ ID NO: 1 have immune activation activity, but the GC content is not necessarily related to the activity of ARNAX. (For forming a stem-loop, the base sequence of positions 1 to 140 of the diRNA of the ED strain forms a complementary strand with the sequence shown at positions 1017 to 1074.)

[0072] From the aspect of synthesis efficiency, it is preferable to use the AU-rich region in SEQ ID NO: 1. Examples of such AU-rich regions include positions 17 to 78, positions 101 to 164, and positions 216 to 269 of SEQ ID NO: 1. The inventors reported that double-stranded RNAs containing 40 bases in the 17-56 position of SEQ ID NO: 1, which is an AU-rich region, especially double-stranded RNAs 100 to 160 bases in length, preferably 110 to 150 bases in length, and more preferably 120 to 140 bases in length, containing the consecutive 17-56 position of SEQ ID NO: 1 show appropriate adjuvant activity and tumor regression effect (as described above).

[0073] As described above, in the practical application of ARNAX, various aspects such as activity, synthesis efficiency, and thermal stability need to be considered. The inventors previously reported ARNAX120 containing a double-stranded RNA composed of 120 bases at positions 17 to 136 of SEQ ID NO: 1 (17-136) as a nucleic acid adjuvant suitable from the viewpoints of synthesis efficiency and activity (WO2018 / 021400). However, it was found that this ARNAX120 (17-136) aggregates during storage.

[0074] ARNAX120 containing a double-stranded RNA composed of 120 bases at positions 1 to 120 of SEQ ID NO: 1 (1-120) has the same length, GC content (thermal stability), AU-rich region contained (synthesis efficiency), and sequence of the single-stranded RNA portion as ARNAX120 (17-136) but, different from ARNAX120 (17-136) does not aggregate during cryopreservation and shows excellent storage stability. ARNAX120 (1-120) also shows excellent adjuvant activity and tumor regression effect after cryopreservation, and thus is suitable for practical application as a drug.

[0075] (2) Single-stranded oligodeoxynucleotide (single-stranded ODN)

[0076] TLR9 recognizes the unmethylated CpG motif of viral DNA and bacterial DNA. Signal transduction mediated by TLR9 can be efficiently carried out by short synthetic oligodeoxynucleotides (ODNs). These ODNs contain CpG motifs unique to the genes of bacteria and viruses and are known as "CpG ODNs" in this field. It is known that CpG ODNs are delivered to the endosomes of dendritic cells and act as TLR9 ligands, and thus are useful as strong vaccine adjuvants and antibody production enhancers. On the other hand, CpG ODNs strongly induce MyD88-dependent cytokines (especially IFNα) and cause a Th2 response.

[0077] In CpG ODNs, ODNs in which CpG is replaced with GpC, TpC, or CpC are delivered to endosomes. However, they do not have TLR9 agonist activity and thus do not induce unnecessary immune responses. In ARNAX, such ODNs without TLR9 agonist activity are used as single-stranded ODNs.

[0078] GpC ODNs without TLR9 agonist activity are commercially available as controls for CpG ODNs (because they do not have TLR9 agonist activity) (http: / / www.invivogen.com / tlr9-agonist), and these ODNs can also be used as single-stranded ODNs in the synthesis of ARNAX.

[0079] From the viewpoint of the delivery function to endosomes, the single-stranded ODN is preferably 15 bases or more in length, particularly 15 to 28 bases in length, such as 20 to 28 bases in length or 24 to 26 bases in length. In the present invention, the 25-base-long GpC ODN shown below is used as the single-stranded ODN.

[0080] GpC ODN: tgctgctgcttgcaagcagcttgat (SEQ ID NO: 2)

[0081] From the viewpoint of stability (nuclease resistance), the single-stranded nucleotides constituting the GpC ODN are preferably modified. Examples of such modification include phosphorothioate modification. By performing phosphorothioate modification, the single-stranded ODN is not decomposed by nucleases, and nucleic acids can be efficiently delivered to endosomes.

