Fluorescent protein selection marker staygold-DUF350r gene as well as gene derivative product and application of fluorescent protein selection marker staygold-DUF350r gene
By modifying the fluorescent protein genes staygold and DUF350, the L-valine codon in its nucleotide sequence is replaced with rare codon GTC, and the recombinant vector and recombinant strain are constructed, which solves the problem of low efficiency in screening high-yield L-valine strains in the prior art, and achieves the effect of efficient screening and high yield.
Patent Information
- Application Number
- CN202510756612.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2045-06-09
AI Technical Summary
The lack of effective fluorescent protein screening markers in the prior art is used to screen for microbial strains with high yields of L-valine, resulting in inefficient screening.
A fluorescent protein screening marker staygold-DUF350r gene was designed. By modifying the staygold and DUF350 genes, all the L-valine codons in their nucleotide sequences were replaced with rare codons GTC, and the peptide was connected in tandem by flexible proteins, recombinant vectors and recombinant strains were constructed, and high-yield L-valine strains were screened using fluorescence signal intensity.
The screening efficiency of L-valine high-yield strains was significantly improved, screening time and cost were saved, screening efficiency was improved, sorting efficiency reached 54%, screening efficiency of screening high-yield strains reached 57%, and the maximum yield increased by 45%.
Smart Images

Figure CN120272505A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a fluorescent protein screening marker staygold- DUF350 r Genes and their gene-derived products and applications. Background Art
[0002] Currently, large-scale global L-valine production is primarily carried out through microbial fermentation. This method relies on the metabolic capabilities of microorganisms, which can utilize supplied energy sources to synthesize amino acids such as L-valine. Through genetic engineering or mutagenesis techniques, strains can be developed that overcome limiting factors in metabolic regulation, such as auxotrophic strains that exhibit feedback inhibition or strains resistant to L-valine analogs. This enhances the microbial ability to synthesize L-valine and increases yields. Physical or chemical mutagenesis using aminoethylcysteine, a structural analog of L-valine, allows the creation of large strain libraries containing a wide variety of mutations. Therefore, to identify high-L-valine-producing strains from these strains, a selection marker suitable for a wide range of microbial cells is required to enable high-throughput screening.
[0003] Screening for high-amino acid-producing strains is primarily based on resistance activity selection and fluorescence intensity screening (CN116103361A) or the use of protein amino acid translation elements as screening markers to select high-producing strains (CN116376946A). However, few screening markers have been developed for L-valine production strains. Summary of the Invention
[0004] In view of this, the object of the present invention is to provide a fluorescent protein screening marker staygold-DUF350 r Gene, used for screening L-valine high-yielding mutant strains.
[0005] The present invention provides a fluorescent protein screening marker gene, including a modified staygold Genetically modified DUF350 Gene concatenation ; The modified staygold The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The modified DUF350 The nucleotide sequence of the gene is shown in SEQ ID NO: 2.
[0006] Preferably, the modified staygold Genetically modified DUF350 The genes are connected in series by connecting peptide coding sequences.
[0007] Preferably, the nucleotide sequence of the fluorescent protein selection marker gene is shown in SEQ ID NO: 3.
[0008] The present invention provides a gene-derived product containing the fluorescent protein screening marker gene, comprising at least one of the following: a gene expression cassette, a recombinant vector and a recombinant strain.
[0009] Preferably, the backbone vector of the recombinant vector includes a prokaryotic expression vector; The host bacteria of the recombinant strain include Escherichia coli.
[0010] The present invention provides the use of the fluorescent protein screening marker gene or a product derived from the gene in screening L-valine producing strains.
[0011] The present invention provides a method for screening a L-valine producing strain, comprising the following steps: The fluorescent protein screening marker gene is transferred into Escherichia coli, and after screening culture and induction culture, the fluorescent signal is observed, and the L-valine production advantage strain is screened according to the intensity of the fluorescent signal: the higher the intensity of the fluorescent signal, the higher the L-valine production.
[0012] Preferably, the fluorescent protein selection marker gene is transferred into Escherichia coli in the form of a recombinant vector.
[0013] Preferably, the induction culture further comprises subjecting the screened Escherichia coli to a normal pressure and room temperature plasma mutagenesis treatment before the induction culture.
[0014] Preferably, the parameters of the atmospheric pressure and room temperature plasma mutagenesis treatment are: incident power of 120-150 W, gas volume of 10-15 SLM, and helium pressure of 110-130 KPa.
