Application of CRX in inhibition of epithelial-mesenchymal transition of retinal pigment epithelial cells

By overexpressing the CRX gene in retinal pigment epithelial cells and enhancing the expression of E-cadherin and Occludin using viral vectors, the inhibition of subretinal fibrosis was solved, and effective treatment and prevention of AMD was achieved.

CN120285152APending Publication Date: 2025-07-11TONGEYE MEDICAL TECHNOLOGY (NINGBO) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510573014.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-06
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The prior art lacks effective means to inhibit the epithelial interstitial transformation (EMT) of retinal pigment epithelial cells, leading to subretinal fibrosis, which in turn leads to visual damage to AMD, especially the progression of wet AMD is difficult to control.

Method used

Overexpressing the CRX gene in retinal pigment epithelial cells, using viral vectors such as lentivirus, adeno-associated virus or HSV-1 viral vectors, enhance the expression of E-cadherin and Occludin to inhibit EMT.

Benefits of technology

It significantly inhibits the EMT of RPE cells, reduces the formation of subretinal fibrosis, provides a new method to prevent and treat AMD, and has wide application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120285152A_ABST
    Figure CN120285152A_ABST
Patent Text Reader

Abstract

The invention discloses an application of CRX in inhibition of epithelial-mesenchymal transition of retinal pigment epithelial cells. The invention discloses an application of CRX in preparation of a medicine as shown in (1) or (2). The medicine comprises a carrier for over-expressing CRX; (1) a drug for inhibiting epithelial-mesenchymal transition of retinal pigment epithelial cells; and (2) a medicine for preventing and / or treating age-related macular degeneration subretinal fibrosis. The invention finds that the expression of E-cadherin and Occludin can be promoted by overexpressing CRX in RPE cells, so that the epithelial-mesenchymal transition of the RPE cells is inhibited, and the CRX can be used for preventing or treating age-related macular degeneration subretinal fibrosis and also can be used for preventing or treating highly myopia retinal degeneration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of CRX in inhibiting the epithelial-mesenchymal transition of retinal pigment epithelial cells. Background Art

[0002] Age-related macular degeneration (AMD) is one of the main causes of severe vision loss in the elderly, and the formation of subretinal fibrosis is an important cause of blindness. The pathogenesis of AMD is complex, and the epithelial-mesenchymal transition (EMT) of retinal pigment epithelial (RPE) cells is considered to be one of the important factors leading to the onset of AMD. After EMT, RPE cells transform into myofibroblasts, which are the main participants in subretinal fibrosis. Therefore, inhibiting EMT of RPE cells has become a research hotspot for the treatment and prevention of subretinal fibrosis formation in AMD. Summary of the Invention

[0003] In order to solve the deficiencies in the prior art, the present invention aims to provide the application of CRX in inhibiting EMT of retinal pigment epithelial cells.

[0004] AMD is a common cause of irreversible vision loss in the elderly. The occurrence of subretinal fibrosis, as the final manifestation of advanced wet AMD, seriously affects the quality of life of patients, and there is no effective treatment for this severe complication. Although anti-VEGF therapy has become the standard treatment for wet AMD, by inhibiting angiogenesis and vascular permeability to slow down the disease progression, there are still a considerable number of patients who do not respond well to anti-VEGF therapy, and fibrosis will continue to develop, leading to further deterioration of vision. The pathogenesis of subretinal fibrosis is extremely complex, involving multiple factors and multiple signaling pathways. RPE cells play a key role in this process, and their EMT has been widely studied and confirmed. EMT of RPE cells leads to the loss of epithelial markers and the acquisition of mesenchymal characteristics, and then transforms into myofibroblasts, which participate in the formation of subretinal fibrosis. RPE cells are the main contributing cells to the formation of subretinal fibrosis. Therefore, inhibiting EMT of RPE cells can be used for the treatment or prevention of AMD, especially the formation of subretinal fibrosis in wet AMD.

[0005] In the present invention, CRX is overexpressed in iPSC-RPE cells, enhancing the expression of E-cadherin and Occludin in RPE cells, thereby being able to inhibit low-density passage and TGF-β1-induced EMT; in in vivo mouse experiments, a virus carrying the CRX gene is injected into the subretinal space to infect RPE cells, causing them to overexpress CRX, and subretinal fibrosis is induced by a laser induction method, and immunohistological staining is used to determine the inhibitory effect of CRX on RPE cell EMT and the inhibitory effect on the formation of subretinal fibrosis.