[0082] 2. Synthesis of ARNAX

[0083] ARNAX is composed of the above-mentioned "double-stranded RNA" and "single-stranded ODN". The double-stranded RNA and the single-stranded ODN can be directly linked or linked via a suitable linker. ARNAX120 (1-120) does not contain a linker, but a suitable linker can also be inserted within the scope that does not impair the object of the present invention.

[0084] ARNAX can be synthesized in the form of a nucleic acid composed of a single-stranded nucleic acid A (a chimeric nucleic acid of the "single-stranded ODN" and the sense strand of the "double-stranded RNA") and a single-stranded nucleic acid B (the antisense strand of the "double-stranded RNA"). Each single-stranded nucleic acid (sense strand, antisense strand) can be synthesized, for example, by synthesizing partial sequences according to the method described in the above-mentioned WO2016 / 088784 and sequentially linking them. Of course, it is not limited to the above method, and it can also be synthesized by linking double-stranded RNA to a single-stranded ODN according to a method well known in the art.

[0085] Each single-stranded nucleic acid forming ARNAX preferably does not have a phosphate group bound to either end. This is because when a phosphate group remains at the 5' end, activation of the RIG-I pathway in the cytoplasm and induction of a large amount of cytokine production by in vivo administration in large amounts cause side effects (Robinson et al. J Natl Cancer Inst. 1976 Sep;57(3):599-602). Although a 3'-phosphate is added to the 5' end of the RNA strand synthesized by in vitro transcription, the nucleic acids of the present invention can be produced by chemical synthesis, and thus can be synthesized in the form of nucleic acids that do not have a phosphate group bound to either the 5' end or the 3' end.

[0086] 3. Preservation of ARNAX

[0087] The synthesized ARNAX can be lyophilized and stored frozen until use. ARNAX120 (1-120) The frozen storage product is stable at least for 1 year at -20°C or lower.

[0088] In one embodiment, ARNAX (1-120) is dissolved in water (distilled water for injection) or physiological saline for storage and dissolved in 1xPBS solution for use when needed. After such freeze-thawing, ARNAX120 (1-120) is also stable and does not lose its adjuvant activity or anti-tumor activity. In addition to water and physiological saline, ARNAX120 (1-120) can be dissolved in buffers commonly used for drugs such as phosphate buffer for storage. The pH of the solution (buffer) is preferably near neutral.

[0089] AARNAX (1-120) is stable for 2 days in phosphate buffer at no more than 30°C, and thus is applicable to room temperature (1 - 30°C) and normal temperature (15 - 25°C).

[0090] 4. Adjuvant composition

[0091] The present invention also provides an adjuvant composition containing ARNAX. In the tumor microenvironment, an immunosuppressive state is generated not only by tumor cells but also by myeloid cells infiltrating into the tumor. Tumor-associated macrophages (TAM) strongly support tumor proliferation, maintenance, and infiltration, contributing to the formation of a microenvironment favorable for tumors. Myeloid-derived suppressor cells (MDSC) inhibit the activity of antigen-specific T cells. Administration of Poly(I:C) has strong anti-cancer activity in a TLR3-dependent manner, but the systemic production of IFN-α / β and inflammatory cytokines mediated by MDA5 expressed in a wide range of cells becomes a problem. In contrast, in the administration of ARNAX, intracellular RLRs such as MD5 are not activated, only TLR3 is activated, converting cancer-suppressive cells in the tumor into cancer-attacking types, and it is considered that tumor proliferation can be inhibited. Therefore, the administration of ARNAX does not induce an excessive inflammatory response and is useful as a nucleic acid adjuvant with reduced side effects.

