Application of SNRPD3 in preparation of medicine for treating ovarian cancer

Abstract

The invention discloses application of SNRPD3 in preparation of a medicine for treating ovarian cancer, and belongs to the technical field of biological medicine. The invention provides application of a reagent for inhibiting or down-regulating SNRPD3 expression in preparation of drugs for treatment or adjuvant treatment of ovarian cancer. The reagent is siRNA or an ASO drug targeting SNRPD3. The invention proves that the apoptosis of the serous ovarian cancer cells can be increased and the growth of transplanted tumors of the serous ovarian cancer cells in mice can be inhibited by interfering the expression of the SNRPD3; an ASO drug targeting SNRPD3 can reduce SNRPD3 expression, and in-vitro experiments prove that the ASO drug can inhibit malignant biological behaviors of ovarian cancer cells; the siRNA is combined to inhibit SNRPD3 and a PARP inhibitor (PARPi) to treat ovarian cancer cells, and in-vitro experiments prove that the apoptosis ratio of the ovarian cancer cells is obviously increased by combining the siRNA and the PARP inhibitor. The invention provides a new treatment approach for ovarian cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of SNRPD3 in the preparation of drugs for treating ovarian cancer. Background Art

[0002] The information disclosed in the background art of the present invention is only intended to enhance the overall understanding of the present invention, and is not necessarily regarded as an admission or an indication in any form that this information constitutes the prior art that is already well-known to those of ordinary skill in the art.

[0003] Ovarian cancer is one of the common gynecological malignancies. There are often no obvious symptoms in the early stage. Approximately 70% of patients are diagnosed with advanced diseases (stage III - stage IV) at the time of diagnosis. The 5-year survival rate of advanced patients is only about 30%. The initial treatment strategy for ovarian cancer includes cytoreductive surgery combined with platinum-based chemotherapy, but most patients gradually develop chemotherapy resistance and face the problems of recurrence and metastasis. In recent years, the emergence of PARP inhibitors has gradually changed the traditional treatment mode of "surgery + chemotherapy + follow-up observation" to "surgery + chemotherapy + maintenance treatment". However, it is still unable to change the outcome of ovarian cancer progression or recurrence, and new treatment strategies are needed to improve the disease prognosis.

[0004] Alternative splicing is an important mechanism for regulating gene expression and generating proteome diversity. Alternative splicing usually changes the function of proteins and may produce oncogenes or inactivate tumor suppressor genes. Targeting genes related to alternative splicing has great application potential for the treatment of malignant tumors. By deeply studying the specific splicing dysregulation in ovarian cancer, revealing the molecular mechanisms and related functions of splicing dysregulation in ovarian cancer, and developing new therapeutic methods for regulating RNA splicing will open up a new approach and strategy for ovarian cancer treatment; however, related research in ovarian cancer is still in its infancy. Summary of the Invention

[0005] In view of this, the present invention provides the application of SNRPD3 in the preparation of drugs for treating ovarian cancer. The present invention discovers that SNRPD3 is a key core splicing factor involved in the occurrence and development of ovarian cancer. SNRPD3 can be used as a therapeutic target for ovarian cancer. Interfering with or inhibiting the expression of SNRPD3 can inhibit the proliferation and growth of ovarian cancer cells, and drugs targeting SNRPD3 can be used to inhibit the growth of ovarian cancer cells.

[0006] In the first aspect, the present invention provides the application of a reagent for inhibiting or downregulating the expression of SNRPD3 in the preparation of drugs for treating or adjuvantly treating ovarian cancer.

[0007] SNRPD3 is a small ribonucleoprotein D3 polypeptide. As a core member of the Sm protein family, it mainly forms small nuclear ribonucleoproteins (snRNPs) by binding to small nuclear RNAs and plays an important role in mRNA splicing and regulation. However, its role in the treatment of ovarian cancer has not been reported yet.

[0008] In one or more embodiments of the present invention, the reagent is siRNA, and the sequence of the siRNA is SEQ ID NO.2 or SEQ ID NO.3.

[0009] In one or more embodiments of the present invention, the reagent is an ASO drug targeting SNRPD3, and the nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.6.

[0010] In one or more embodiments of the present invention, the ovarian cancer is serous ovarian cancer.

