Small molecule nucleic acid drug for intervening in cancer-specific LINC00942 and application of small molecule nucleic acid drug in targeted therapy of liver cancer

By designing siRNA specifically targeting LINC00942 to coupling with GalNAc, the delivery problem of siRNA in liver cancer cells is solved, and precise treatment of liver cancer cells is achieved, inhibiting liver cancer growth and reducing side effects.

CN120284998AActive Publication Date: 2025-07-11FUDAN UNIV SHANGHAI CANCER CENT
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510213517.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-26
Publication Date
2025-07-11
Estimated Expiration
2045-02-26

AI Technical Summary

Technical Problem

The prior art is difficult to effectively deliver siRNA to liver cancer cells, resulting in poor therapeutic effects on liver cancer and problems such as off-target effects, immunogenicity and drug resistance.

Method used

The siRNA sequence specifically targeting LINC00942 was designed and coupled to the GalNAc ligand, and GalNAc was used to bind to the ASGPR receptor on the surface of hepatocytes to achieve accurate delivery of siRNA.

Benefits of technology

The specific silencing of LINC00942 was achieved, which significantly inhibited the growth of liver cancer cells and reduced side effects, providing a new strategy for targeted liver cancer treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120284998A_ABST
    Figure CN120284998A_ABST
Patent Text Reader

Abstract

The invention provides a small molecule nucleic acid drug for intervening in cancer specific LINC00942 and application of the small molecule nucleic acid drug in targeted therapy of liver cancer, and discovers a non-coding RNA LINC00942 with high expression in liver cancer and capable of promoting cancer length, and the non-coding RNA LINC00942 is used as a potential target for treating liver cancer. According to the present invention, the siRNA sequence specifically targeting LINC00942 is designed, and the siRNA sequence is coupled with the GalNAc ligand; the GalNAc can be combined with an ASGPR receptor which is specifically expressed on the surface of the hepatocyte, so that the siRNA conjugate is accurately delivered into the hepatocyte. According to the method, the problem of siRNA delivery is effectively solved, and specific silencing of LINC00942 is realized, so that the purpose of inhibiting growth of liver cancer cells is achieved. Besides, the invention provides a novel liver cancer treatment method, and the effect of targeted treatment of liver cancer is achieved by specifically silencing LINC00942 with high expression of liver cancer by using a GalNAc mediated siRNA delivery system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of tumor treatment, and specifically relates to a small nucleic acid drug for intervening in cancer-specific LINC00942 and its application in targeted treatment of liver cancer. Background Art

[0002] Long non-coding RNAs (lncRNAs) are a class of RNA molecules that are widely present in the human genome but do not encode proteins, and their length usually exceeds 200 nucleotides. LncRNAs play complex and diverse roles in biology. Although they are not directly translated into proteins, they have important functions in the regulation of gene expression, cell differentiation, development, and the occurrence and development of various diseases. By interacting with DNA, RNA, or proteins, lncRNAs can affect gene transcription, RNA processing, translation, and protein localization and function. Recent studies have revealed that lncRNAs exhibit abnormal expression patterns in various diseases such as cancer, cardiovascular diseases, neurodegenerative diseases, and immune system disorders, which makes them potential biomarkers and therapeutic targets. The diversity and functional complexity of lncRNAs make the research in this field full of challenges, but at the same time provide a great opportunity to decode the unknown details in the life process and bring new hope for precision medicine.

[0003] Studies have shown that many lncRNAs are abnormally expressed in tumors, and these abnormally expressed lncRNAs can promote tumorigenesis and development in various ways, such as regulating the expression of tumor-related genes, affecting the proliferation and survival of tumor cells, regulating tumor immune escape, etc. Therefore, intervening and regulating the expression of these lncRNAs closely related to tumors is considered a highly promising new strategy for tumor treatment. Currently, a variety of methods have been developed to intervene in the expression of lncRNAs, including RNA interference (RNAi), antisense RNA (ASO), aptamers, ribozymes, and small molecule inhibitors, etc. These methods can regulate the expression of lncRNAs by degrading lncRNA transcripts, blocking the binding of transcription factors to lncRNA gene promoters, interfering with the interactions between lncRNAs and proteins, DNA, RNA, or complexes, etc. However, there are still many challenges in effectively interfering with these lncRNAs for treatment, such as off-target effects, immunogenicity, delivery efficiency, drug resistance, etc. To address these problems, the development of targeted delivery technologies has become crucial. By using targeted delivery technologies, therapeutic agents can be specifically delivered to tumor cells, thereby improving the therapeutic effect and reducing side effects. Among them, N-acetylgalactosamine (GalNAc) has a high affinity for the hepatocyte-specific asialoglycoprotein receptor (ASGPR). By binding GalNAc to siRNA, a GalNAc-siRNA complex can be formed, and this complex can be specifically delivered to liver cells. This delivery method can achieve precise regulation of lncRNA expression, thus providing a new strategy for tumor treatment.

