Acid-resistant Dehalogenococcus and its application

Abstract

The present invention belongs to the field of environmental pollution remediation, specifically an acid-resistant Dehalogenating Coccidioides and its application. The strain is a Dehalogenating Coccidioides that tolerates acidic conditions ( Dehalococcoides mccartyi NK, deposited with the General Microbiology Center of the China General Culture Collection Administration on February 13, 2025, with the culture deposit number CGMCC No. 46384. The NK strain of the present invention can be used for in situ bioremediation of various organochlorine pollutants in low-pH groundwater and soil, overcoming the limitations of traditional dehalogenating microorganisms in their poor adaptability to acidic environments. It can significantly improve in situ dechlorination efficiency and greatly reduce the cost of adding exogenous pH buffers, targeting dechlorination stagnation and accumulation of toxic intermediates caused by pH reduction during site remediation.

Description

Technical Field

[0001] The present invention belongs to the field of environmental pollution remediation, and specifically relates to an acid-resistant dehalogenating coccidioides and an application thereof. Background Art

[0002] Organochlorine compounds are widely used in industrial and agricultural production activities and are a major category of environmental pollutants monitored globally. Among them, tetrachloroethylene (Tetrachloroethene) and trichloroethene (Trichloroethene) are widely used as organic solvents, and vinyl chloride (Vinyl chloride) is a key precursor in the synthesis of polyvinyl chloride (PVC) plastics. The World Health Organization's International Agency for Research on Cancer lists tetrachloroethene as a suspected Class 2A carcinogen, while trichloroethene and vinyl chloride are Class 1 human carcinogens. Furthermore, tetrachloroethene and trichloroethene are included in my country's first list of toxic and hazardous water pollutants. 1,2-Dichloroethane is also a highly toxic chemical and is listed as a controlled pollutant in my country's Groundwater Quality Standard (GB / T14848-2017). These short-chain organochlorine compounds are stable and difficult to degrade naturally in the environment. Once enriched and transported into groundwater through rivers or rainwater, they can easily become persistent sources of pollution, posing a long-term threat to water quality and human health. Therefore, their degradation and transformation have become a hot topic of research in environmental bioremediation technologies.

[0003] Dehalogenating microorganisms utilize organic chlorides as electron acceptors at the end of their respiratory chain for energy metabolism, generating chlorine-free or low-chlorine-substituted, easily degradable end products. This process, known as organohalogen respiration, is a major pathway for the degradation and transformation of chlorinated olefins and chlorinated alkanes in anaerobic environments. Dehalogenating microorganisms are sensitive to fluctuations in a range of environmental factors, including pH. A pH of 6.0 can lead to decreased dechlorination activity and cell growth arrest, accompanied by the accumulation of highly toxic intermediates (e.g., monochloroethylene). Previous studies have not reported dehalogenating microorganisms capable of stably dechlorinating vinyl chlorides to ethylene at pH levels as low as 5.5. For example, Vainberg et al. reported in 2009 that the optimal pH for the dechlorination of tetrachloroethylene using the SDC-9™ bioaugmentation agent is 6.0-6.8. At pH levels below 5.5, tetrachloroethylene and trichloroethylene are reduced exclusively to cis-dichloroethylene. In 2014, Lacroix reported the effect of pH on the dechlorination rate of several anaerobic dechlorination enrichment culture systems (SL2-PCEa, SL2-PCEb, AQ-1, and PM). Similarly, the dechlorination of cis-dichloroethylene to ethylene stagnates when the pH is below 5.5, resulting in the accumulation of the intermediate monochloroethylene. The research content was published in the journals of Journal of Industrial Microbiology and Biotechnology and Applied and Environmental Microbiology. The soil and groundwater of many organochlorine-contaminated sites are naturally weakly acidic. The hydrochloric acid released by the reductive dechlorination reaction can further reduce the pH of the medium. Therefore, dehalogenating biological materials that can tolerate acidic environments are an important requirement for bioremediation projects of organochlorine-contaminated sites. Summary of the Invention

[0004] The present invention aims to provide an acid-resistant Dehalogenococcus Dehalococcoides mccartyi )NK and its application in environmental bioremediation.