[0011] In one or more embodiments of the present invention, the reagent is used to inhibit the proliferation or migration of ovarian cancer cells or promote the apoptosis of ovarian cancer cells.

[0012] Furthermore, the ovarian cancer cells include HEY, SKOV3 or OVCAR8.

[0013] In a second aspect, the present invention provides a pharmaceutical composition for treating ovarian cancer, comprising a reagent that inhibits or down-regulates the expression of SNRPD3 and a pharmaceutically acceptable excipient.

[0014] In one or more embodiments of the present invention, the reagent that inhibits or down-regulates the expression of SNRPD3 is siRNA, and the sequence of the siRNA is SEQ ID NO.2 or SEQ ID NO.3.

[0015] In one or more embodiments of the present invention, the reagent that inhibits or down-regulates the expression of SNRPD3 is an ASO drug, and the nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.6.

[0016] In one or more embodiments of the present invention, the pharmaceutical composition is an oral preparation or an injection preparation.

[0017] In one or more embodiments of the present invention, the pharmaceutical composition further comprises a PARP inhibitor.

[0018] In a third aspect, the present invention provides an ASO drug that targets and inhibits the expression of SNRPD3, and the nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.6.

[0019] Compared with the prior art, the present invention has achieved the following beneficial effects:

[0020] (1) The present invention provides the use of a reagent for inhibiting or downregulating the expression of SNRPD3 in the preparation of a drug for treating ovarian cancer. By transiently transfecting SNRPD3 siRNA, the present invention interferes with the expression of SNRPD3 in serous ovarian cancer. Through MTT, Transwell and colony growth experiments, it is confirmed that the SNRPD3 molecule can promote the proliferation, invasion, migration and colony formation ability of serous ovarian cancer cells; through flow cytometry apoptosis experiments, it is detected and confirmed that interfering with the expression of SNRPD3 can increase the apoptosis of serous ovarian cancer cells.

[0021] (2) Through a mouse tumorigenesis experiment, the present invention confirms that interfering with the expression of SNRPD3 can inhibit the growth of transplanted tumors of serous ovarian cancer cells in mice.

[0022] (3) By synthesizing an ASO drug targeting SNRPD3 to reduce the expression of SNRPD3, in vitro experiments prove that it can inhibit the malignant biological behavior of ovarian cancer cells. Further, by constructing a CDX model, it is confirmed that the ASO drug targeting SNRPD3 significantly inhibits tumor growth. Therefore, the related drugs targeting SNRPD3 may have certain clinical application value for serous ovarian cancer.

[0023] (4) By jointly using siRNA to inhibit SNRPD3 and PARP inhibitor (PARPi) to treat ovarian cancer cells, in vitro experiments prove that the combination of the two significantly increases the apoptosis ratio of ovarian cancer cells. Therefore, the combination of related drugs targeting SNRPD3 and PARPi may provide a new treatment plan for the clinical treatment of ovarian cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The accompanying drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 Detection results of SNRPD3 mRNA (A), immunoblotting results (B), relative cell survival rate (C) and colony formation (D) ability of the control group, ovarian cancer cell lines HEY, SKOV3, and OVCAR8 with SNRPD3 silenced by siRNA in Example 1 of the present invention;

[0026] Figure 2Detection results of the migration and invasion abilities of the control group in Example 1 of the present invention, ovarian cancer cell lines HEY, SKOV3, and OVCAR8 with SNRPD3 silenced by siRNA; among them, A is a representative picture of the Transwell experiment of the cells in the SNRPD3 knockdown group (si-SNRPD3#1 and si-SNRPD3#2) and the control group (si-NC); B is the statistical analysis of the Transwell data in A.

[0027] Figure 3 Representative pictures of the apoptosis levels of the cells in the SNRPD3 knockdown group (si-SNRPD3#1 and si-SNRPD3#2) and the control group (si-NC) detected by flow cytometry in Example 2 of the present invention.

[0028] Figure 4 Representative pictures of the mouse xenograft tumors (A), statistical charts of tumor volume (B), and statistical charts of tumor mass (C) of the cells in the interference group (PLKO.1-SNRPD3#1 and PLKO.1-SNRPD3#2) and the control group (PLKO.1-ctrl) in Example 3 of the present invention.

