Neutralizing nano antibody aiming at monkey pox virus membrane protein M1R and application of neutralizing nano antibody

By developing nano-antibody M1-01 and its Fc fusion antibodies that specifically bind to the monkeypox virus membrane protein M1R, the problem of lack of effective monkeypox virus antibodies in the prior art was solved, and efficient neutralization and diagnosis of monkeypox virus was achieved, and there are broad application prospects.

CN120329422APending Publication Date: 2025-07-18INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410060428.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-16
Publication Date
2025-07-18

AI Technical Summary

Technical Problem

There is a lack of efficient, stable and economical antibodies against monkeypoxvirus membrane protein M1R in the prior art, especially effective solutions in neutralizing poxvirus infection.

Method used

A nanoantibody M1-01 and its Fc fusion antibody specifically binding to the monkeypox virus membrane protein M1R was developed. It was prepared by phage library screening and genetic engineering technology, and the Fc fragment of murine IgG2a was combined with improved affinity and neutralization activity.

Benefits of technology

It has achieved efficient neutralization of monkeypox virus, has good biological activity and stability, and is suitable for the preparation of drugs and diagnostic products for preventing or treating poxvirus infection, and has broad drug applications and clinical diagnostic prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004666269930000011
    Figure HDA0004666269930000011
  • Figure HDA0004666269930000012
    Figure HDA0004666269930000012
  • Figure HDA0004666269930000021
    Figure HDA0004666269930000021
Patent Text Reader

Abstract

The invention discloses a neutralizing nano antibody aiming at a monkey pox virus membrane protein M1R and application of the neutralizing nano antibody. In particular discloses a nano antibody specifically binding to M1R protein. The nano antibody comprises a complementarity determining region CDR1 of 26th to 33rd sites of SEQ ID No.1, a complementarity determining region CDR2 of 51th to 58th sites of SEQ ID No.1 and a complementarity determining region CDR3 of 97th to 110th sites of SEQ ID No.1. The nano antibody with M1R protein antigen specificity is obtained through multiple rounds of screening of a phage library, and the Fc fusion antibody of the nano antibody is further constructed. The nano antibody and the fusion antibody thereof are good in affinity, good in vaccinia virus neutralizing activity, good in solubility, low in cost and good in biological activity, and have very wide prospects and important significance in the fields of medicine application, clinical diagnosis and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and specifically relates to a neutralizing nanobody against the membrane protein M1R of monkeypox virus and its application. Background Art

[0002] Poxviridae, scientifically named Poxviridae, is a virus that often causes local or systemic suppurative skin lesions after infecting humans and animals. The "Pox" in the scientific name comes from English, meaning "pox" or "pustule". This family is a type of DNA virus with the largest virions and a complex structure. The virions are brick-shaped or oval-shaped, with a size of (300-450)×(170-260) nanometers, and a buoyant density of 1.1-1.33 in cesium chloride. It has a core, lateral bodies, and an envelope, and the core contains viral DNA bound to proteins. Monkeypox is a viral disease caused by monkeypox virus (mpoxvirus, MPXV). Monkeypox virus is classified in the genus Orthopoxvirus of the family Poxviridae and is one of the four Orthopoxvirus viruses that are pathogenic to humans. The other three are variola virus, vaccinia virus, and cowpox virus.

[0003] Nanobody (Nb), namely the variable domain of the heavy chain of heavy-chain antibody VHH (variable domain of heavy chain of heavy-chain antibody), has a molecular weight of only about 13-15 KDa, a diameter of about 2.5 nm, and a length of 4 nm. It is the smallest antibody fragment with antigen-binding function so far. Its antigen-binding ability and stability are basically the same as those of a complete antibody or have higher specific antigen affinity. Compared with traditional antibodies, nanobodies also have many unique properties, such as good stability, can reach special antigen epitopes, arbitrary combination of building block patterns, low production cost, etc. At present, due to its advantages such as stable structure, small molecule, good solubility, tolerance to various adverse environments, good stability of preparations, and easy humanization, VHH single-domain antibodies have been widely used in the research of miniaturized genetic engineering antibodies, new drug development, and the diagnosis and treatment of diseases. The research and development of nanobodies have very broad prospects and important significance in the fields of drug application and clinical diagnosis, etc. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a neutralizing nanobody against the membrane protein M1R of monkeypox virus and its application. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0005] To achieve the above object, the present invention first provides a nanobody that specifically binds to the M1R protein. The nanobody comprises complementarity-determining regions CDR1 at positions 26-33 of SEQ ID No.1, CDR2 at positions 51-58 of SEQ ID No.1, and CDR3 at positions 97-110 of SEQ ID No.1, respectively, in terms of amino acid sequence.