[0005] To achieve the above object, the technical solutions adopted by the present invention are as follows:

[0006] A strain of acid-resistant Dehalogenococcus, which is a Dehalogenococcus strain that tolerates acidic conditions ( Dehalococcoides mccartyi )NK, was deposited in the General Microbiology Center of China Culture Collection Administration on February 13, 2025. The depository address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the culture deposit number is CGMCC No. 46384.

[0007] The Dehalococcidioides NK is grown in an anaerobic inorganic salt liquid culture medium with a pH of 5.5 and containing 60 mM 2-(N-morpholino)ethanesulfonic acid buffer salt, with acetic acid as a carbon source, H2 as an electron donor, and a chlorinated olefin or chlorinated alkane as an electron acceptor.

[0008] The Dehalogenococcus NK was isolated from a river sediment sample in the Xihe River Basin in Shenyang City and grew in an anaerobic inorganic salt culture medium containing trichloroethylene, H2 and acetic acid.

[0009] The isolation and culture technology of Dehalogenococcus NK includes the following steps: enriching and subculturing the bacteria in a pH 5.5 culture medium containing river sediment and supplemented with trichloroethylene for ten times, and using the mixed bacterial solution as an inoculum to obtain a pure culture using the extinction dilution separation method.

[0010] An application of the acid-resistant Dehalogenococcus sp., and an application of the strain in degrading organochlorine pollutants.

[0011] The organochlorine pollutants are various chlorinated olefins and / or chlorinated alkanes.

[0012] The various chlorinated alkenes are tetrachloroethylene, trichloroethylene, cis-1,2-dichloroethylene, trans-1,2-dichloroethylene, 1,1-dichloroethylene, and monochloroethylene; the chlorinated alkane is 1,2-dichloroethane.

[0013] A preparation for degrading organic chlorinated pollutants, the preparation containing the acid-resistant dehalogenating coccidioides ( Dehalococcoides mccartyi ) NK strain.

[0014] The preparation is the acid-resistant Dehalogenococcus Dehalococcoides mccartyi ) NK culture, culture concentrate or culture suspension.

[0015] An application of the preparation for degrading organochlorine pollution, and an application of the preparation in remediating scenes contaminated by organochlorine pollutants.

[0016] The organochlorine pollutants are various chlorinated olefins and / or chlorinated alkanes.

[0017] The culture is grown in an anaerobic liquid inorganic salt medium with a pH of 5.5 containing 60 mM 2-(N-morpholino)ethanesulfonic acid buffer, or a medium with a pH of 7.2 containing 30 mM sodium bicarbonate buffer, with acetic acid as a carbon source, H2 as an electron donor, and a chlorinated olefin or chlorinated alkane as an electron acceptor; the culture concentrate is cultured in an anaerobic liquid inorganic salt medium with a pH of 5.5 containing 60 mM 2-(N-morpholino)ethanesulfonic acid buffer, or a medium with a pH of 7.2 containing 30 mM sodium bicarbonate buffer, with acetic acid as a carbon source, H2 as an electron donor, and a chlorinated olefin or chlorinated alkane as an electron acceptor, followed by centrifugation to remove the liquid medium, and storing the precipitated bacteria in a sealed anaerobic vial to obtain the culture concentrate; and the culture concentrate obtained is resuspended in the liquid medium to obtain a culture bacterial suspension.