[0015] The present invention provides a fluorescent protein screening marker gene, including a modified staygold Genetically modified DUF350 Gene concatenation ; The modified staygold The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the modified DUF350 The nucleotide sequence of the gene is shown in SEQ ID NO: 2. Staygold and genes DUF350 All L-valine codons in the nucleotide sequence were replaced with the second rare codon GTC, and the resulting fluorescent protein gene after codon replacement was Staygold and genes after codon substitution DUF350 Connect in series to obtain the fluorescent protein screening marker staygold-DUF350 rGene. Experiments in the present invention have shown that when the fluorescent protein screening marker gene is introduced into a host bacterium, the fluorescence intensity of the recombinant strain is positively correlated with the L-valine concentration, significantly improving the screening efficiency of high-L-valine-producing strains. This screening marker can save screening time and cost and improve screening efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 Recombinant bacteria at different valine concentrations E.coli BL21 (DE3) / pUC-57(+)-staygold- Fluorescence intensity histogram of DUF350r; Figure 2 The figure is a scatter plot of L-valine production of the sorted Escherichia coli mutant strains; Figure 3 The figure is a histogram of the codon usage frequency of Escherichia coli; Figure 4 Recombinant bacteria for different fermentation times E.coli Fluorescence intensity histogram of BL21 (DE3) / pUC-57(+)-staygold-DUF350r; Figure 5 This is a graph showing the relationship between L-valine production and fluorescence intensity. DETAILED DESCRIPTION
[0017] The present invention provides a fluorescent protein screening marker gene, including a modified [[ID=()]]staygold Genetically modified DUF350 Genes are connected in series; the modified [[ID=2()]]staygold The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the modified DUF350 The nucleotide sequence of the gene is shown in SEQ ID NO: 2.
[0018] In the present invention, the modified staygold Fluorescent protein gene staygold Based on the above, the codons encoding L-valine were all replaced with the second rare codon GTC. DUF350 The gene modification method is preferably based on Escherichia coli DUF350Based on a gene, all the codons encoding L-valine were replaced with the second rare codon, GTC. A codon is a three-base sequence used to encode an amino acid. Rare codons are used in different species and organisms with uneven distribution of frequencies. The most frequently used codons are considered optimal codons, while codons that are not frequently used are called rare codons or codons with low utilization rates. If all the codons for a certain amino acid in a gene are replaced with the rare codon corresponding to that amino acid, when the concentration of that amino acid in the cell drops significantly, tRNA will be unable to load the amino acid. Only when the amino acid concentration increases significantly can the amino acid loading level of tRNA return to normal, thereby accelerating the translation of genes rich in rare codons.
[0019] In the present invention, the modified staygold Genetically modified DUF350 The genes are connected in series via a connecting peptide coding sequence. The connecting peptide is preferably a flexible protein connecting peptide. The present invention does not particularly limit the type of the flexible protein connecting peptide; any flexible protein connecting peptide known in the art, such as a G4S connecting peptide, can be used. In an embodiment of the present invention, the flexible connecting peptide coding sequence is shown in SEQ ID NO: 4.
[0020] In the present invention, the present invention is to transform staygold Genetically modified DUF350 The gene connection order is not particularly limited, and any connection order can be either front or back. In an embodiment of the present invention, the nucleotide sequence of the fluorescent protein selection marker gene is preferably as shown in SEQ ID NO:3.
[0021] The present invention provides a gene-derived product containing the fluorescent protein screening marker gene, comprising at least one of the following: a gene expression cassette, a recombinant vector and a recombinant strain.
[0022] In the present invention, the gene expression cassette preferably includes genetic elements that regulate gene expression levels, such as promoters and enhancers. The backbone vector of the recombinant vector preferably includes a prokaryotic expression vector, such as pET-22b(+) or pUC-57(+). The present invention does not particularly limit the method for constructing the recombinant vector; any recombinant vector construction method known in the art, such as homologous recombination, can be used.
[0023] In the present invention, the host bacteria of the recombinant strain preferably include Escherichia coli, such as wild Escherichia coli strain CGMCC No. 1.366 or BL21 (DE3). The present invention has no particular limitation on the method for constructing the recombinant strain, and any method for constructing a recombinant strain known in the art can be used, such as the calcium chloride heat shock method.
[0024] The present invention provides the use of the fluorescent protein screening marker gene or a product derived from the gene in screening L-valine producing strains.