[0092] ARNAX has the following characteristics: 1) It is efficiently taken up into dendritic cells; 2) It only activates TLR3 and does not activate MDA5 / RIG-1; 3) It does not induce the production of systemic inflammatory cytokines / type I IFN; 4) It activates dendritic cells and induces NK cells and CTLs; 5) It shows strong anti-tumor activity; 6) It can inhibit tumor proliferation by controlling the tumor microenvironment; 7) It can be chemically synthesized according to GMP standards; 8) Among viral infections, there are types that are not hindered by antibody production induction (RSV, SARS, etc.), but ARNAX is expected to be used as a vaccine for these infections; etc. Therefore, ARNAX is extremely useful as an adjuvant in immunotherapy.

[0093] In the adjuvant composition of the present invention, in addition to ARNAX (ARNAX120 (1-120) ), it may also contain a pharmaceutically acceptable carrier and additives. Examples of such carriers and additives include surfactants, excipients, coloring agents, flavoring agents, preservatives, antioxidants, stabilizers, buffers, suspending agents, isotonic agents, binders, disintegrants, lubricants, flow promoters, flavor correctors, etc., but are not limited to these, and other commonly used carriers can also be appropriately used.

[0094] Specifically, as an aqueous carrier, it includes water, ethanol, polyols (glycerol, propylene glycol, polyethylene glycol, etc.), vegetable oils such as olive oil, and organic esters such as ethyl oleate.

[0095] Examples of non-aqueous carriers include light anhydrous silicic acid, lactose, microcrystalline cellulose, mannitol, starch, calcium carboxymethylcellulose, sodium carboxymethylcellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl acetal diethylaminoacetate, polyvinylpyrrolidone, gelatin, medium-chain triglyceride, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethyl cellulose, corn starch, inorganic salts, etc.

[0096] Examples of antioxidants include ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite as water-soluble antioxidants, ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol as fat-soluble antioxidants, and citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid as metal chelating agents.

[0097] The administration route of the adjuvant composition of the present invention is not particularly limited, and parenteral administration is preferred. Specifically, examples include injection, nasal administration, pulmonary administration, transdermal administration (including patches), etc. As injection administration, intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection can be exemplified, and subcutaneous injection is particularly preferred. The administration method can be appropriately selected according to the age and symptoms of the patient.

[0098] The dosage of the adjuvant composition of the present invention can be appropriately determined according to its purpose of use, route of administration, etc. When administered to humans, for example, in a single administration, the dosage can be selected within the range of 0.00001 mg to 10 mg per kg body weight in terms of ARNAX (ARNAX120 (1-120) )). Alternatively, for example, in terms of ARNAX (ARNAX120 (1-120) ), the dosage can be selected within the range of 1 to 100 mg / individual for each patient. However, the dosage of the adjuvant composition of the present invention is not limited to the above dosages.

[0099] The adjuvant composition of the present invention may contain antigen molecules. However, endogenous antigens exist in the bodies of cancer patients and bacterial-infected individuals. Therefore, an immune effect can be obtained even with only the adjuvant nucleic acid. When sufficient effects cannot be obtained with only the adjuvant nucleic acid, the antigen molecule can be administered together with the adjuvant according to the disease to be treated. The antigen can be any one of a protein, mRNA, VLP, and intact particle. Examples of antigen molecules include viral antigens, bacterial antigens, protozoal antigens, cancer antigens, and antigenic components thereof.

[0100] Examples of viral antigens include viral antigens such as adenovirus, retrovirus, picornavirus, herpesvirus, rotavirus, hantavirus, coronavirus, togavirus, flavivirus, rhabdovirus, paramyxovirus, orthomyxovirus, bunyavirus, arenavirus, reovirus, papillomavirus, parvovirus, poxvirus, hepadnavirus, spongiform virus, HIV, CMV, hepatitis A virus, hepatitis B virus, hepatitis C virus, influenza virus, measles virus, poliovirus, smallpox virus, rubella virus, herpes simplex virus, varicella-zoster virus, Epstein-Barr virus, Japanese encephalitis virus, rabies virus, influenza virus, or combinations thereof.