[0018] The advantages of the present invention are:

[0019] The strain, isolated from river sediment samples, belongs to the genus Dehalogenococcus at the taxonomic level. In an anaerobic inorganic salt medium with acetic acid as the carbon source and at pH 5.5, the Dehalogenococcus NK strain completely dechlorinated 50 μmol of tetrachloroethylene in 90 days, 110 μmol of trichloroethylene in 60 days, 120 μmol of 1,2-dichloroethane in 20 days, and 80 μmol of highly toxic, difficult-to-anaerobic monochloroethylene in 45 days. This strain completely dechlorinated various organochlorine pollutants, producing ethylene as the non-toxic final product. The strain is also tolerant to certain pH fluctuations, overcoming dechlorination stagnation caused by pH reduction during site remediation, reducing the cost of adding exogenous buffers during the environmental remediation process, and effectively remediating environments contaminated by complex organic chlorides. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a scanning electron microscope image of the acid-resistant Dehalogenococcus NK strain of the present invention.

[0021] Figure 2 The present invention provides a phylogenetic evolutionary tree constructed by homology comparison of 16S rRNA gene sequences of the acid-resistant Dehalogenococcus NK and related strains.

[0022] Figure 3 The graph is a dechlorination degradation curve of organochlorine pollutants by the acid-resistant Dehalococcus NK of the present invention under pH 5.5 conditions; wherein a is the dechlorination degradation curve of tetrachloroethylene, b is the dechlorination degradation curve of trichloroethylene, c is the dechlorination degradation curve of trans-1,2-dichloroethylene, d is the dechlorination degradation curve of 1,1-dichloroethylene, e is the dechlorination degradation curve of monochloroethylene, and f is the dechlorination degradation curve of 1,2-dichloroethane.

[0023] Figure 4 The dechlorination rates of trichloroethylene and 1,2-dichloroethane by the acid-resistant Dehalogenococcus NK strain of the present invention at different pH values ​​are as follows: a is the dechlorination rate of trichloroethylene at pH 7.2, pH 5.5, and pH 5.2; and b is the dechlorination rate of 1,2-dichloroethane at pH 7.2, pH 5.5, and pH 5.2. DETAILED DESCRIPTION

[0024] The specific embodiments of the present invention are further described below with reference to examples. It should be noted that the specific embodiments described here are only for illustrating and explaining the present invention, and are not intended to limit the present invention.

[0025] The Dehalogenococcus NK strain of the present invention is isolated from a river sediment sample and belongs to the genus Dehalogenococcus at the taxonomic level. The Dehalogenococcus NK strain still maintains high dechlorination activity for all six vinyl chloride compounds and 1,2-dichloroethane in an anaerobic inorganic salt culture medium with a pH as low as 5.5, completely dechlorinating 110 μmol of trichloroethylene in 60 days and 120 μmol of 1,2-dichloroethane in 20 days. The end product of the degradation of multiple organic chlorides by the strain is all non-toxic ethylene, thus overcoming the dechlorination stagnation caused by the decrease in pH during site remediation and reducing the cost of adding exogenous buffers during the environmental remediation process.

[0026] Unless otherwise specified, the experimental methods, materials and reagents used in the following examples are conventional methods.

[0027] Each liter of inorganic salt anaerobic culture medium contains: NaCl 1.0 g, MgCl2·6H2O 0.5 g, KH2PO4 0.2 g, NH4Cl 0.3 g, KCl 0.3 g, CaCl2·2H2O 0.015 g, FeCl2·4H2O 1.5 mg, CoCl2·6H2O 190 μg, MnCl2·4H2O 100 μg, ZnCl2 70 μg, H3BO 36 μg, Na2MoO4·2H2O 36 μg, NiCl2·6H2O 24 μg, CuCl2·2H2O 2 μg, Na2SeO3·5H2O 6 μg, Na2WO4·2H2O 8 μg, and resazurin sodium 0.025% (w / v) as an oxygen indicator. The culture medium was brought to a boil under a stream of high-purity nitrogen (N₂) and cooled to room temperature in an ice bath. 24 mg of L-cysteine, 48 mg of Na₂S·9H₂O, and 77 mg of dithiothreitol (DTT) were added as reducing agents to remove oxygen. 11.714 g (60 mM) 2-(N-morpholino)ethanesulfonic acid buffer (MES) was added to the low-pH medium as a buffer, and the pH was adjusted to 5.2-5.5 with 2 M sodium hydroxide. 1 mM NaHCO₃ was added as an inorganic carbon source. 2.52 g (30 mM) NaHCO₃ was added to the neutral-pH medium as a buffer, and the pH was adjusted to 7.2-7.3 with CO₂. After the culture medium headspace was replaced with an N₂ / CO₂ (80 / 20, v / v) mixture, 100 mL of the medium was aliquoted into 160 mL serum bottles, sealed with butyl rubber stoppers and aluminum caps, and autoclaved at 121°C for 30 min.