[0004] RNA interference technology (RNAi) uses siRNA molecules to silence specific genes and has become a new hope for treating various diseases. However, there are still challenges in effectively delivering siRNA to target cells and making it work.

[0005] Based on this, the inventors of this case expected to use the pro-cancer long non-coding RNA LINC00942 that is highly expressed in liver cancer and use it as a potential target for liver cancer treatment. They designed a siRNA sequence specifically targeting LINC00942 and conjugated it with a GalNAc ligand. Since GalNAc can bind to the ASGPR receptor specifically expressed on the surface of hepatocytes, the siRNA conjugate can be precisely delivered into hepatocytes. This method effectively solves the problem of siRNA delivery and achieves specific silencing of LINC00942, thereby achieving the purpose of inhibiting the growth of liver cancer cells.

[0006] In addition, the inventors of this case expected to provide a new method for treating liver cancer. By using the GalNAc-mediated siRNA delivery system, specifically silence LINC00942 highly expressed in liver cancer to achieve the effect of targeted treatment of liver cancer. Summary of the Invention

[0007] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide small molecule nucleic acid drugs that intervene in cancer-specific LINC00942 and their applications in targeted therapy of liver cancer.

[0008] In order to achieve the above purpose, the present invention provides the application of siRNA targeting LINC00942 in the preparation of liver cancer drugs.

[0009] Preferably, the targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

[0010] Preferably, the sense strand of the siRNA comprises the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and the antisense strand of the siRNA comprises the sequence shown in SEQ ID NO:5 or SEQ ID NO:6; preferably, the nucleic acid on the sense strand or antisense strand of the siRNA comprises 2'-OMe modification (i.e., i2OMe) and fluorination modification (i.e., i2F).

[0011] Preferably, the 3' end of the siRNA is conjugated with trivalent GalNAc.

[0012] In addition, the present invention also discloses siRNA targeting LINC00942, and the targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

[0013] Preferably, the nucleic acid on the sense strand or antisense strand of the siRNA comprises 2'-OMe modification (i.e., i2OMe) and fluorination modification (i.e., i2F).

[0014] Preferably, the 3' end of the siRNA is conjugated with trivalent GalNAc.

[0015] Furthermore, the present invention discloses the application of a reagent for detecting the level of LINC00942 in the preparation of a liver cancer prognosis assessment kit.

[0016] Preferably, the reagent comprises primers and / or probes for detecting LINC00942.

[0017] Preferably, the primers for detecting LINC00942 are as shown in SEQ ID NO:7 and 8.

[0018] It should be noted that in the technical solution of the present invention, a long non-coding RNA (LINC00942) that is specifically highly expressed in liver cancer tissues and has a cancer-promoting function is identified and used as a potential target for the treatment of liver cancer. For this target, specific siRNA is designed to silence the expression of LINC00942, and by conjugating with the GalNAc ligand, a GalNAc-siLINC00942 conjugate is constructed to achieve targeted delivery to liver cancer cells. Through in vivo experiments using a liver orthotopic xenograft tumor model, the results show that in mice treated with GalNAc-siLINC00942, the tumor growth and metastasis ability are significantly reduced. This study indicates that targeting LINC00942, which is specifically highly expressed in liver cancer cells, using the GalNAc-siRNA technology can effectively inhibit the occurrence and development of liver cancer, providing a new strategy for the targeted treatment of liver cancer.