[0101] Examples of bacterial antigens include bacterial antigens such as Bacillus, Escherichia, Listeria, Neisseria, Nocardia, Salmonella, Staphylococcus, Streptococcus, or combinations thereof.

[0102] Examples of protozoal antigens include protozoal antigens such as Plasmodium, Toxoplasma, Entamoeba, Eimeria, Isospora, Giardia, Cryptosporidium, Cyclospora, or combinations thereof.

[0103] Examples of cancer antigens include cancer antigens of leukemia, lymphoma, astrocytoma, glioblastoma, melanoma, breast cancer, lung cancer, head and neck cancer, digestive system tumors, gastric cancer, colon cancer, liver cancer, pancreatic cancer, uterine cancer, ovarian cancer, vaginal cancer, testicular cancer, prostate cancer, penile cancer, bone tumors, vascular tumors, esophageal cancer, rectal cancer, colorectal cancer, pancreatic cancer, gallbladder cancer, cholangiocarcinoma, laryngeal cancer, bronchial cancer, bladder cancer, kidney cancer, brain tumors, thyroid cancer, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, etc., or combinations thereof.

[0104] 5. Pharmaceutical composition

[0105] In addition to having an adjuvant effect, ARNAX also has a therapeutic effect on cancers or infectious diseases, etc. The present invention also provides a pharmaceutical composition containing ARNAX (ARNAX120 (1-120) ), particularly a pharmaceutical composition for treating cancers or infectious diseases.

[0106] Examples of cancers that are the subject of the pharmaceutical composition of the present invention include, for example, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, gastric cancer, testicular cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, non-Hodgkin's lymphoma, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, acute myeloid leukemia, chronic myeloid leukemia, acute lymphocytic leukemia, chronic leukemia, acute leukemia, pediatric solid cancers, lymphocytic lymphoma, bladder cancer, kidney cancer, ureteral cancer, renal pelvic cancer, central nervous system (CNS) tumors, primary CNS lymphoma, vascular tumors, spinal tumors, brainstem glioma, pituitary adenoma, Kaposi's sarcoma, squamous cell carcinoma, squamous cell cancer, T cell lymphoma, environmentally induced tumors, etc.

[0107] Examples of infectious diseases that are the subject of the pharmaceutical composition of the present invention include, for example, HIV infection (AIDS), SARS (SARS-COV1, SARS-COV2), hepatitis, herpes, malaria, leishmaniasis, influenza, dysentery, pneumonia, tuberculosis, sepsis, etc. In particular, it can be suitably applied to HIV infection that produces severe immune deficiency.

[0108] In the pharmaceutical composition of the present invention, in addition to ARNAX (ARNAX120 (1-120)In addition to [[ID=]], it may also contain pharmaceutically acceptable carriers and additives. Examples of such carriers and additives include surfactants, excipients, colorants, flavorants, preservatives, antioxidants, stabilizers, buffers, suspending agents, isotonic agents, binders, disintegrants, lubricants, flow promoters, flavor correctors, etc., but are not limited to these, and other commonly used carriers can also be appropriately used. Specific examples of these are as described in the "adjuvant composition".

[0109] The administration route of the pharmaceutical composition of the present invention is not particularly limited, and parenteral administration is preferred. Specifically, injection administration, nasal administration, pulmonary administration, transdermal administration, etc. can be cited. As injection administration, intravenous injection, intramuscular injection, intraperitoneal injection, subcutaneous injection can be exemplified. The administration method can be appropriately selected according to the age and symptoms of the patient.

[0110] The dosage of the pharmaceutical composition of the present invention can be appropriately determined according to its use purpose, administration route, etc. When administered to humans, for example, in a single administration, the dosage can be selected within the range of 0.00001 mg to 10 mg per kg body weight in terms of ARNAX (ARNAX120 (1-120) )). Or, for example, the dosage can be selected within the range of 1 to 100 mg / individual in terms of ARNAX (ARNAX120 (1-120) ). However, the dosage of the pharmaceutical composition of the present invention is not limited to the above dosage.