[0028] Wolin Vitamin Complex: Biotin 20μg / L, Folic Acid 20μg / L, Pyridoxine Hydrochloride 100μg / L, Riboflavin 50μg / L, Thiamine 50μg / L, Pantothenic Acid 50μg / L, Niacin 50μg / L, Vitamin B 12 50μg / L, p-aminobenzoic acid 50μg / L, lipoic acid 50μg / L, filter the vitamin solution with a 0.22μm pore size filter membrane into a sterile 2mL centrifuge tube, store at -20℃ until use, add 0.1mL of Wolin's complex vitamins to every 100mL of culture medium.

[0029] Gas Chromatographic Detection Method for Organic Chloride and Ethylene: Gas chromatography was used to quantitatively analyze vinyl chloride compounds and ethylene. The specific analysis method was as follows: an Agilent 7890B gas chromatograph coupled with a flame ionization detector (FID) was loaded with a DB-624 capillary column (Agilent, 60 m × 0.32 mm × 1.8 µm). The GC parameters were as follows: inlet temperature 200°C; initial column temperature 60°C maintained for 2 minutes, then increased to 200°C at a rate of 25°C / min and held for 1 minute; He as carrier gas, column flow rate 3 mL / min; detector temperature 300°C; H₂ as fuel gas, flow rate 30 mL / min; synthetic air as oxidant, flow rate 350 mL / min; and nitrogen as makeup gas, flow rate 25 mL / min. Liquid samples (500 μL) were withdrawn from the culture flask at regular intervals and analyzed by gas chromatography.

[0030] Example 1: Enrichment, separation and identification of acid-resistant Dehalogenococcus NK of the present invention

[0031] (1) Enrichment of Dehalogenococcus NK: Sediment samples collected from the Xihe River Basin in Shenyang (41°39′N, 123°6′E), inorganic salt culture medium, and other required sterile materials were placed in an anaerobic glove box containing N2 / H2 (95 / 5, v / v) for approximately 2 h. Approximately 3 g of sediment sample was added to a serum bottle containing pH 5.5 culture medium. The serum bottle was sealed with a rubber stopper and transferred out of the glove box. 10 μL of trichloroethylene, 0.1 mL of Wolin vitamin complex, and 10 mL of H2 were added and incubated in a 30°C incubator in the dark. After trichloroethylene was completely degraded to ethylene, the enriched culture was transferred to fresh culture medium at 5% (v / v). Ten consecutive transfers were performed, and the degradation of trichloroethylene was monitored using a gas chromatograph.

[0032] (2) Isolation of Dehalogenococcus NK: After ten consecutive transfers of highly enriched culture, 1 mL of the enriched solution was transferred to a liquid culture medium containing 0.1 mL of monochloroethylene as 10 -1 Dilution gradient, then from 10 -1 Transfer 1 mL of bacterial solution from the dilution bottle to the new culture medium as 10 -2 Repeat this process until you get 10 -10 The dilution culture bottle was cultured at 30℃ in the dark to complete the first round of dilution and separation. After the monochloroethylene was completely degraded, the bacterial solution in the high gradient dilution bottle was transferred to the liquid inorganic salt culture medium for the second round of dilution and separation. -10 After gradient dilution, 10% of the monochloroethylene was completely degraded. -8 The bacterial solution in the dilution bottle was subjected to purity identification to obtain a pure culture solution of the NK strain.