[0019] Compared with the prior art, the beneficial effects that can be achieved by at least one of the above technical solutions adopted in the embodiments of this specification at least include:

[0020] The present invention discovers a cancer-promoting long non-coding RNA LINC00942 that is highly expressed in liver cancer and uses it as a potential target for the treatment of liver cancer. A siRNA sequence specifically targeting LINC00942 is designed and conjugated with the GalNAc ligand. GalNAc can bind to the ASGPR receptor specifically expressed on the surface of liver cells, thereby precisely delivering the siRNA conjugate into liver cells. This method effectively solves the problem of siRNA delivery, achieves specific silencing of LINC00942, and thus achieves the purpose of inhibiting the growth of liver cancer cells. In short, the present invention provides a novel method for the treatment of liver cancer, which specifically silences LINC00942 highly expressed in liver cancer by using the GalNAc-mediated siRNA delivery system to achieve the effect of targeted treatment of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It shows the analysis of the expression of LINC00942 in various tumor tissues and normal tissues in the TCGA database. It shows that LINC00942 is significantly highly expressed in liver cancer tissues and hardly expressed in normal liver tissues.

[0022] Figure 2 It shows that LINC00942 is specifically highly expressed in liver cancer tissues and is related to the prognosis of patients. Among them, Figure 2In A and B, multiple datasets showed that LINC00942 was significantly highly expressed in liver cancer tissues but was basically not expressed in adjacent tissues, while C showed the Kaplan-Meier curves indicating the overall survival probabilities of patients with high and low expression of LINC00942 in the TCGA-LIHC cohort.

[0023] Figure 3 In vitro cell function experiments showed that LINC00942 promoted the proliferation, migration, and invasion of liver cancer cells. Among them Figure 3 A in it showed the interference of LINC00942 by multiple siRNAs in the liver cancer cell lines MHCC97H and SNU449, and the interference efficiency was detected by qPCR. B showed the overexpression of LINC00942 in the liver cancer cell lines Huh7 and SNU449, and the overexpression efficiency was detected by qPCR. Figure 3 C-F in it showed the CCK8 proliferation, colony formation, cell migration, and invasion experiments after knocking down LINC00942 in liver cancer cells. It was found that interfering with LINC00942 significantly inhibited the proliferation, colony formation, migration, and invasion abilities of liver cancer cells. Figure 3 G-J in it showed the CCK8 proliferation, colony formation, cell migration, and invasion experiments after overexpressing LINC00942 in liver cancer cells. It was found that the overexpression of LINC00942 significantly promoted the proliferation, colony formation, migration, and invasion abilities of liver cancer cells.

[0024] Figure 4 In vitro cell experiments showed that LINC00942 promoted the proliferation, migration, and invasion of liver cancer cells. Among them, Figure 4 A-E in it showed the construction of a stable LINC00942-shRNA knockdown cell line and the CCK8 proliferation, colony formation, cell migration, and invasion experiments. It was found that interfering with LINC00942 significantly inhibited the proliferation, colony formation, migration, and invasion abilities of liver cancer cells.

[0025] Figure 5 In vivo experiments showed that LINC00942 promoted the proliferation, migration, and invasion of liver cancer cells. Among them, Figure 5 A-D in it showed the stable knockdown of LINC00942 in MHCC97H cells, and 3×10 6 cells were subcutaneously injected into 5-week-old male BALB / c nude mice. The experiment found that the knockdown of LINC00942 significantly delayed tumor growth and reduced the tumor volume and weight. Ki67 staining of the tumor tissues also showed that the positive rate of Ki67 in the tumor cells of the LINC00942 knockdown group decreased significantly. Figure 5 E-H in it showed the stable overexpression of LINC00942 in Huh7 cells, and 3×106 Cells were subcutaneously injected into 5-week-old male BALB / c nude mice. Experimental findings showed that overexpression of LINC00942 significantly promoted tumor growth, increasing tumor volume and weight. Ki67 staining of tumor tissues also indicated a significantly higher positive rate of Ki67 in tumor cells in the LINC00942 overexpression group. Figure 5 I and J in [reference] show that 3×10 6 Huh7 cells stably overexpressing LINC00942 were injected into the livers of 5-week-old male BALB / c nude mice to establish a nude mouse orthotopic liver transplantation tumor model. After 4 weeks, the mice were euthanized, and their lung tissues were dissected. Hematoxylin and eosin (H&E) staining was used to determine the number of metastatic lesions in the lungs. The results showed that overexpression of LINC00942 significantly promoted tumor lung metastasis. The above in vivo experiments further demonstrated the ability of LINC00942 to promote the growth and metastasis of hepatocarcinoma cells in vivo.

[0026] Figure 6 is the flowchart for GalNAc-siRNA treatment of orthotopic liver xenograft tumors.