[0111] The pharmaceutical composition of the present invention may contain antigen molecules. However, endogenous antigens exist in the bodies of cancer patients and bacterial infected patients. Therefore, an immune effect can be obtained even with only ARNAX. When sufficient effects cannot be obtained with only ARNAX, the antigen molecule can be administered together with an adjuvant according to the disease to be treated. Examples of antigen molecules include viral antigens, bacterial antigens, cancer antigens, and antigenic components thereof, etc. Specific examples of these are as described in the "adjuvant composition".

[0112] The pharmaceutical composition of the present invention can be used in combination with other anticancer agents and anti-infective agents. The inventors reported that by using ARNAX in combination with immune checkpoint inhibitors such as anti-PD-1 antibody and anti-PD-L1 antibody, a synergistic effect can be obtained (the above WO2018 / 021400). It is considered that anti-PD-1 antibody and anti-PD-L1 antibody act in the effector phase of the immune defense mechanism. In contrast, ARNAX is delivered to the endosome of dendritic cells and acts in the sensitization phase of activating TLR3 and inducing NK cells, CTLs, etc. Therefore, by using ARNAX in combination with anti-PD-1 antibody and anti-PD-L1 antibody, the immune defense mechanism can be activated in both the entire sensitization phase and the effector phase.

[0113] Based on the above mechanism of action, by using ARNAX in combination, it is effective against cancers that are not effective when anti-PD-1 antibodies or anti-PD-L1 antibodies are used alone, and more strongly induces CTL-dependent tumor regression. Furthermore, by using it in combination with ARNAX, effects such as antibody production and NK cell activation that cannot be achieved when anti-PD-1 antibodies or anti-PD-L1 antibodies are used alone, and the effect of improving the tumor microenvironment are also exerted. ARNAX has high safety and can be safely administered to the elderly, which can expand the treatment targets of anti-PD-1 antibodies and anti-PD-L1 antibodies and improve their effects.

[0114] The pharmaceutical composition of the present invention can also be used in combination with radiotherapy. Thereby, the effect of radiotherapy in cancer treatment can be improved. When the pharmaceutical composition of the present invention is used in combination with radiotherapy, a distant effect of cancer regression is also observed in the region where radiation is not irradiated. The distant effect refers to the following effect: in radiotherapy, cancer shrinkage is observed not only at the irradiated site but also at a relatively distant non-treatment site. It is considered that the distant effect is caused by activating the immunity of distant lesions by cancer antigen information and the like released from cancer cells destroyed at the radiation irradiation site.

[0115] Examples

[0116] The present invention will be described in more detail below by way of examples, but the present invention is not limited by these examples.

[0117] Example 1: ARNAX120 (17-136) and ARNAX120 (1-120) Stability during cryopreservation

[0118] 1. Agglutination formation

[0119] Two nucleic acids ARNAX120 (17-136) and ARNAX120 (1-120) ( Figure 1 ) with different sequences in the double-stranded RNA (120mer) part were synthesized. ARNAX120 (17-136) is composed of the sense strand of SEQ ID NO: 7 and the antisense strand of SEQ ID NO: 8. ARNAX120 (1-120) is composed of the sense strand of SEQ ID NO: 4 and the antisense strand of SEQ ID NO: 5. The partial sequences of the single-stranded oligonucleotides (SEQ ID NO: 2) of the two nucleic acids are common. The sequence of the double-stranded RNA part of ARNAX120 (17-136) is positions 17-136 of SEQ ID NO: 1. In contrast, the sequence of the double-stranded RNA part of ARNAX120 (1-120) is positions 1-120 of SEQ ID NO: 1, and they are different in this regard.