[0033] (3) Identification of Dehalogenococcus NK:

[0034] Morphological identification:

[0035] The degradation bacterial solution obtained in step (2) was centrifuged at 4°C and 15,000 x g for 10 min to collect cells in the logarithmic growth phase. The cells were fixed with 2.5% glutaraldehyde and dehydrated, and the bacterial morphology was observed under an electron microscope (see Figure 1 The results showed that the Dehalogenococcus NK bacteria isolated in the above steps were oblate spherical, with a diameter of about 0.5 μm, no spores formed at both ends, and Gram-negative.

[0036] 16S rRNA sequence homology analysis ( Figure 2 ):

[0037] Total DNA of the strain was extracted, and whole-genome sequencing was performed using a combined Illumina NovaSeq and PacBio HiFi sequencing method. The 16S rRNA gene fragment obtained by whole-genome sequence annotation was 1497 bp and the G+C mol% was 52.2%.

[0038] 16S rRNA gene sequence of Dehalococcus NK

[0039] 5'-AGCTTGGAGAGTTTGATCCTGGCTCAGGATGAACGCTAGCGGGCGTGCCTTATG

[0040]

[0041] Physiological and biochemical characteristics identification:

[0042] The NK strain isolated and purified above was identified as a Gram-negative bacterium.

[0043] The strain was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on ​​February 13, 2025, with the deposit number CGMCC No. 46384.

[0044] Example 2: Dechlorination and degradation of organic chlorides by Dehalogenococcus NK under low pH conditions

[0045] The experiment of dechlorination and degradation of different organic chlorides by Dehalococcus NK in pH 5.5 anaerobic medium was carried out, specifically:

[0046] Using the aforementioned pH 5.5 anaerobic inorganic salt liquid medium, 8 μL of tetrachloroethylene (78.2 μmol / bottle), 5 μL of trans-1,2-dichloroethylene (65.0 μmol / bottle), 8 μL of 1,1-dichloroethylene (99.9 μmol / bottle), and 10 μL of trichloroethylene (111.1 μmol / bottle) were added to every 100 mL of medium. Monochloroethylene, a gas at room temperature and pressure, was added to each bottle (2 mL (81.6 μmol / bottle)). 1,2-dichloroethane was added to each bottle (10 μL (126.6 μmol / bottle). 0.1 mL of Wolin's vitamin complex solution was then added to the system, and a 5% (v / v) pure culture of Dehalogenococcus NK obtained above was inoculated. Each organic chloride treatment was repeated three times, and the cells were incubated in a dark incubator at 30°C. During the dechlorination process, 0.5 mL of liquid from the culture bottle was added to 0.5 mL of deionized water and the dechlorination conversion of organic chlorides in the bottle was monitored using gas chromatography. The dechlorination rate was calculated based on the change in the concentration of dechlorinated products over time. For example, during the reductive dechlorination of trichloroethylene, each molecule of dichloroethylene generated corresponds to 1 Cl - The release of each molecule of vinyl chloride corresponds to 2 Cl - The release of ethylene corresponds to 3 Cl - The linear regression equation is determined by time (X value) and total chloride ion release (Y value). The slope divided by the culture volume is the dechlorination rate, which is expressed in μM Cl. - / d.

[0047] Depend on Figure 3It can be seen that Dehalococcus NK can completely dechlorinate tetrachloroethylene and its dechlorination intermediates (trichloroethylene, cis-1,2-dichloroethylene, and monochloroethylene) at pH 5.5 (a), and can completely dechlorinate trichloroethylene (b), trans-1,2-dichloroethylene (c), 1,1-dichloroethylene (d), monochloroethylene (e), and 1,2-dichloroethane (f). The dechlorination period for 75 μmol tetrachloroethylene is about 90 days, the dechlorination period for 110 μmol trichloroethylene is about 60 days, the dechlorination period for 65 μmol trans-dichloroethylene is about 37 days, the dechlorination period for 84 μmol 1,1-dichloroethylene is about 93 days, the dechlorination period for 80 μmol monochloroethylene is about 45 days, and the dechlorination period for 120 μmol The dechlorination period of 1,2-dichloroethane was about 20 days, and the average dechlorination rates were 28.6, 101.5, 37.7, 18.1, 20.0, and 90.9 μM Cl - / d, and the products are all ethylene.