[0006] The specific technical solution of the present invention is as follows: The present invention provides the application of the CRX gene in the preparation of the drug described in (1) or (2) below, and the drug contains a vector for overexpressing the CRX gene; (1) A drug for inhibiting EMT of retinal pigment epithelial cells; (2) A drug for preventing and / or treating subretinal fibrosis of age-related macular degeneration.

[0007] Further, the vector is a viral vector; Preferably, the viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.

[0008] Further, the EMT is low-density passage and TGF-β1-induced EMT.

[0009] The present invention also provides a product according to any one of (1)-(3) below, (1) The product is a pharmaceutical composition, and the pharmaceutical composition contains a vector for overexpressing the CRX gene; Preferably, the vector is a viral vector; Preferably, the viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector; (2) The product is a cell overexpressing the CRX gene, and the cell is an iPSC-RPE cell or an RPE cell; (3) The product is a mouse overexpressing the CRX gene, and the CRX gene is overexpressed in the RPE cells of the mouse.

[0010] The present invention also provides a method for inhibiting EMT of retinal pigment epithelial cells, including: overexpressing the CRX gene in retinal pigment epithelial cells.

[0011] Further, the CRX gene is overexpressed in retinal pigment epithelial cells by using an overexpression vector carrying the CRX gene.

[0012] Further, the overexpression vector is a viral vector; Preferably, the viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.

[0013] The present invention also provides a method for increasing E-cadherin and Occludin in RPE cells, comprising: overexpressing the CRX gene in retinal pigment epithelial cells.

[0014] Further, the CRX gene is overexpressed in retinal pigment epithelial cells by using an overexpression vector carrying the CRX gene.

[0015] Further, the overexpression vector is a viral vector; Preferably, the viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.

[0016] Compared with the prior art, the present invention has the following advantages: 1. Significant effect: By overexpressing CRX, E-cadherin and Occludin in RPE cells are increased, thereby significantly inhibiting EMT.

[0017] 2. High innovation: Overexpressing CRX in RPE cells can resist low-density passage and TGF-β1-induced EMT, and play a protective role in the retina, providing new ideas and methods for preventing and treating the formation of subretinal fibrosis in AMD, and can also be used for preventing and treating retinal degeneration in high myopia.

[0018] 3. Wide application: It has important application value for inhibiting EMT of RPE cells, and may also inhibit EMT of other cells, thus having potential application value for diseases caused by cell EMT. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Determining the overexpression of CRX in iPSC-RPE cells by WB and quantitative analysis methods (n = 3); Figure 2 : Determining that overexpressing CRX can inhibit EMT caused by low-density passage by WB and quantitative analysis methods (n = 3); Figure 3 : Determining that overexpressing CRX can inhibit EMT caused by TGF-β1 by WB and quantitative analysis methods (n = 3).

[0020] Figure 4 : After 1 week of lentivirus carrying the CRX gene infecting, determining the high expression of CRX in RPE by immunofluorescence (n = 3); Figure 5: Changes in the fibrotic area size at different time points after laser induction in the empty vector group and CRX overexpression group by Masson staining; Figure 6 : Detection of changes in the fibrotic area size of choroidal spreads and quantitative analysis at different time points after laser induction in the empty vector group and CRX overexpression group by immunofluorescence staining (n = 3). Specific implementation manners

[0021] To understand the present invention more clearly, the present invention is further described below with reference to the following examples and drawings. The examples are only for explanation and do not limit the present invention in any way. In the examples, all original reagent materials can be obtained commercially. The experimental methods without specific conditions are conventional methods and conventional conditions well-known in the art, or are carried out according to the conditions recommended by the instrument manufacturer.

[0022] In the following examples, 293FT was purchased from ATCC; iPSC-RPE cells were differentiated in our laboratory. All animal experimental procedures in the present invention were strictly carried out in accordance with the guiding principles formulated by the Animal Experimental Ethics Committee of Tongji University.