[0027] Figure 7 shows the therapeutic effect of GalNAc-siLINC00942 in vivo. Among them, Figure 7 in A and B, for the mice treated with GalNAc-siLINC00942, their in vivo tumor growth ability was significantly weakened compared with the control group, and the fluorescence intensity was significantly reduced. Figure 7 in C and D shows that HE staining found that the intrahepatic metastasis ability and lung metastasis ability of the mice in the GalNAc-siLINC00942 treatment group were significantly weakened compared with the control group. Figure 7 in E shows that the staining degree of Ki67 in the tumor tissues of the mice in the GalNAc-siLINC00942 treatment group was significantly weakened. Specific embodiments

[0028] The embodiments of the present application will be described in detail below with reference to the accompanying drawings.

[0029] The following describes the embodiments of the present application through specific examples, and those skilled in the art can easily understand the other advantages and effects of the present application from the content disclosed in this specification. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. The present application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present application. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work belong to the scope protected by the present application.

[0030] It should be noted that the following describes various aspects of the embodiments within the scope of the appended claims. It should be apparent that the aspects described herein can be embodied in a wide variety of forms, and any specific structure and / or function described herein is illustrative only. Based on the present application, those skilled in the art should understand that one aspect described herein can be implemented independently of any other aspect, and two or more of these aspects can be combined in various ways. For example, any number and aspects described herein can be used to implement the device and / or practice the method. Additionally, this device and / or this method can be implemented using other structures and / or functionality in addition to one or more of the aspects described herein.

[0031] It should be noted that the present invention designs technical solutions from the following aspects:

[0032] 1. Regarding the specific high expression of LINC00942 in liver cancer tissues but not in normal liver tissues, siRNA with specific targeted interference was designed, and the target sequence is: GGTTCATCTCCAGAAGGCTTGGAAT. To improve the stability of siRNA in vivo, chemical modifications were performed on siRNA. Specifically, these include: 2'-O-Me, FU, and FC, and these modifications can significantly extend the half-life of siRNA in vivo and improve its therapeutic effect. In addition, to achieve specific targeting of hepatocytes, a GalNAc molecule was linked to the 3' end of the sense strand of siRNA.

[0033] 2. Preparation of tumor cell lines: Lentivirus of PWPXL-GFP-Luciferase was packaged using 293T cells and infected MHCC97H cells. MHCC97H cell lines stably expressing Luciferase were screened and established, which enables subsequent tracking of tumor growth through in vivo bioluminescence imaging technology.

[0034] 3. Establishment of orthotopic xenograft tumor model in nude mouse liver: MHCC97H cells stably expressing Luciferase were injected into the nude mouse liver in situ.

[0035] 4. Experimental grouping and treatment regimen: The first in vivo imaging was performed 7 days after cell inoculation, and the animals were randomly divided into two groups of 5 each. The control group of mice was given GalNAc-siNC subcutaneously, and the experimental group of mice was given GalNAc-siLINC00942. The second in vivo imaging was performed on the 14th day and the drug was administered again. The last imaging was performed on the 21st day, and the mouse liver and lung tissues were collected for HE staining and immunohistochemistry experiments and statistical analysis to evaluate the therapeutic effect of GalNAc-siLINC00942 in vivo.

[0036] Example 1

[0037] Experimental methods

[0038] 1.1 Download and analysis of RNA sequencing datasets

[0039] The bam files of RNA-seq of human tumor samples of 33 different cancer types were downloaded from the TCGA database; the TPM expression values of LINC00942 were analyzed quantitatively by the bioinformatics software StringTie. For the expression data of liver cancer tissues, the expression data of 50 pairs of paired liver cancer and adjacent tissues in the TCGA liver cancer patient (TCGA-LIHC) RNA-seq dataset from the GDC data (https: / / portal.gdc.cancer.gov / ) were analyzed. The GSE77314 dataset and the GSE144269 dataset were downloaded from the Gene Expression Omnibus (GEO, https: / / www.ncbi.nlm.nih.gov / geo / ), and the expression of LINC00942 in 50 pairs of tumor tissues and adjacent tissues was analyzed.

[0040] 1.2 Cell culture

[0041] Human liver cancer cells Huh7, MHCC97H and SNU449 and human embryonic kidney cells HEK-293T cells were cultured in high-glucose DMEM medium containing 10% fetal bovine serum (FBS) and 1% double antibody (penicillin and streptomycin). The cells were cultured in an incubator at 37 °C and 5% CO2.