[0006] Furthermore, the amino acid sequence of the nanobody may be SEQ ID No.1 or an amino acid sequence having at least 80% identity with SEQ ID No.1 and having the same function.

[0007] Furthermore, the name of the nanobody may be M1-01, which has only the variable region (VHH) of the heavy-chain antibody and is composed of framework region FR1, complementarity-determining region CDR1, framework region FR2, complementarity-determining region CDR2, framework region FR3, complementarity-determining region CDR3, and framework region FR4 in sequence.

[0008] Furthermore, in the amino acid sequence (SEQ ID No.1) of the nanobody M1-01, positions 1-25 of SEQ ID No.1 are framework region FR1, positions 26-33 are complementarity-determining region CDR1, positions 34-50 are framework region FR2, positions 51-58 are complementarity-determining region CDR2, positions 59-96 are framework region FR3, positions 97-110 are complementarity-determining region CDR3, and positions 111-123 are framework region FR4.

[0009] The sequences of the complementarity-determining regions are defined according to the Kabat numbering system.

[0010] Other variants of the nanobody sequence of the present invention with improved affinity and / or potency can be obtained by using methods known in the art and are included within the scope of the present invention. For example, amino acid substitution can be used to obtain antibodies with further improved affinity. Alternatively, codon optimization of the nucleotide sequence can also be used to improve the translation efficiency in the expression system for producing antibodies. In addition, polynucleotides containing sequences that optimize antibody specificity by applying directed evolution methods to any nucleic acid sequence of the present invention also fall within the scope of the present invention.

[0011] In certain embodiments, substitutions, insertions, or deletions may occur in one or more complementarity-determining regions or framework regions of the nanobody of the present invention, provided that such changes do not substantially reduce the ability of the antibody to bind to the antigen. For example, conservative changes (e.g., conservative substitutions, well-known to those skilled in the art, where conservative substitutions of amino acids do not change the properties and functions of the protein) can be made to the complementarity-determining regions and / or framework regions, which do not substantially reduce the binding affinity. For example, such changes can be outside the antigen-contact residues in the complementarity-determining regions.

[0012] The present invention also provides a fusion protein, which comprises the nanobody and a constant region, and the sequence of the constant region can be selected from the sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

[0013] Furthermore, the constant region can be the Fc of murine IgG2a.

[0014] Furthermore, the fusion protein is obtained by fusing the Fc of murine IgG2a at the C-terminus of the nanobody M1-01.

[0015] Furthermore, the amino acid sequence of the Fc of murine IgG2a can be as shown in SEQ ID No. 4, and the nucleotide sequence can be as shown in SEQ ID No. 3.

[0016] The name of the fusion protein can be M1-01-Fc, or it can also be called nanobody M1-01-Fc, and its amino acid sequence can be as shown in SEQ ID No. 5, and the nucleotide sequence can be as shown in SEQ ID No. 6.

[0017] The present invention also provides a biomaterial, which can be any one of the following:

[0018] A1) A nucleic acid molecule encoding the nanobody;

[0019] A2) A nucleic acid molecule encoding the fusion protein;

[0020] A3) An expression cassette containing the nucleic acid molecule of A1) or A2);

[0021] A4) A recombinant vector containing the nucleic acid molecule of A1) or A2);

[0022] A5) A recombinant host cell containing the nucleic acid molecule of A1) or A2).

[0023] Among them, the recombinant host cell of A5) can express the nucleic acid molecule of A1) or A2).