[0023] Example 1. Overexpression of CRX in iPSC-RPE cells inhibits EMT (1) Overexpression of CRX in iPSC-RPE cells Obtaining the CRX gene sequence: Extract RNA from iPSC-RPE cells. Using the Primescript™ RT MasterMix kit, reverse transcribe the extracted mRNA into cDNA. Obtain the CRX gene sequence by PCR. The primers used for PCR are: F: ATTCGAATTTAAATCGGATCCATGATGGCGTATATGAACCC (SEQ ID NO. 1); R: CGATCGCAGATCCTTGCGGCCGCCAAGATCTGAAACTTCCAGG (SEQ ID NO. 2). The PCR amplification reaction system includes 25 μL PrimeSTARMax Premix (2×), 10 pmol of each primer F / R, 100 ng of template cDNA, and make up to 50 μL of total volume with ddH2O. PCR reaction conditions: 98°C, 10 min; 98°C, 10 s; 55°C, 15 s; 72°C, 1.5 min; 33 cycles, final extension 72°C, 10 min. After electrophoresis of the product, cut the gel and recover. Use the NanoDrop 2000 spectrophotometer to quantitatively analyze the recovered PCR product to determine the DNA concentration and purity, and store it at -20°C for long term.

[0024] Vector construction: The PCR product was ligated with the pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro vector (Wuhan Miaoling Biotechnology Co., Ltd., P0268) digested with Notl1 and BAMH1 using a ready-to-use seamless cloning kit (Sangon Biotech, B632219). The ligation reaction system contained 10 μL of 2X Seamless cloning Master Mix, 0.3 pmol of the target gene DNA fragment, and 0.1 pmol of the vector plasmid DNA fragment. The total volume was made up to 20 μL with sterilized ddH2O. Ligation was carried out at 50°C for 20 minutes to promote the efficient recombination ligation between the target gene and the vector plasmid DNA fragment. The resulting ligated plasmid was the vector plasmid pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro carrying the CRX gene. After the ligated plasmid was transformed into STBL3 competent cells, colonies were picked, cultured in liquid, and plasmids were extracted.

[0025] Virus preparation and cell transfection: HEK293T cells were seeded into a 10 cm diameter cell culture dish and cultured in DMEM medium containing 4.5 g / L glucose, supplemented with 10% FBS, 50 U / mL penicillin, and 50 mg / mL streptomycin until the cell confluence reached 80%. 10 μg of the vector plasmid pCDH-CMV-MCS-EF1-CopGFP-T2A-Puro carrying the CRX gene, 7.5 μg of psPAX2, and 3 μg of pMD2.G were mixed in 500 μL of DMEM and thoroughly mixed. 4 μL of Lipofectamine 2000 was added to 500 μL of DMEM, inverted and mixed well, and then left to stand for 5 min. The plasmid mixture was slowly added dropwise to the liposome mixture, inverted and mixed well, and left to stand for 10 min. The final mixture was evenly added to HEK293T cells, gently shaken to ensure uniform distribution of the transfection mixture, and then the cell culture dish was returned to the 37°C incubator for continued culture for 8 - 10 h. The medium in each dish was replaced with 15 mL of fresh 4.5 g / L glucose DMEM medium containing 5% FBS, 50 U / mL penicillin, and 50 mg / mL streptomycin. After continued culture for 60 h, the virus-containing supernatant was collected and filtered through a 0.45 μm syringe filter to remove cell debris. The resulting virus was used to infect iPSC-RPE cells. GFP expression was examined by fluorescence microscopy 2 - 3 days later to verify the virus transfection efficiency and successful virus packaging. At the same time, iPSC-RPE cells transfected with a lentivirus carrying an empty vector were used as a control (Control).

[0026] Overexpression of CRX in iPSC-RPE cells was determined by WB and quantitative analysis methods. The results are shown in Figure 1, the expression level of CRX in iPSC-RPE cells increased significantly.