[0120] The synthesized nucleic acid is stored frozen at -20°C after lyophilization until use. Aggregate formation is analyzed by size exclusion chromatography (SEC-HPLC) under the following conditions.

[0121] [SEC-HPLC Analysis Conditions]

[0122] Column: TSKgel UP-SW3000, 4.6 mm × 300 nm, 2 μm × 2 columns (+ guard column)

[0123] Column temperature: 30°C

[0124] Mobile phase: 1x PBS (137 mM NaCl, 2.68 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4)

[0125] Flow rate: 0.18 mL / min

[0126] Sample diluent: 1 x PBS

[0127] Gradient condition: Isocratic elution (A 100%)

[0128] Detection wavelength: 260 nm

[0129] (1) ARNAX120 (17-136)

[0130] Dissolve the lyophilized product of ARNAX120 (17-136) (before cryopreservation) in water for injection at a concentration of 1 mg / mL, and prepare a final 1x PBS solution using water for injection and 10x PBS, and analyze the formation of aggregates (initial) by size exclusion chromatography (SEC-HPLC). In addition, freeze the lyophilized product of ARNAX120 (17-136) at -20°C for 1 month, dissolve it in the same manner as above (1 month freeze), immediately repeat freeze-thaw, and analyze the formation of aggregates in the solution of this sample (freeze-thaw, repeat) by SEC-HPLC.

[0131] The proportion of aggregates in ARNAX120 before cryopreservation (17-136) was 18%. In contrast, the proportion of aggregates in ARNAX120 after cryopreservation (17-136) was 35%, and the proportion of aggregates in ARNAX120 after repeated freeze-thaw (17-136) was 36.2% ( Figure 2 ). In ARNAX120 (17-136) , it was confirmed that aggregation increased due to cryopreservation and repeated freeze-thaw.

[0132] (2) ARNAX120 (1-120)

[0133] Freeze-dried ARNAX120 (1-120) was stored frozen (-20 °C), and the formation of aggregates was analyzed by SEC-HPLC (before freezing, and after 1, 3, 6, 9, and 12 months of storage, Figure 3 , Table 1). Additionally, the formation of aggregates of ARNAX120 (1-120) dissolved in physiological saline and stored at -20 °C was similarly analyzed by SEC-HPLC (after 1 and 3 months of storage) (Table 1). No formation of aggregates was confirmed in the frozen storage product of the freeze-dried ARNAX120 (1-120) for 12 months at -20 °C, and the content of the double-stranded active moiety was constant. Even when dissolved in physiological saline, stability was confirmed for 1 month ( Figure 3 , Table 1).

[0134] [Table 1]

[0135]

[0136] 2. Tm value

[0137] The Tm values of ARNAX120 (17-136) and ARNAX120 (1-120) were measured. Each nucleic acid was dissolved in 10 mM sodium phosphate buffer (pH 7.4), allowed to stand at 5 °C for 60 minutes, and then heated to 95 °C at +0.5 °C / minute. 100 μL of the solution of each nucleic acid (1 mg / mL) was collected and made up to 5 mL with the above buffer to measure the Tm value.

[0138] ARNAX120 (17-136) showed three stages of structural changes, whereas ARNAX120 (1-120) showed only two stages of structural changes ( Figure 4 ). It is assumed that ARNAX120 (1-120) without structural changes near room temperature is easy to handle.

[0139] Example 2: Activity of ARNAX120 (17-136) and ARNAX120 (1-120) after freeze-thawing (TLR3-mediated IFNβ activation ability)

[0140] 1. Activity after freeze-thawing

[0141] A control plasmid (pEF / BOS) or a plasmid expressing human TLR3 was transfected into HEK293 cells together with an IFN-β promoter reporter gene plasmid, and ARNAX120 (17-136)or ARNAX120 (1-120) . The luciferase activity in the cells was measured after 6 hours. Regarding the luciferase activity, the luciferase activity when adding the medium to the cells expressing pEF / BOS as a negative control was set to 1 and expressed as a multiple.