[0042] 1.3 Real-time fluorescence quantitative PCR (qPCR)

[0043] Total RNA was extracted from cultured cells using TRIzol reagent (Invitrogen, CA, USA), and the RNA was reverse-transcribed into cDNA using Evo M-MLV RT Master Mix (Accurate Biology, Hunan, China). The qPCR reaction was performed using SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, Hunan, China), and three replicates were set for each sample group.

[0044] Table 1 qPCR primer sequences

[0045]

[0046]

[0047] 1.4 siRNA transfection

[0048] All siRNAs were synthesized by Ribobio. After transient centrifugation of the siRNA dry powder, it was dissolved in DEPC water to prepare a 20 μM stock solution, which was aliquoted and stored in a -20 °C freezer. Transient transfection was performed in cells using Lipofectamine RNAi MAX transfection reagent (Invitrogen, CA, USA). Subsequent experiments could be carried out 24 - 48 h after transfection.

[0049] Table 2 siRNA sequences

[0050] Name Sequence (5'-3') siNC AGUACAGCAAACGAUACGG (as shown in SEQ ID NO:13) siLINC00942-1 GGTTCATCTCCAGAAGGCTTGGAAT (as shown in SEQ ID NO.1) siLINC00942-2 TCCTCGGCCTGAGGGAGGCAGTGAA (as shown in SEQ ID NO.2)

[0051] 1.5 Design and plasmid construction of LINC00942 shRNA

[0052] The forward and reverse primers of the shRNA of LINC00942 were synthesized by GenScript Biotech Corporation. The primer fragments were annealed to form shRNA double-strands; the Lenti-gRNA-Puro vector (Addgene #84752) was digested with BsmB I-v2 (New England Biolabs, MA, USA); the shRNA was ligated into the Lenti-gRNA-Puro vector through a ligation reaction using Solution I ligase (Takara, Japan). Then, it was transformed into Escherichia coli HB101, and after spreading on plates, monoclonal colonies were picked for expansion culture, plasmids were extracted, and after being sent for sequencing and identified as correct, the plasmid construction was completed and used for subsequent lentivirus packaging.

[0053] Table 3 shRNA sequences

[0054]

[0055] 1.6 Construction of plasmid overexpressing LINC00942

[0056] Specific amplification primers were designed according to the full-length sequence of LINC00942, and the full-length fragment of LINC00942 was amplified by PCR using PrimeSTAR HS Premix high-fidelity enzyme (Takara, Japan); the PWPXL vector was digested with EcoR I-HF (New England Biolabs, MA, USA) and BamH I-HF (New England Biolabs, MA, USA); the full-length fragment of LINC00942 was ligated to the PWPXL vector by seamless cloning using ClonExpressUltra One Step Cloning Kit (Vazyme, Nanjing, China); after transformation and plasmid extraction, the plasmid was sent for sequencing and identified as correct, and the PWPXL-LINC00942 overexpression plasmid was successfully constructed, with the empty vector as the Vector negative control.

[0057] Full-length sequence of LINC00942:

[0058]

[0059] 1.7 Construction of PWPXL-EGFP-Luciferase Plasmid for In Vivo Imaging Experiments in Mice

[0060] The luciferase gene (Luciferase) was cloned into the PWPXL vector. The PWPXL vector itself contains EGFP, and Luciferase was inserted behind EGFP for fusion expression to obtain the PWPXL-EGFP-Luciferase plasmid.

[0061] 1.8 Lentivirus Packaging, Infection, and Construction of Stable Expression Cell Lines

[0062] Lentivirus packaging: After trypsinizing HEK-293T cells in good growth state, an appropriate amount of cells was inoculated into a 6-well plate. After overnight culture until the density reached 70-80%, lentivirus packaging could be carried out. Take 2 μg of plasmid, 1.4 μg of packaging plasmid psPAX2 (Addgene#12260), 0.7 μg of envelope plasmid pMD2.G (Addgene#12259) and mix with 500 μL of serum-free DMEM medium. Take another EP tube and mix 10 μL of liposome transfection reagent with 500 μL of serum-free DMEM medium, and let it stand at room temperature for 5 min. Mix the two systems, gently pipette to mix evenly, and let it stand for 15 min. Take out the HEK-293T cells in the 6-well plate from the incubator, discard the medium, add 1 mL of serum-free medium to each well, and then slowly add the incubated transfection system along the well wall, mix evenly, and put it back into the incubator. After culturing for 6-8 h, change the medium to 2 mL of fresh complete medium. After 48 h of transfection, collect the medium, aspirate the medium with a syringe, filter it through a 0.45 μm filter membrane and collect it in an EP tube to obtain the virus solution, which can be directly used to infect cells or stored in a -80 °C refrigerator.