[0024] Among the above biomaterials, the nucleic acid molecule can be any one of the following:

[0025] B1) A DNA molecule whose nucleotide sequence or coding sequence is SEQ ID No.2 or SEQ ID No.6;

[0026] B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and having the same function.

[0027] The DNA molecule shown in SEQ ID No.2 encodes the nanobody M1-01 with the amino acid sequence of SEQ ID No.1.

[0028] The DNA molecule shown in SEQ ID No.6 encodes the fusion protein M1-01-Fc (nanobody M1-01-Fc) with the amino acid sequence of SEQ ID No.5.

[0029] The above-mentioned 75% or more identity can be 80%, 85%, 90% or 95% or more identity.

[0030] In this article, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search to calculate the identity of the amino acid sequence, and then the identity value (%) can be obtained.

[0031] The host cells (also referred to as recipient cells) described in this article refer to any type of cell that can be used to introduce a vector. The host cell can be a eukaryotic cell (such as HEK293, CHO, and myeloma cells, etc.), or it can be a prokaryotic cell (such as Escherichia coli, etc.). The host cell can be understood to refer not only to a specific recipient cell, but also to the progeny of such a cell, and due to natural, accidental, or intentional mutations and / or alterations, the progeny does not have to be exactly the same as the original parental cell, but is still included in the scope of the host cell.

[0032] The present invention also provides the applications of the above-mentioned nanobody, the above-mentioned fusion protein, and / or the above-mentioned biomaterial in any of the following:

[0033] C1) Application in the preparation of a drug for preventing or treating poxvirus infection;

[0034] Use in the preparation of a product for detecting the level of poxvirus and / or poxvirus M1 antigen;

[0035] Use in the preparation of a product for diagnosing or assisting in the diagnosis of a disease caused by poxvirus infection;

[0036] Use in the preparation of a drug for inhibiting or neutralizing the activity of poxvirus;

[0037] Use in the preparation of a product for binding to M1R protein.

[0038] In this article, the poxvirus includes, but is not limited to, monkeypox virus, vaccinia virus, rabbitpox virus, ectromelia virus, vaccinia virus, variola virus, camelpox virus, etc.

[0039] The M1 antigen described in this article can be M1R antigen (i.e., M1R protein).

[0040] The diseases caused by poxvirus infection described in this article can be selected from smallpox, monkeypox, vaccinia, rabbitpox, ectromelia, and camelpox.

[0041] The product described in this article can be a reagent, a kit, a chip, or a test strip.

[0042] The detection includes, but is not limited to, detection by enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, chemiluminescent immunoassay, colloidal gold immunochromatography, agglutination assay, immunoturbidimetry, etc.

[0043] The present invention also provides a pharmaceutical composition, which contains the nanobody or the fusion protein, and a pharmaceutically acceptable carrier.

[0044] Furthermore, the pharmaceutically acceptable carrier is selected from diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption promoters, adsorption carriers, surfactants, and lubricants.

[0045] The pharmaceutical composition can have at least one of the following uses:

[0046] E1) Preventing or treating poxvirus infection;

[0047] E2) Inhibiting or neutralizing the activity of poxvirus.

[0048] The present invention also provides a kit, which contains the nanobody or the fusion protein, and the kit has any one of the following uses:

[0049] D1) Detecting the level of poxvirus and / or poxvirus M1 antigen;

[0050] D2) Diagnosing or assisting in the diagnosis of a disease caused by poxvirus infection;

[0051] D3) Bind to the M1R protein.

[0052] The kit includes, but is not limited to, a chemiluminescent immunoassay kit, an enzyme-linked immunosorbent assay kit, a colloidal gold immunoassay kit, or a fluorescence immunoassay kit.

[0053] The detection of the M1R protein described herein may be to detect whether the test sample contains the M1R protein and / or to detect the content of the M1R protein in the test sample.

[0054] The test sample may be a cell or tissue sample.

[0055] The products for detecting the M1R protein described herein include products that detect antigen-antibody binding by methods such as enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, luminescence immunoassay, colloidal gold immunochromatography, agglutination assay, or immunoturbidimetry assay.