[0027] Among them, Western blot was operated as follows: (1) Preparation of protein samples: Obtain choroid and RPE tissues, add an appropriate amount of protein lysate RIPA containing protease inhibitor, collect RIPA, centrifuge at 12,000 rpm for 20 minutes, and take the supernatant. The protein concentration was determined by BCA quantification method: the concentration of the protein standard was 2 μg / μL. The protein standard was added sequentially according to 0 μL, 1 μL, 2 μL, 4 μL, 8 μL, 16 μL (unit: μL), and ddH2O was added to make up to 20 μL for making the standard curve. Take 2 μL of the sample, make up to 20 μL with ddH2O, add 200 μL of the working solution in the kit to each well, set a blank well, and incubate in a constant temperature incubator at 37°C for 30 minutes. The absorbance was read at a wavelength of 562 nm with an enzyme-labeled instrument, and the sample concentration was calculated according to the protein standard curve. Further calculate the protein sample denaturant required for each sample, adjust the protein concentration of the sample to 1 μg / μL, and after preparation, denature at 100°C in a metal bath for 10 minutes to denature the protein repeatedly. After centrifugation, store at -80°C in the refrigerator.

[0028] (2) Gel preparation: Use a gel rapid preparation kit to prepare a 12.5% gel.

[0029] (3) Electrophoresis: After the stacking gel solidifies, install the tank. Add protein Marker and protein samples in sequence, ensure that the protein mass in each well is the same, and generally the loading volume is 20 μL. Connect the power supply, keep the voltage at 80 V, and after 30 minutes, adjust the voltage to 110 V. Determine the electrophoresis time according to the size of the target protein band.

[0030] (4) Membrane transfer: First, activate the PVDF membrane with methanol, shake on a shaker for 1 minute, wash it with 1×TBST solution after activation. The placement order for membrane transfer is sponge pad → filter paper → gel → PVDF membrane → filter paper → sponge pad. Connect the power supply, keep the current at 300 mA for 120 minutes.

[0031] (5) Incubation with antibodies: After membrane transfer is completed, carefully separate the membrane and place it in a pre-prepared 5% BSA blocking solution for blocking for 1 hour. Then incubate with the diluted primary antibody overnight in a 4°C refrigerator. Wash the membrane 3 times with 1×TBST on a shaker, 10 minutes each time. Incubate the PVDF membrane with the secondary antibody diluted with 5% BSA at room temperature for 1 hour.

[0032] (6)Chemiluminescence: Mix solution A and solution B in the Enhanced chemiluminescen ECL kit at a ratio of 1:1. Lay the PVDF membrane flat on the color development plate, drop the mixed working solution on the membrane, and place it in the luminometer for luminescence color development. The luminescent solution needs to be prepared immediately before use. (2)Overexpression of CRX in iPSC-RPE can enhance its ability to resist EMT Seed the ESC-RPE cells overexpressing CRX and the control ESC-RPE cells into 6-well plates at a ratio of 50% or 25%. Four days later, detect the expression of E-cadherin, Occludin, α-SMA, and Vimentin by Western blot. Low-density (25% ratio) passage can promote EMT in cells, resulting in increased expression of α-SMA and Vimentin and decreased expression of E-cadherin and Occludin. However, after overexpression of CRX, the expression of E-cadherin and Occludin can be significantly increased, while the expression of α-SMA and Vimentin can be decreased. The results are shown in Figure 2 . In addition, after seeding cells at a ratio of 25%, add 5 ng / mL of TGF-β1 to the culture medium. Four days later, detect the expression of α-SMA, Vimentin, E-cadherin, and Occludin. We found that TGFβ1 can significantly induce EMT in cells, resulting in increased expression of α-SMA and Vimentin and decreased expression of E-cadherin and Occludin. However, after overexpression of CRX, the expression of E-cadherin and Occludin can be significantly increased, while the expression of α-SMA and Vimentin can be decreased. The results are shown in Figure 3 .

[0033] Example 2. Overexpression of CRX in mouse RPE cells can inhibit EMT in RPE and reduce subretinal fibrosis (1)Inject the virus carrying the CRX gene into the subretinal space to overexpress CRX in mouse RPE cells Virus preparation: Prepare the lentivirus carrying the CRX gene according to the method in Example 1.