[0025] In the present invention, the host bacteria of the L-valine production strain is preferably Escherichia coli, such as wild Escherichia coli strain CGMCC NO.1.366 or BL21 (DE3).
[0026] The present invention provides a method for screening a L-valine producing strain, comprising the following steps: The fluorescent protein screening marker gene is transferred into Escherichia coli, and after screening culture and induction culture, the fluorescent signal is observed, and the L-valine production advantage strain is screened according to the intensity of the fluorescent signal: the higher the intensity of the fluorescent signal, the higher the L-valine production.
[0027] In the present invention, the fluorescent protein selection marker gene is preferably transferred into Escherichia coli in the form of a recombinant vector. The Escherichia coli preferably includes wild Escherichia coli strains CGMCC NO.1.366 or BL21 (DE3).
[0028] In the present invention, the induction culture preferably includes subjecting the screened E. coli to atmospheric pressure room temperature plasma (ARTP) mutagenesis treatment before induction. The ARTP mutagenesis treatment parameters are preferably: incident power of 120-150 W, gas volume of 10-15 SLM, and helium pressure of 110-130 kPa; alternatively, the ARTP mutagenesis treatment parameters are 120 W incident power, 10 SLM gas volume, and helium pressure of 120 kPa. This ARTP mutagenesis enhances L-valine carbon flux and output, optimizes transcription factor expression, and balances intracellular cofactors, thereby increasing L-valine production.
[0029] In the present invention, the described method was used to screen for high-L-valine-producing strains. The results showed that 240 mutant strains were obtained through sorting, 130 of which had fluorescence intensities higher than the average before sorting, with a sorting efficiency of 54%. The L-valine content of the 21 mutant strains with strong fluorescence intensity was further measured. Among the 21 mutant strains, 12 strains with increased L-valine production were screened, with a screening efficiency of 57%, the highest yield being 0.310 g / L, and a yield increase of 45%. The fluorescent protein screening marker staygold-DUF350r gene provided by the present invention can effectively screen strains with increased L-valine production.
[0030] The following is a fluorescent protein screening marker provided by the present invention in conjunction with the examples. staygold-DUF350 r The genes and their gene-derived products and applications are described in detail, but they should not be understood as limiting the scope of protection of the present invention.
[0031] The contents not described in detail in the examples are all based on conventional techniques in the art; the experimental materials and reagents not described in detail are all common commercial products. Among them, the vectors and host bacteria involved in the examples were purchased from Sangon Biotech (Shanghai) Co., Ltd. and are common commercial products. Escherichia coli ( Escherichia coli ) CGMCC NO.1.366 was purchased from China General Microbiological Culture Collection Center.
[0032] Example 1 staygold-DUF350 r Fragment construction Search for fluorescent protein genes using the National Center for Biotechnology Information (NCBI) database Staygold The nucleotide sequence of the gene, NCBI accession number: LC601652.1, contains 11 L-valine codons, including 3 GTC codons, 5 GTT codons, 2 GTA codons, and 1 GTG codon. The L-valine codons GTT, GTA, and GTG are replaced with the second rare codon GTC of L-valine in Escherichia coli. StaygoldThe nucleotide sequence of the gene is shown in SEQ ID NO: 1 ().
[0033] From Escherichia coli ( Escherichia coli ) Select genes with a high proportion of L-valine codons in the CGMCC NO.1.366 genome DUF350 The nucleotide sequence contains 29 L-valine codons, including 7 GTC codons, 2 GTT codons, 1 GTA codon, and 19 GTG codons. The L-valine codons GTT, GTA, and GTG in the sequence are replaced with the second rare codon GTC for L-valine in Escherichia coli. DUF350 ( DUF350 r) nucleotide sequence such as SEQ ID NO: 2 (ATGAGTCAATATCTTGTCGACGGAGTCCTCGGCACCCTTTCATATTTCGTCTTGGCCGCAGTCATCCTCGTCGTCGGTTTTGTCATTTTGGACTTGATCACCCCAGGTAAACTGCATGAACTCGTCTTTGTCCACCATCTGCCCAACGCCGCTGTCATCACCGTCGCGCAGCAGGTCTCCATCGGAATCATCGTCGTCACTGCTGTCCTGA CCTCCTCAGATATTTTGAGTGAAGGTTTGCTGGAGACTGCAGTCTTCGGTGCCCTTGGTCTGGTCATCCAAGTCGTCGTCATGGCGGTCTTGGAAGCTGTCATTCCGGGACGTTTCCGTGATCTCGTCGAAGATCCCAAACTCCGTTCCGGTGCCGTCGTCGCCGCCGTCATCTTGATCGTCGTCGGAACCGTCAACGCTGCATGTCTGATT).