[0056] The present invention also provides a method for preparing the nanobody, which includes: constructing a recombinant expression vector containing a nucleic acid molecule encoding the nanobody; introducing the recombinant expression vector into a host cell to obtain a recombinant cell expressing the nanobody; culturing the recombinant cell, and obtaining the nanobody through separation and purification.

[0057] Further, the nucleic acid molecule encoding the nanobody may be any one of the following:

[0058] F1) A DNA molecule whose nucleotide sequence or coding sequence is SEQ ID No. 2;

[0059] F2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and having the same function.

[0060] Further, the host cell may be a 293F cell.

[0061] Further, the introduction may be to transform the host cell with a vector carrying the nanobody gene of the present invention by any known transfection method such as calcium phosphate co-precipitation method, liposome-mediated method, electroporation method, or viral vector method.

[0062] In an alternative embodiment, the nanobody is at least one of a monovalent nanobody, a bivalent or multivalent nanobody, a bispecific antibody, and a fusion nanobody.

[0063] Monovalent nanobody: It is an antigen-specific nanobody screened from a nanobody library with a specific antigen. Due to a large number of hydrophilic residues on its surface, it can maintain a strict monomer structure and can specifically and highly affinity bind to its antigen only in this monomer form.

[0064] Multivalent Nanobodies: Bivalent or multivalent nanobodies have two or more VHH structures that can recognize the same epitope of an antigen, with higher affinity than monovalent nanobodies, and do not affect the pharmacokinetics and targeting ability of nanobodies.

[0065] Multispecific Antibodies: Bispecific nanobodies have two different VHHs that can bind to two different antigens or different epitopes on the same antigen, with stronger antigen recognition ability than monovalent nanobodies.

[0066] Fusion Nanobodies: Nanobodies have strict monomeric characteristics and a very small relative molecular mass, and can easily be combined with other structures (such as IgG-Fc, etc.) through genetic engineering technology to form new fusion molecules, such as enzymes, antimicrobial peptides, or imaging substances that can extend their half-life. In the new fusion molecule, the nanobody binds specifically to its target antigen, and the part fused with the nanobody can perform corresponding functions. Clinically, doctors hope that drugs can stay in the body for a long enough time. However, the blood clearance rate of nanobodies is very fast, which is not conducive to the drugs carried by them to play their roles. Therefore, by genetically fusing the nanobody VHH with a molecule with a longer lifespan, the presence time of nanobodies in the blood can be increased, that is, their half-life can be extended, so as to achieve better therapeutic effects.

[0067] In a specific embodiment of the present invention, M1-01 is a monovalent nanobody, and M1-01-Fc is a fusion nanobody.

[0068] Furthermore, M1-01-Fc fuses with the murine IgG-Fc fragment, and the nucleotide sequence of the murine Fc gene fragment is as shown in SEQ ID No.3, and the amino acid sequence encoded by it is as shown in SEQ ID No.4.

[0069] As used herein, the terms "single-domain antibody", "nanobody", "monovalent nanobody", "nanobody", and "VHH antibody" have the same meaning and can be used interchangeably.

[0070] Advantages of the present invention: A nanobody with vaccinia virus neutralizing activity is provided. The nanobody M1-01 of the present invention specifically targets the core antigen M1R of monkeypox virus, can be abundantly expressed using a prokaryotic expression system, has good solubility, low cost, and good biological activity. The fusion antibody obtained after fusing the Fc fragment has a high improvement in both affinity and neutralizing activity. Moreover, since M1R is a highly conserved protein in poxviruses, and the examples demonstrate that this nanobody can neutralize vaccinia virus (vaccinia virus strain WR), it can be considered that this nanobody has the potential for application in the treatment and prevention of poxvirus infections. The nanobody drug of the present invention has good affinity, stable structure, small molecule size, is easy to recombinantly express, and has low production cost. It can be used alone or as a drug delivery system to carry related drugs, and has very broad prospects and important significance in the fields of drug application and clinical diagnosis, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 It is the SDS-PAGE diagram for the purification of nanobody M1-01.