[0063] Lentivirus infection and stable strain construction: When the density of cells in good state reached 50-70%, lentivirus infection could be carried out. Taking the 6-well plate as an example, change the fresh medium of the cells and add polybrene with a final concentration of 6 μg / mL, and put it back into the incubator. After 30 min, take out the cells, add an appropriate amount of virus solution to the wells, change the fresh medium after overnight infection. After 36-48 h, for the fluorescent plasmid, the infection efficiency can be observed under a fluorescence microscope and subsequent flow sorting can be performed. For the resistance screening plasmid, the corresponding screening drug can be added, and after screening, RNA can be extracted to detect the efficiency, and the stable expression strain with good efficiency can be used for subsequent experiments.

[0064] 1.9 In Vitro Cell Function Experiments: Cell Proliferation, Migration, and Invasion Experiments

[0065] The cell proliferation ability was evaluated by CCK8 assay and colony formation assay. For the CCK8 assay, 1500 cells of different treatment groups were seeded in 96-well plates. After culturing for a required period of time, 10% CCK8 (HY-K0301, MCE) was added to the cells, and then the cells were cultured for another 2 hours. The absorbance value at OD 450 was detected. For the colony formation assay, 3000 cells of different treatment groups were seeded in 6-well plates and incubated for 7 - 14 days. Subsequently, the cells were stained with 1% crystal violet solution for 15 minutes, photographed, and quantified using ImageJ software.

[0066] Cell migration and invasion assays were performed in 24-well plates containing Transwell chambers (Corning, USA). For the cell migration assay, cells (5×10 4 cells) in 200 μl of serum-free medium were seeded into the upper chamber, and 500 μl of DMEM medium containing 20% FBS was added to the lower chamber. After incubating at 37 °C for a period of time, the chambers were taken out, placed in crystal violet staining solution for 15 min, and then rinsed with water. The dried chambers were photographed for cell images using an inverted microscope, and then counted and statistically analyzed using ImageJ software. For the cell invasion assay, Matrigel (BD, New Jersey, USA) was thawed in a 4 °C refrigerator before the experiment and diluted with serum-free medium at a ratio of 1:9 on ice. Then, 500 μL of medium containing 20% FBS was added to the 24-well plate, the Transwell chamber was placed, 70 μL of diluted Matrigel was added to the chamber, and then the 24-well plate was placed in an incubator for 30 min before subsequent experiments.

[0067] 1.10 Subcutaneous tumor formation assay in nude mice

[0068] Five-week-old male BALB / c nude mice were housed in an SPF environment and provided with sufficient food and water during growth. Huh7 cells with stable overexpression of LINC00942 or MHCC97H cells with stable knockdown of LINC00942 were subcutaneously injected into the nude mice. The tumor size was measured every 3 days. The experiment was terminated after 3 - 5 weeks. The mice were euthanized, and the subcutaneous tumors were dissected, weighed, and recorded. At the same time, all subcutaneous tumors were grouped and photographed. The fresh tumor tissues were fixed in 4% paraformaldehyde for subsequent paraffin embedding, sectioning, and immunohistochemical staining.

[0069] 1.11 Orthotopic liver transplantation tumor assay in nude mice

[0070] Five-week-old male BALB / c nude mice were housed in an SPF environment and provided with sufficient food and water during growth. Huh7 cells stably overexpressing LINC00942 were directly injected into the livers of BALB / c nude mice. The status of the mice was observed during this period to ensure that the tumor burden would not be too large. After 4 weeks, the mice were euthanized, and then the mouse lungs were fixed in 4% paraformaldehyde for subsequent hematoxylin and eosin (H&E) staining.