[0029] Figure 5 Detection results of the relative cell survival rate (A) and colony formation (B) abilities of the control group, ovarian cancer cell lines HEY, SKOV3, and OVCAR8 with SNRPD3 silenced by ASO drug in Example 4 of the present invention.

[0030] Figure 6 Detection results of the migration and invasion abilities of the control group, ovarian cancer cell lines HEY, SKOV3, and OVCAR8 with SNRPD3 silenced by ASO drug in Example 4 of the present invention; among them, A is a representative picture of the Transwell experiment of the cells in the ASO drug SNRPD3 silenced group (ASO#1 and ASO#2) and the control group (ASO-NC); B is the statistical analysis of the Transwell data in A.

[0031] Figure 7 Representative pictures of the mouse xenograft tumors (A), statistical charts of tumor volume (B), and statistical charts of tumor mass (C) of the cells in the drug treatment group (SNRPD3 ASO#2) and the control group (ASO-NC) in Example 5 of the present invention.

[0032] Figure 8 Effect of flow cytometry analysis on the apoptosis of tumor cells by inhibiting the expression of SNRPD3 with siRNA and treating with gradient PARP inhibitor olaparib in SKOV3 cells in Example 6 of the present invention. Detailed implementation manners

[0033] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0034] As introduced in the background art, there has been no study on the relationship between SNRPD3 and ovarian cancer and its mechanism in the occurrence and development of ovarian cancer. In order to clarify the mechanism of SNRPD3 in the occurrence and development of ovarian cancer and provide better treatment for ovarian cancer patients, the present invention studies the mechanism of SNRPD3 expression in the occurrence and development of ovarian cancer, and clarifies the effect of SNRPD3 on the proliferation and metastasis of ovarian cancer cells. Further research is carried out on the ASO drug targeting SNRPD3, and the research shows that the ASO drug targeting SNRPD3 inhibits the growth of tumors in the mouse CDX model.

[0035] The technical solution of the present invention will be further elaborated below with specific embodiments. The HEY cell line used in the following examples was provided by the laboratory of Dr. Liu at Shandong University, the SKOV3 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences, and the OVCAR8 cell line was provided by the Characterization Cell Line Core Facility of MD Anderson Cancer Center. The SNRPD3 antibody was purchased from Invitrogen, and the catalog number was PA5-51524.

[0036] Example 1 Biological function of SNRPD3 in ovarian cancer cells

[0037] 1. siRNA gene silencing

[0038] The siRNA silencing technology was used to inhibit the expression of SNRPD3 in the in vitro cultured ovarian cancer cell lines HEY, SKOV3, and OVCAR8. RNA and cell proteins were extracted, and qRT-PCR and immunoblotting were used to analyze and verify the expression level of mRNA and protein of SNRPD3. The results are shown in Figure 1 A and B as shown, and the siRNA silencing technology was used to inhibit the expression of SNRPD3. The expression level of SNRPD3 in ovarian cancer cells decreased significantly, indicating that the siRNA silencing was successful.

[0039] The siRNA sequences used in this example are as follows:

[0040] si-NC: UUCUCCGAACGUGUCACGUTT (SEQ ID NO.1);

[0041] si-SNRPD3#1: CACCCAUGUUAAAGAGCAUGAtt (SEQ ID NO.2);

[0042] si-SNRPD3#2: GUCCAACAUCACAGUCACAUAtt (SEQ ID NO.3).

[0043] Among them, si-NC is a control siRNA with no specific targeting; si-SNRPD3#1 and si-SNRPD3#2 are specific si-RNAs targeting SNRPD3 expression.

[0044] The specific steps are as follows:

[0045] a. Digest and centrifuge ovarian cancer cell lines HEY, SKOV3, and OVCAR8 respectively, count them, and inoculate them in 6-cm culture dishes overnight.

[0046] b. Dissolve si-SNRPD3#1 and si-SNRPD3#2 dissolved in 10 μL of RNase-free water in 500 μL of Opti-MEM medium respectively, and set up a control; dissolve 10 μL of the finished product Lipo-2000 in 500 μL of Opti-MEM medium, blow and suck evenly, and let it stand for 5 min.

[0047] c. Mix the control group, the dissolved si-SNRPD3#1 and si-SNRPD3#2 with the dissolved Lipo-2000 respectively, blow and suck evenly, and let it stand for 25 min.