[0034] After codon replacement by flexible protein linker peptide DUF350 r Fluorescent protein gene after fragment and codon replacement Staygold Connect and synthesize staygold-DUF350 r
[0035] Example 2 Construction of recombinant plasmids Plasmid pUC-57(+) was used to EcoR I. FastDigest Hind After being treated with the double enzyme digestion reaction system of III, the seamless cloning system was used to combine with the FastDigest EcoR I. FastDigest Hind After double enzyme digestion staygold-DUF350 r The fragments were connected to obtain the recombinant vector pUC-57(+)- staygold-DUF350 r 。 The double enzyme digestion reaction system is shown in Table 1, with a total system volume of 20 μL; the seamless cloning system is shown in Table 2, with a total system volume of 10 μL.
[0036] Table 1 Double enzyme digestion reaction system
[0037] The double enzyme digestion reaction conditions are as follows: React at 37°C for 30 min; inactivate at 80°C for 5 min and store at 4°C.
[0038] Table 2 Seamless cloning system
[0039] The seamless cloning procedure was as follows: the recombination reaction was carried out at 50°C for 15 min, and then the temperature was lowered to 4°C or immediately cooled on ice.
[0040] Example 3 1. Competent Cell Transformation 10 μL of the recombinant vector pUC-57(+)- staygold-DUF350 r Add 100 μL of E. coli ( E. coliBL21(DE3) competent cells were gently tapped to mix, incubated on ice for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, and immediately placed on ice for 2-3 minutes. 900 μL of resistance-free LB liquid medium was added to the centrifuge tube and incubated at 37°C, 200 rpm, for 1 hour. The incubated bacterial liquid was centrifuged at 5000 rpm for 2 minutes. 900 μL of the supernatant was discarded and the remaining cells were resuspended and evenly spread onto LB solid medium plates containing 100 μg / mL ampicillin using a sterile spreader. The plates were incubated upside down in a 37°C incubator for 12-16 hours. The LB liquid medium formula is: 0.5% yeast extract, 1% peptone, 1% sodium chloride, and solvent water. The LB solid medium formula is: 0.5% yeast extract, 1% peptone, 1% sodium chloride, and solvent water, and 2% agar powder.
[0041] 2. Positive colony screening and verification A single colony obtained in the above step was picked and inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured at 37°C overnight. After the culture was completed, PCR amplification was performed using the bacterial liquid as a template and P1-F (5'-GCTAGTACACCATTTAAATTTCAAC-3', SEQ ID NO: 6) and P1-R (5'-GAGACTCTCGAAGCACACTTATAA-3', SEQ ID NO: 7) as primers. The PCR amplification system is shown in Table 3, and the total system is 20 μL.
[0042] Table 3 PCR amplification system
[0043] The PCR amplification procedure was as follows: 95°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 1 min, 72°C extension for 4 min, 30 cycles; 72°C extension for 10 min, and storage at 4°C. Staygold The amplified product was verified by agarose gel electrophoresis. The agarose gel electrophoresis test PCR product. The results showed that the primers P1-F and P1-R were able to amplify a specific gene band with a size of about 650 bp, which was close to the theoretical value of 651 bp. This indicates that staygold-DUF350 r The fragment was successfully inserted and the recombinant bacteria were obtained. E.coli BL21 (DE3) / pUC-57(+)- staygold - DUF350 r .
[0044] Example 4 Valine addition concentration and fluorescence intensity detection The recombinant bacteria successfully verified in Example 3 E.coli BL21 (DE3) / pUC-57(+)- staygold - DUF350 r Streak culture on LB solid medium, pick a single colony and inoculate it into LB liquid medium, and culture at 37°C and 200 rpm until OD 600 ≈1.0, inoculated with a volume ratio of 2% in 50 mL of LB liquid medium containing ampicillin with a final concentration of 100 μg / mL, and cultured at 37°C and 200 rpm until OD 600 ≈1.0. L-valine hydrochloride at final concentrations of 1 g / L, 2 g / L, 3 g / L, and 4 g / L was added to the culture medium, and then IPTG at a final concentration of 0.5 μM was added to induce the expression of fluorescent protein. No IPTG was added to the control group. Three parallel experiments were set up for each gradient. The induction conditions were 25°C and 200 r / min for 14 h. After induction, the fluorescence intensity was measured using a microplate reader at an excitation wavelength of 488 nm and a detection wavelength of 535 nm.