[0071] 1.12 GalNAc-siLINC00942 treatment of nude mouse orthotopic liver tumor transplantation model

[0072] GalNAc-siRNA for in vivo animal experiments was biosynthesized by Huzhou Hippo Biotech. The GalNAc-siNC sequence is UUCUCCGACGUGUCACGUUU (as shown in SEQ ID NO:10). The GalNAc-siLINC00942 sequence is GGTTCATCTCCAGAAGGCTTGGAAT (as shown in SEQ ID NO:1). (The GalNAc-siLINC00942 sequence was selected according to the siRNA interference efficiency and the most obvious functional group in in vitro cell experiments corresponding to the siLINC00942-1 sequence). The GalNAc-siNC and GalNAc-siLINC00942 sequences were conjugated with chemical modifications, including 2'-OMe, FC, FU. At the same time, a trivalent GalNAc molecule was linked to the 3' end of the sense strand.

[0073] Construction of a cell line stably expressing EGFP-Luciferase: MHCC97H cells were infected with PWPXL-EGFP-Luciferase virus. After 48 hours, the cells were collected and sorted by flow cytometry to obtain GFP-positive cells, which were further expanded in culture to obtain a hepatocellular carcinoma cell line stably expressing EGFP-Luciferase.

[0074] Inject 5×10 6Stable expression of EGFP-Luciferase MHCC97H cells were injected into the liver of 5-week-old male BALB / c nude mice to construct an orthotopic xenograft tumor model. Seven days after orthotopic transplantation, each mouse was injected intraperitoneally with D-luciferin (150 mg / kg). After the mice were anesthetized with isoflurane, imaging was performed using an IVIS Lumina LT Series III in vivo imaging system to observe the growth of the transplanted tumors. The nude mice were randomly divided into two groups (N = 5 mice / group), and GalNAc-siNC and GalNAc-siLINC00942 (5 mg / kg) were injected subcutaneously for treatment experiments once a week for two consecutive weeks. After in vivo imaging in the third week, the mice were euthanized, dissected, and liver and lung tissues were collected for subsequent HE staining and immunohistochemical staining.

[0075] Experimental results of Example 2

[0076] 2.1 Expression of LINC00942 in liver cancer

[0077] The expression levels of LINC00942 in 33 types of tumor tissues and corresponding normal tissues were analyzed through the TCGA database (the sample sizes of each type of tissue are marked in the figure). It was found that LINC00942 was significantly highly expressed in liver cancer tissues, while it was hardly expressed in normal liver tissues.

[0078] 2.2 Correlation between the expression of LINC00942 in liver cancer tissues and prognosis

[0079] Data from multiple datasets (TCGA-LIHC, GSE77314, GSE144269) all showed that LINC00942 was significantly highly expressed in liver cancer tissues and hardly expressed in adjacent cancer tissues ( Figure 2 A and B in). It provided a good target for specific targeted therapy of liver cancer cells. And the high expression of LINC00942 was associated with poor prognosis of patients ( Figure 2 C in), which further enhanced the clinical significance of targeting LINC00942 for treatment.

[0080] 2.3 In vitro experimental study on the correlation between LINC00942 and the proliferation, migration, and invasion of liver cancer cells

[0081] To explore the biological function of LINC00942, two siRNAs specifically targeting LINC00942 were designed (sequences are shown in the method), transfected transiently into MHCC97H and SNU449 cells, and RNA was extracted 48 h later to detect the interference efficiency of LINC00942 by qPCR ( Figure 3in A). In addition, an overexpression plasmid of LINC00942 was constructed and transfected into Huh7 and SNU449 cells. After 48 h, RNA was extracted and the overexpression efficiency of LINC00942 was detected by qPCR ( Figure 3 in B). After knocking down LINC00942 in hepatoma cells, it was found that the proliferation, migration and invasion abilities of hepatoma cells were significantly down-regulated ( Figure 3 in C-F). On the contrary, overexpression of LINC00942 significantly promoted the proliferation, migration and invasion abilities of hepatoma cells ( Figure 3 in G-J). In addition, after stably knocking down LINC00942 by shRNA, the proliferation, migration and invasion abilities of hepatoma cells were also significantly inhibited ( Figure 4 in A-E). The above results all indicated the pro-cancer effect of LINC00942 in hepatoma cells.