[0034] Model establishment: Male C57BL / 6J mice at 6 - 8 weeks old were randomly divided into 2 groups: laser injury group, empty vector group, and treatment group. There were 40 mice in each group. Mice were anesthetized by intraperitoneal injection of 4% chloral hydrate at a dose of 500 mg / kg. The right eye of each mouse was instilled with compound tropicamide eye drops for mydriasis, and levofloxacin eye ointment was used as the medium on the mouse cornea and contact lens surface. Using a 532 nm argon laser, four to six laser spots were selected at each fundus around the optic disc. The photocoagulation site was more than 2 optic disc diameters away from the optic disc and avoided large blood vessels. The disruption of Bruch's membrane was confirmed by the formation of subretinal bubbles after laser application. Ten days after laser injury, lenti - CRX or empty vector GFP was injected into the subretinal space, and the fundus of the mice was observed, and grouping and labeling were done well. And the mice were randomly sacrificed on the 7th and 21st days after injection to further quantify subretinal fibrosis.

[0035] (2)CRX inhibits EMT of RPE cells and reduces subretinal fibrosis We observed that the lentivirus mainly infected RPE cells, and the results are shown in Figure 4 . We performed Masson staining and immunostaining on choroidal flat mounts. Masson staining showed that compared with the normal retina with continuous retinal structure, the changes in the choroid and outer nuclear layer (ONL) in the laser burn center were significantly damaged 7 days after laser photocoagulation. Subsequently, 14 days after laser photocoagulation, retinal edema and newly formed blood vessels extended into the subretinal space, and the results are shown in Figure 5 . Compared with the blank vector group at 7 days and 14 days, the collagen area in the CRX group was significantly reduced, and the results are shown in Figure 6 . These results indicate that overexpression of CRX can reduce laser - induced subretinal fibrosis in mice.

[0036] Among them, the operation of immunofluorescence staining is as follows: The eyeballs were fixed with 4% PFA, and frozen sections were made. The samples were blocked with 3% BSA at room temperature for 1 hour, and the primary antibody against human Collagen1 diluted with 3% BSA (abcam company) was added, placed in a wet box to prevent drying, and incubated overnight at 4°C. Washed 3 times with PBS, 5 minutes each time; added the secondary antibody labeled with fluorescein diluted with 3% BSA, placed in a wet box, incubated overnight at 4°C in the dark, washed 3 times with PBS, 5 minutes each time; stained the cell nuclei with 0.5 μg / mL DAPI for 5 minutes, sealed with a fluorescent mounting medium, and observed under a fluorescence microscope. Overexpression of CRX can reduce the production of Collagen 1. Obviously, the above - mentioned embodiments are only examples for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or alterations can be made based on the above description.

Claims

1. Use of CRX in the preparation of a drug as described in (1) or (2) below, characterized in that, The drug contains a vector overexpressing CRX gene; (1) A drug for inhibiting the epithelial-mesenchymal transition of retinal pigment epithelial cells; (2) A drug for preventing and / or treating subretinal fibrosis in age-related macular degeneration.

2. The application according to claim 1, characterized in that The vector is a viral vector; The viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.

3. The application according to claim 1, characterized in that, The epithelial-mesenchymal transition is induced by low-density passage and TGF-β1.

4. A product according to any one of the following 1-3, characterized in that (1) The product is a pharmaceutical composition, and the pharmaceutical composition comprises a vector overexpressing CRX gene; The vector is a viral vector; The viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector; (2)The product is a cell overexpressing CRX a gene, and the cell is an iPSC-RPE cell or an RPE cell; (3)The product is a mouse overexpressing CRX gene, and CRX gene is overexpressed in the RPE cells of the mouse.

5. A method for inhibiting epithelial-mesenchymal transition of retinal pigment epithelial cells, characterized in that, including: Overexpress the CRX gene in retinal pigment epithelial cells.

6. The method according to claim 5, characterized in that, By overexpressing a vector carrying CRX the gene in retinal pigment epithelial cells CRX to overexpress the gene.

7. The method according to claim 6, characterized in that, The overexpression vector is a viral vector; Preferably, the viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.

8. A method for increasing the content of E-cadherin and Occludin in retinal pigment epithelial cells, characterized in that, including: Overexpress the CRX gene in retinal pigment epithelial cells.

9. The method according to claim 8, characterized in that, By overexpressing the CRX gene in retinal pigment epithelial cells using an overexpression vector carrying the CRX gene.

10. The method according to claim 9, wherein The overexpression vector is a viral vector; The viral vector is a lentiviral vector, an adeno-associated viral vector or an HSV-1 viral vector.