[0048] d. Discard the cell culture medium, carefully add the above liquids to the cell culture dishes respectively, add 1 mL of Opti-MEM medium, shake evenly, culture in an incubator for 6 h, and then change to normal medium.

[0049] e. Extract RNA after 24 h and extract protein after 48 h.

[0050] 2. Cell proliferation experiment

[0051] Digest and centrifuge the control group, ovarian cancer cell lines HEY, SKOV3, and OVCAR8 with silenced SNRPD3 respectively, and seed them in 96-well culture plates (1×10 3 each well), add 20 μL of MTT solution at 0 h, 24 h, 48 h, 72 h, 96 h, and 120 h respectively, incubate for 4 h, discard the culture medium, add 100 μL of DMSO solution to dissolve the crystals, and measure the absorbance at a wavelength of 490 nm. Use the colony formation assay to detect the effect of knocking down SNRPD3 on the cell colony formation ability. As Figure 1 shown in C and D below, knocking down SNRPD3 significantly inhibits the proliferation ability and colony formation ability of ovarian cancer cell lines.

[0052] 3. Transwell experiment

[0053] Transwell chambers were used for analyzing cell migration ability, and Transwell chambers coated with Matrigel were used for analyzing invasion ability, with a pore size of 0.8 μm. The above-mentioned control group and the cell line with SNRPD3 silenced were resuspended in serum-free medium and seeded into the chambers (5×10 4 cells / well), and cultured for the corresponding time according to the cell characteristics. The cells that did not pass through the pores on the upper layer of the chamber were removed with a cotton swab, and the cells that had passed through the membrane on the lower layer were fixed with methanol for 15 min, stained with 0.1% crystal violet for 20 min, and then observed under a microscope. Five fields of view were randomly observed and the number of cells that had passed through the membrane was counted. As Figure 2 shown in A and B of , it can be seen that knocking down SNRPD3 significantly inhibited the invasion and migration ability of ovarian cancer cell lines.

[0054] Example 2 Detection of promoting apoptosis of serous ovarian cancer cells by interfering with SNRPD3 expression.

[0055] The apoptosis experiment was carried out according to the instructions of the cell apoptosis kit, which is briefly described as follows: The cells were digested and counted, one million cells were taken out and resuspended in 1 ml of staining buffer. The PBS was aspirated and discarded, and the cells were resuspended in 100 μL of 1×Binding Buffer; 5 μL of Annexin V-FITC and 10 μL of PI Staining Solution were added and gently mixed; the reaction was carried out in the dark at room temperature for 10 - 15 min; 400 μL of 1×Binding Buffer was added, and after mixing, the sample was placed on ice and detected by a flow cytometer within 1 hour. The results are as Figure 3 shown, and it can be seen that silencing SNRPD3 expression can induce apoptosis of SKOV3 and OVCAR8 cells.

[0056] Example 3 Tumorigenesis experiment in animals

[0057] To verify whether SNRPD3 has the same function in vivo, the inventors cloned the shSNRPD3 sequences and the control sequences designed based on the sequences of si-SNRPD3#1 and si-SNRPD3#2 into the PLKO.1 vector and transfected HEY cells to establish stable transfected cell lines for nude mouse tumorigenesis experiments. The inventors injected two groups of cell lines into the armpits of nude mice at 5×10 6 cells, and observed their tumorigenic ability. After 2 - 4 weeks of observation and measurement, the inventors sacrificed all nude mice by cervical dislocation, dissected the in-situ tumors for measurement. The results are as Figure 4 shown, and the experimental results show that the tumor growth ability of the mice in the PLKO.1-shSNRPD3 group was significantly lower than that of the control group.

[0058] Example 4 ASO targeted interference of SNRPD3 expression

[0059] Antisense oligonucleotides (ASO) are a type of small nucleic acid drug. Small nucleic acid drugs have strong target specificity, are easy to design, and have a short R & D cycle, making them a powerful tool for disease treatment. The inventors designed a specific ASO sequence targeting SNRPD3, and used the ASO transient transfection technique to inhibit the expression of SNRPD3 in the ovarian cancer cell lines HEY, SKOV3, and OVCAR8 cultured in vitro, and conducted the above-related experiments. The specific experimental methods were the same as those in Example 1.