[0082] 2.4 In vivo experiments to study the correlation between LINC00942 and the proliferation, migration and invasion of hepatoma cells

[0083] 3×10 6 MHCC97H cells with stably knocked-down LINC00942 were subcutaneously injected into 5-week-old male BALB / c nude mice. The results showed that the knockdown of LINC00942 significantly delayed tumor growth and reduced tumor volume and weight ( Figure 5 in A-C). Ki67 staining also showed that the positive rate of Ki67 in the tumor tissues of the LINC00942 knockdown group was significantly decreased ( Figure 5 in D). In addition, 3×10 6 Huh7 cells with stably overexpressed LINC00942 were subcutaneously injected into 5-week-old male BALB / c nude mice. The experiment found that overexpression of LINC00942 significantly promoted tumor growth and increased tumor volume and weight ( Figure 5 in E-G). Ki67 staining also showed that the positive rate of Ki67 in the tumor tissues of the LINC00942 overexpression group was significantly increased ( Figure 5 in H). At the same time, Huh7 cells with stably overexpressed LINC00942 were injected into the liver of nude mice to establish a nude mouse liver orthotopic transplantation tumor model. The results showed that overexpression of LINC00942 significantly increased the formation of tumor lung metastasis foci ( Figure 5 in I and J). The above in vivo experiments further demonstrated the ability of LINC00942 to promote the growth and metastasis of hepatoma cells in vivo.

[0084] 2.5 Therapeutic effect of GalNAc-siLINC00942 in vivo

[0085] Based on the significantly high expression of LINC00942 in liver cancer but almost no expression in normal liver, and the ability of LINC00942 to promote the tumor progression of liver cancer, the in vivo therapeutic effect and significance of GalNAc-siLINC00942 were further explored. By establishing a nude mouse orthotopic liver xenograft model (see the method specifically, such as Figure 6 shown), in vivo therapeutic experiments were carried out by subcutaneously injecting GalNAc-siLINC00942 or the corresponding control GalNAc-siNC into nude mice. The results showed that in the mice treated with GalNAc-siLINC00942, the in vivo growth ability of the tumors was significantly weakened compared with the control group ( Figure 7 A and B in), in addition, the intrahepatic metastasis ability and lung metastasis ability were also significantly reduced compared with the control group ( Figure 7 C and D in). Moreover, the positive rate of Ki67 in the tumor tissues of the mice in the GalNAc-siLINC00942 treatment group was significantly decreased ( Figure 7 E in). The above results suggest that targeting LINC00942 with high specific expression in liver cancer cells by GalNAc-siRNA can effectively inhibit the in vivo growth and metastasis ability of nude mouse xenografts.

[0086] The above embodiments are only for explaining the technical concept and characteristics of the present invention. The purpose is to enable those of ordinary skill in the art to understand the content of the present invention and implement it accordingly, and it cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the essence of the content of the present invention should be covered within the protection scope of the present invention.

Claims

1. Use of siRNA targeting LINC00942 in the preparation of drugs for liver cancer.

2. The application according to claim 1, characterized in that the targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO:1 or SEQ ID NO:

2.

3. The application according to claim 1 or 2, characterized in that, The sense strand of the siRNA comprises the sequence shown in SEQ ID NO:3 or SEQ ID NO:4, and the antisense strand of the siRNA comprises the sequence shown in SEQ ID NO:5 or SEQ ID NO:6; preferably, the nucleic acid on the sense strand or antisense strand of the siRNA comprises 2'-OMe modification and fluorination modification.

4. The application according to any one of claims 1-3, characterized in that, The 3' end of the siRNA is conjugated with trivalent GalNAc.

5. siRNA targeting LINC00942, characterized in that, The targeting sequence of the siRNA comprises the sequence shown in SEQ ID NO:1 or SEQ ID NO:

2.

6. The siRNA according to claim 5, wherein, The nucleic acid on the sense strand or antisense strand of the siRNA comprises 2'-OMe modification and fluorination modification.

7. The siRNA according to claim 5 or 6, wherein The 3' end of the siRNA is conjugated with trivalent GalNAc.

8. Use of a reagent for detecting the level of LINC00942 in the preparation of a kit for evaluating the prognosis of liver cancer.

9. The application according to claim 8, wherein The reagent comprises primers and / or probes for detecting LINC00942.

10. The application according to claim 9, characterized in that, The primers for detecting LINC00942 are as shown in SEQ ID NO:7 and 8.

Citation Information

Patent Citations

  • Small molecule nucleic acid drug for intervening cancer-specific LINC01419 and application of small molecule nucleic acid drug in targeted therapy of liver cancer

    CN117653653A

  • Small molecule nucleic acid drug for targeted inhibition of LINC02163 and application of small molecule nucleic acid drug in targeted therapy of liver cancer

    CN118526591A