[0045] The relationship between L-valine concentration and fluorescence intensity is shown in Figure 1 ,The results showed that the fluorescence intensity was positively correlated with the amount of L-valine added.
[0046] Experimental Example 6 Applications of fluorescent protein selection markers (1) Fluorescent protein screening marker transformation The recombinant vector pUC-57(+)- staygold - DUF350 r 10 μL was transformed into L-valine-producing Escherichia coli CGMCC NO.1.366 competent cells and cultured for 12-16 h. The operation steps were the same as those in Example 3.
[0047] (2) Positive colony screening The positive recombinant colonies in step (1) were picked and verified, and the steps were the same as in Example 4 to obtain CGMCC NO.1.366 / pUC-57(+)- staygold - DUF350 r .
[0048] (3) ARTP mutagenesis of recombinant strains The single colony in step (2) was picked and inoculated into LB liquid medium containing 100 μg / mL ampicillin, and cultured at 37°C and 200 rpm until OD 600is 0.6~0.8, and is exposed to ARTP for 120 s.
[0049] The ARTP parameters were set as follows: incident power of 120 W, gas volume of 10 SLM, and helium pressure of 120 KPa.
[0050] (4) Inducible expression of fluorescent protein After the mutagenesis, the stainless steel disc with the mutagenic bacterial solution was placed in 1 mL of LB liquid medium containing 100 μg / mL ampicillin, shaken for 1 min, and cultured at 37°C and 200 rpm until the OD 600 The concentration of IPTG was 0.6-0.8, and the final concentration was 0.5 mM. The mixture was induced at 25°C for 12 h.
[0051] (5) High-throughput screening of mutant strains Take 1 mL of the bacterial solution obtained after induction in step (4), wash and resuspend it in 0.1% PBS buffer (pH = 7.0) and dilute it to OD 600 The RI was ≈1.0. Flow cytometry was used to analyze strain clustering, with excitation at 488 nm, fluorescence detection at 535 nm, sample pressure at 60 psi, and a nozzle diameter of 70 μm. Data were analyzed using Beckman Summit 5.2 software. A gate was set at 0.01% of the total cells, and cells with high fluorescent protein expression were collected and transferred to a 96-well plate containing 200 μL of LB liquid medium. The cells were cultured at 37°C for 36 h.
[0052] (6) L-valine fermentation test The bacterial liquid in the 96-well plate obtained in step (5) was used as a seed liquid and re-transferred to a deep-well plate containing 1 mL of fermentation medium at a volume ratio of 10%. Fermentation was continued in a microplate incubator at 37°C and 600 r / min for 48 h. After fermentation, 100 μL of fermentation liquid was taken from each well and centrifuged at 5000 r / min for 5 min. The supernatant was diluted to an L-valine concentration of 0.1~1 g / L and the L-valine concentration was measured using a biosensor analyzer. The fermentation medium formula is: glucose 2.0%, corn steep liquor 0.05%, molasses 1.6%, phosphoric acid 0.06%, (NH4)2SO4 1.20%, MgSO4 0.20%, KCl 0.05%, betaine 0.05%, FeSO4 0.03%, MnSO4 0.03%, ZnSO4 0.005%, CuSO4 0.005%, vitamin B1 0.0005%, L-threonine 0.025%, solvent water.
[0053] The above sorting yielded 240 strains of CGMCC NO.1.366 / pUC-57(+)- staygold - DUF350 r Among the mutant strains, the fluorescence intensity of 130 strains was higher than the average value before sorting, and the sorting efficiency reached 54%.
[0054] From the sorted strains, the 21 strains with the highest fluorescence intensity were selected for deep-well plate fermentation for 24 hours, and their L-valine production was measured. The highest L-valine production from the original wild-type Escherichia coli strain across multiple parallel fermentations was 0.21 g / L.
[0055] The results are as follows Figure 2 As shown in the figure, among the 21 mutant strains, 12 strains with improved L-valine production were screened, with a screening efficiency of 57%, the highest yield of 0.310 g / L, and a yield increase of 45%. staygold - DUF350 r The gene can effectively screen strains with improved L-valine production.