[0060] The ASO sequences used in this example are as follows:

[0061] ASO-NC: GCGTATTATAGCCGATTAAC (SEQ ID NO.4);

[0062] ASO#1: CAGTACTTTAATCGGCACAC (SEQ ID NO.5);

[0063] ASO#2: ATGTATACCTGCTCCAGCTG (SEQ ID NO.6).

[0064] Among them, ASO-NC is a nonsense control sequence.

[0065] As Figure 5 shown in A and B, the targeted interference of SNRPD3 expression by ASO significantly inhibited the proliferation ability and colony formation ability of ovarian cancer cell lines. As Figure 6 shown in A and B, the targeted interference of SNRPD3 expression by ASO significantly inhibited the invasion and migration ability of ovarian cancer cell lines.

[0066] Construction of the CDX model and subcutaneous administration in Example 5

[0067] To verify whether SNRPD3 has the same function in vivo, the inventors constructed a CDX model. After the inventors amplified cells in vitro, digested them, centrifuged them, and counted them, they prepared equal amounts of cells. Four-week-old female nude mice were taken, and after skin disinfection, 150 μL of cell suspension was injected at the armpit, and then they were continued to be raised conventionally. When the major axis of the tumor tissue reached 0.5 cm, the formal experiment was carried out.

[0068] 1 OD of ASO drug (ASO#2 in Example 4) was dissolved in 25 μL of opti-MEM solution and 3 μL of lipo 2000 was added. After mixing, it was subcutaneously injected into the tumor mass at multiple points to observe its effect on the tumors of CDX mice. After 3 weeks of observation and measurement, the inventors sacrificed all the nude mice by cervical dislocation, dissected the tumor masses for measurement. The experimental results are as Figure 7 shown. The tumor growth ability of the mice in the SNRPD3 ASO#2 treatment group was significantly lower than that of the control group (ASO-NC).

[0069] Example 6 Detection of the combined use of siRNA to inhibit SNRPD3 and PARP inhibitor to promote apoptosis of serous ovarian cancer cells

[0070] The inventors used siRNA to inhibit SNRPD3 expression and PARP inhibitor (olaparib) to treat ovarian cancer cells and conducted the above-mentioned related experiments. The specific experimental method was the same as that in Example 2. The results are as follows Figure 8 shown. It can be seen that silencing SNRPD3 expression can induce apoptosis of SKOV3 cells, and the combined use of siRNA to inhibit SNRPD3 expression and PARP inhibitor further promotes apoptosis of SKOV3 cells.

[0071] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a reagent for inhibiting or down-regulating SNRPD3 expression in the preparation of a drug for treating or adjuvantly treating ovarian cancer.

2. The application according to claim 1, characterized in that The reagent is siRNA, and the sequence of the siRNA is SEQ ID NO.2 or SEQ ID NO.

3.

3. The application according to claim 1, characterized in that The reagent is an ASO drug targeting SNRPD3, and the nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.

6.

4. The application according to claim 1, characterized in that The ovarian cancer is serous ovarian cancer.

5. The application according to claim 1, characterized in that The reagent is used for inhibiting the proliferation or migration of ovarian cancer cells or promoting the apoptosis of ovarian cancer cells.

6. The application according to claim 5, wherein The ovarian cancer cells include HEY, SKOV3 or OVCAR8.

7. A pharmaceutical composition for treating ovarian cancer, characterized in that, It includes a reagent for inhibiting or down-regulating SNRPD3 expression and a pharmaceutically acceptable excipient.

8. The pharmaceutical composition according to claim 7, wherein The reagent for inhibiting or down-regulating SNRPD3 expression is siRNA, and the sequence of the siRNA is SEQ ID NO.2 or SEQ ID NO.3; or, the reagent for inhibiting or down-regulating SNRPD3 expression is an ASO drug, and the nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.

6.

9. The pharmaceutical composition according to claim 7, characterized in that, The pharmaceutical composition further includes a PARP inhibitor.

10. An ASO drug that targets and inhibits the expression of SNRPD3, characterized in that, The nucleotide sequence of the ASO drug is SEQ ID NO.5 or SEQ ID NO.6.

Images