[0142] (1) ARNAX120 (17-136)

[0143] ARNAX120 was (17-136) dissolved in water for injection so as to reach 1 mg / mL. The freshly dissolved sample was added to the cells at a concentration of 10 μg / mL, and the luciferase activity was measured as described above. Similarly, the dissolved sample was frozen and thawed, added to the cells at a concentration of 10 μg / mL, and the luciferase activity was measured. Compared with the freshly dissolved sample, the frozen and thawed sample showed only about 65% of the activity ( Figure 5 ).

[0144] (2) ARNAX120 (1-120)

[0145] Water: ARNAX120 was (1-120) dissolved in water for injection so as to reach 1 mg / mL. The freshly dissolved sample was added to the cells at concentrations of 1, 5, and 10 μg / mL, and the luciferase activity was measured. Similarly, the dissolved sample was frozen and thawed, added to the cells at concentrations of 1, 5, and 10 μg / mL, and the luciferase activity was measured.

[0146] Normal saline: ARNAX120 was (1-120) dissolved in normal saline so as to reach 1 mg / mL and incubated at 30 °C for 1 hour. The dissolved sample was added to the cells at concentrations of 1, 5, and 10 μg / mL, and the luciferase activity was measured. Similarly, the dissolved sample was frozen and thawed, added to the cells at concentrations of 1, 5, and 10 μg / mL, and the luciferase activity was measured.

[0147] ARNAX120 (1-120) showed concentration-dependent luciferase activity both when dissolved in water and when dissolved in normal saline ( Figure 6 ). In addition, no decrease in luciferase activity due to freezing and thawing was observed.

[0148] 2. Activity after storage of the freeze-dried product

[0149] The freeze-dried ARNAX120 was (1-120) stored at -30 °C for 0 - 12 months, and its activity was measured by the same method as in 1. As a result, it was confirmed that ARNAX120 (1-120)When stored at -30 °C, the activity (ability to activate TLR3-mediated IFNβ) was stable over 1 year ( Figure 7 ).

[0150] Example 3: Effect of freeze-thaw on the anti-tumor activity of ARNAX120 (1-120)

[0151] 1. Tumor regression effect of ARNAX120 (1-120)

[0152] For C57BL / 6J mice (female, 7 weeks old), 2 x 10 6 mouse tumor cell line EG7 (EL4 lymphoma expressing OVA) was subcutaneously transplanted. After 7 days, the tumor volume was confirmed, and 100 μL of ARNAX120 (1-120) (10 μg) + OVA (100 μg) / in 200 μL of PBS was subcutaneously injected into two positions (right abdomen and left abdomen). The tumor volume was measured every 2 - 3 days until day 15. Additionally, on day 15, tumors were collected, and the proportion of CD8 + T cells (CD3 + + CD8 + cells) in the tumor and spleen and the proportion of OVA-specific CD8 + T cells (Tetramer + cells) in CD8 + T cells were measured by flow cytometry.

[0153] On day 7, the average tumor volume of 700 mm 3 significantly regressed by the administration of ARNAX120 (1-120) ( Figure 8 ). Additionally, it was confirmed that ARNAX120 (1-120) induced CTL in the tumor and spleen, resulting in tumor regression ( Figure 9 ).