[0056] Comparative Example 1 Search and analyze the usage frequency of each codon in E. coli on the NCBI official website. The results are as follows Figure 3 As shown, the codons corresponding to L-valine are GUU, GUC, GUA and GUG, among which the codon with the lowest frequency is GUA. According to the method described in Example 1, a gene in which the codons for L-valine are all GUA was constructed. staygold-DUF350 rGUA , and the fluorescence intensity was detected according to the method for detecting gene expression in Examples 2 to 4.
[0057] The results are as follows Figure 4 In a short period of time (within 12 hours), the fluorescence intensity expressed is too high, which can reach 1×10 8 ~1×10 9 Therefore, GUA is not a codon that restricts the expression of L-valine, and it is impossible to construct a fluorescent protein screening marker gene.
[0058] Comparative Example 2 From Escherichia coli ( Escherichia coli ) The gene with the second highest proportion of L-valine in the amino acid sequence of CGMCC NO.1.366 genome was screened rplWThe sequence contains 14 L-valine codons, including 4 GTC codons, 6 GTT codons, 2 GTA codons, and 2 GTG codons. The L-valine codons GTT, GTA, and GTG in the sequence are replaced with the second rare codon GTC of L-valine in Escherichia coli. The nucleotide sequence after replacement is as shown in SEQ According to the method described in Examples 1 to 3, the following genes were obtained by gene synthesis: staygold-rplW r fragments and constructed the recombinant vector pUC-57(+)- staygold-rplW r The relationship between the fluorescence intensity of gene expression and the L-valine concentration in the fermentation broth was then detected according to the method of Example 4.
[0059] See the results Figure 5 The results showed that staygold-rplW r There was no significant correlation between the fluorescence intensity of the transformed strain with the fluorescence selection marker and the concentration of L-valine in the fermentation broth.
[0060] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A fluorescent protein screening marker gene, characterized in that, Including the modified staygold gene and the modified DUF350 genes concatenated to obtain; The modified staygold The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The modified DUF350 nucleotide sequence of the gene is shown in SEQ ID NO:
2.
2. The fluorescent protein screening marker gene according to claim 1, wherein The modified staygold gene and the modified DUF350 gene are concatenated through a linker peptide coding sequence.
3. The fluorescent protein screening marker gene according to claim 1, characterized in that, The nucleotide sequence of the fluorescent protein screening marker gene is as shown in SEQ ID NO:
3.
4. A gene-derived product comprising the fluorescent protein screening marker gene according to any one of claims 1 to 3, characterized in that, It includes at least one of the following: gene expression cassette, recombinant vector, and recombinant strain.
5. The gene-derived product according to claim 4, wherein The backbone vector of the recombinant vector includes a prokaryotic expression vector; The host bacterium of the recombinant strain includes Escherichia coli.
6. Use of the fluorescent protein screening marker gene according to any one of claims 1 to 3 or the gene-derived product according to claim 4 in screening L-valine-producing strains.
7. A method for screening L-valine-producing strains, characterized in that, It includes the following steps: Transfer the fluorescent protein screening marker gene according to any one of claims 1 to 3 into Escherichia coli, carry out screening culture and induction culture, observe the fluorescence signal, and screen the L-valine production dominant strain according to the intensity of the fluorescence signal: the higher the intensity of the fluorescence signal, the higher the yield of L-valine.
8. The method according to claim 7, wherein The fluorescent protein screening marker gene is transferred into Escherichia coli in the form of a recombinant vector.
9. The method according to claim 7 or 8, characterized in that Before the induction culture, it also includes subjecting the screened Escherichia coli to atmospheric and room temperature plasma mutagenesis treatment.
10. The method according to claim 9, wherein The parameters of the atmospheric and room temperature plasma mutagenesis treatment are: incident power is 120 - 150 W, gas flow rate is 10 - 15 SLM, and helium gas pressure is 110 - 130 Kpa.
Citation Information
Patent Citations
Fluorescent protein selection marker staygold-rpAr gene as well as construction method and application thereof
CN117363637A
Fluorescent protein selection marker gene GBT2-staygold and application thereof
CN118028324A
Fluorescent protein selection marker staygold-levEr gene as well as construction method and application thereof
CN119842765A
Enhanced staygold yellow fluorescent protein and use thereof
WO2024087539A1