[0048] Example 3: Dechlorination of trichloroethylene and 1,2-dichloroethane by Dehalococcus NK under different pH conditions

[0049] Using trichloroethylene and 1,2-dichloroethane as representative organic chlorides, the dechlorination rates of Dehalococcus NK in anaerobic culture media at different pH values ​​were compared. Specifically:

[0050] Two sets of experiments were conducted according to the test method described in Example 2. 10 μL of trichloroethylene (liquid phase concentration 0.85 mM) and 10 μL of 1,2-dichloroethane (liquid phase concentration approximately 1.23 mM) were added to each set of experiments. Each set of experiments was set at pH 7.2, pH 5.5, and pH 5.2. The dechlorination rate was calculated after two consecutive cycles under the same pH conditions. The gas chromatography method described above was used to quantitatively analyze the conversion of organic chlorides by Dehalococcus NK.

[0051] Depend on Figure 4 It can be seen that in the trichloroethylene experimental group, the dechlorination rates under pH 7.2 and pH 5.5 conditions were 81.9 μM Cl - / d and 101.5 μM Cl - / d, indicating that after continuous passage in low pH medium, the dechlorination rate of Dehalogenococcus NK at pH 5.5 was not much different from that at neutral pH. The dechlorination activity was still maintained under culture conditions as low as pH 5.2, with a dechlorination rate of 20.1 μM Cl - The dechlorination rates of the 1,2-dichloroethane experimental group at pH 7.2, pH 5.5, and pH 5.2 were 118.0 μM Cl - / d, 90.9μM Cl- / d and 29.0 μM Cl - / d.

[0052] The above-mentioned several embodiments are several implementation methods of the present invention and cannot be used as a limitation on the scope of the present invention. Without departing from the concept of the present invention, there can be a variety of improved cases, all of which are within the scope of protection of the present invention.

Claims

1. An acid-resistant Dehalogenococcus sp., characterized by: Dehalogenobacterium spp. Dehalococcoides mccartyi NK was deposited in the General Microbiology Center of China Culture Collection Administration on February 13, 2025, with the culture collection number CGMCC No. 46384.

2. An application of the acid-resistant Dehalogenococcus according to claim 1, characterized in that: Application of the strain in degrading organochlorine pollutants; The organochlorine pollutants are various chlorinated alkenes and / or chlorinated alkanes; The various chlorinated alkenes are tetrachloroethylene, trichloroethylene, cis-1,2-dichloroethylene, trans-1,2-dichloroethylene, 1,1-dichloroethylene, and monochloroethylene; the chlorinated alkane is 1,2-dichloroethane.

3. A preparation for degrading organic chlorinated pollutants, characterized in that: The preparation contains the acid-resistant Dehalogenococcus as claimed in claim 1 Dehalococcoides mccartyi NK strains.

4. The preparation for degrading organic chlorinated pollutants according to claim 3, characterized in that: The preparation is the acid-resistant Dehalogenococcus Dehalococcoides mccartyi NK culture, culture concentrate or culture suspension.

5. Use of the preparation for degrading organic chlorinated pollutants according to claim 3, characterized in that: Use of said formulation in remediation of scenes contaminated by organochlorine pollutants; The organochlorine pollutants are various chlorinated alkenes and / or chlorinated alkanes; The various chlorinated alkenes are tetrachloroethylene, trichloroethylene, cis-1,2-dichloroethylene, trans-1,2-dichloroethylene, 1,1-dichloroethylene, and monochloroethylene; the chlorinated alkane is 1,2-dichloroethane.

Images