[0154] 2. Effect of freeze-thaw on anti-tumor activity

[0155] The tumor regression effect of the ARNAX120 (1-120) sample prepared in the same manner as in 1 above was compared between the case of being freeze-thawed (FT: freeze and thaw (freeze-thaw), once) and the case of not being freeze-thawed (Non-FT: Non-freeze and thaw (not freeze-thawed)). Regardless of whether there was freeze-thaw, ARNAX120 (1-120) showed a significant tumor regression effect, confirming that its anti-tumor activity was not affected by freeze-thaw ( Figure 10 ). ​​

[0156] Example 4: Antitumor effect of ARNAX120 (abscopal effect) (1-120)

[0157] Subcutaneously transplant EG7 (2x10 6 / 200 μL PBS) into the right flank (treatment site) of C67BL / 6 mice (7 weeks old, ♀), and subcutaneously transplant EG7 (2x10 5 / 200 μL PBS) into the left flank (abscopal site). On the 6th day, confirm that the tumor volume reaches 250 - 300 mm 3 , irradiate the treatment site with radiation (15 Rad), and the next day, administer PBS or ARNAX120 (1-120) (25 μg / 200 μL PBS) subcutaneously, and measure the proliferation of tumors over time at the treatment site and the abscopal site.

[0158] No rad / PBS group (n = 6)

[0159] Rad / PBS group (n = 5)

[0160] Rad / ARNAX120 (1-120) group (n = 5)

[0161] By administering ARNAX120 (1-120) , an abscopal effect of tumor regression was observed not only at the irradiated site (treatment site) but also at the non-irradiated site (abscopal site). Compared with radiotherapy alone, the survival of mice was prolonged ( Figure 11 ).

[0162] Example 5: Cytokine induction by ARNAX120 (1-120)

[0163] Divide C57BL / 6J mice (7 weeks old, ♀) into 3 groups (4 mice in each group), and subcutaneously administer 200 μL of normal saline, 50 μg / 200 μL of ARNAX120 (1-120) in normal saline or 50 μg / 200 μL of poly(I:C) in normal saline near the inguinal lymph nodes. Collect blood from the tail vein 3 hours and 6 hours later, and measure IL-6, TNF-α, and IL-12p40 in the serum by cytometric bead assay (CBA), and measure IP-10 by ELISA ( Figure 12 ).

[0164] Divide C57BL / 6J mice (8 weeks old, ♀) into 3 groups (4 mice in each group), and intraperitoneally administer 200 μL of normal saline, ARNAX120 (1-120)50 μg / 200 μL normal saline or poly(I:C) 50 μg / 200 μL normal saline. Blood was collected from the tail vein at 3 hours and 6 hours, and IL-6, TNF-α, and IL-12p40 in the serum were measured by CBA, and IP-10 was measured by ELISA( Figure 13 ).

[0165] ARNAX120 (1-120) Compared with poly(I:C), it hardly induced inflammatory cytokines (IL-6, TNF-α) regardless of the administration method (subcutaneous administration, intraperitoneal administration), but induced Th1 cytokines (IL-12, IP-10) equally to poly(I:C).

[0166] Industrial applicability

[0167] The nucleic acid of the present invention is easy to handle, has good storage stability, and maintains high anti-tumor activity even after cryopreservation. Therefore, the nucleic acid of the present invention is suitable for practical application as a drug.

[0168] All publications, patents, and patent applications cited in this specification are hereby incorporated by reference directly into this specification.

[0169] Sequence data:

[0170]

[0171]

Claims

1. A nucleic acid, which is composed of a sense strand shown in SEQ ID NO: 4 and an antisense strand shown in SEQ ID NO:

5.

2. The nucleic acid according to claim 1, wherein, At least a part of the nucleotides of the single-stranded oligodeoxynucleotide constituting the sense strand are phosphorothioate-modified.

3. An adjuvant composition, which contains the nucleic acid according to claim 1 or 2.

4. A pharmaceutical composition, which contains the nucleic acid according to claim 1 or 2.

5. The pharmaceutical composition according to claim 4, which is used in combination with radiotherapy.

6. The pharmaceutical composition according to claim 4, which is used in combination with an immune checkpoint inhibitor.

7. The pharmaceutical composition according to claim 4, which further contains an antigen.

8. The pharmaceutical composition according to any one of claims 4 to 7, which is used for treating or preventing cancer or an infectious disease.

Images