[0072] Figure 2 It is the SDS-PAGE diagram for the purification of fusion antibody M1-01-Fc.

[0073] Figure 3 It is for detecting the binding kinetic activity of nanobody M1-01 by SPR.

[0074] Figure 4 It is for detecting the binding kinetic activity of fusion antibody M1-01-Fc by SPR.

[0075] Figure 5 It is for detecting the nanobody activity by vaccinia virus neutralization test. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0076] The present invention will be further described in detail below in conjunction with the specific embodiments. The given embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0077] The experimental methods in the following embodiments, unless otherwise specified, are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial channels.

[0078] The BS-C-1 cells in the following embodiments are from procell company, with the product number CL-0039.

[0079] The vaccinia virus (strain WR(ATCC VR-119)) in the following examples is derived from the American Type Culture Collection (ATCC). The public can obtain this biological material from the applicant in accordance with the relevant regulations on national biosafety. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0080] Example 1: Expression and purification of monkeypox virus M1R protein

[0081] The prokaryotic system was used to express the recombinant M1R protein of monkeypox virus. According to the reference sequence of Mpox virus isolate MPXV_USA_2022_MA001 (GenBank: ON563414.3), the membrane protein gene of monkeypox virus was synthesized. The target gene was constructed between the NcoI and XhoI restriction sites of the pET-22b vector to obtain a prokaryotic expression vector expressing the monkeypox virus M1R fusion histidine tag (6*His). The expression plasmid was transfected into commercially available Escherichia coli BL21(DE3) competent cells (purchased from Beijing TransGen Biotech Co., Ltd.). After verifying the sequence accuracy by sequencing, the recombinant bacteria were inoculated into LB liquid medium and cultured at 37°C and 230 rpm until OD600 = 0.6. Then, IPTG with a final concentration of 0.5 mM was added to the culture system, and the culture was continued to be induced at 25°C and 180 rpm for 17 - 19 hours, and then the cells were collected by centrifugation.

[0082] Furthermore, the collected cells were resuspended in a sucrose solution (0.5M sucrose, 0.2M Tris, 0.5 mM EDTA). After slowly adding 100 mL of ddH2O to the resuspended solution to release the recombinant protein in the periplasmic space, it was centrifuged at 12,000 rpm / min for 30 minutes. The supernatant was transferred to a new tube, and the antigen protein was purified by nickel column ion affinity chromatography. Using the imidazole gradient elution method, the low-concentration imidazole eluent (20 mM) was used to wash away the impurity bands, and the high-concentration imidazole eluents (300 mM, 500 mM) could finally prepare a protein with a purity of over 90%. The protein was loaded into a dialysis bag and dialyzed overnight to change the PBS buffer system, and steps such as concentration were completed. Finally, the target protein (recombinant protein M1R) was obtained, aliquoted and stored at -80°C for later use.

[0083] Example 2: Screening of phage library and identification of positive clones

[0084] The basic operation process of phage library screening is briefly described as follows: First, 50 μg of the recombinant protein M1R prepared in Example 1 above was biotinylated using the commercial kit EZ-Link™ Sulfo-NHS-LC-LC-Biotin from Thermo Fisher Scientific, and desalted and purified (the desalting column was purchased from Thermo Fisher Scientific). The first round of screening was liquid-phase selection. First, 12 μg of the biotinylated M1R protein was mixed with 1 mL of the phage library (10 12 -10 13 ) and incubated at room temperature for 1 hour; then 100 μL of streptavidin-coated magnetic beads (GE Healthcare) was added, and the mixture was incubated on a rotary shaker at room temperature for 30 minutes; then the magnetic beads were washed 10 times with PBS-T and PBS, and 400 μL of elution buffer was added to the magnetic beads and eluted for 5 min; 200 μL of the eluate was added to 5 mL of the TG1 Escherichia coli culture in the logarithmic growth phase and cultured at 37 °C for 1 hour; after the above culture was infected with the helper phage CM13, the culture was expanded overnight and the phages in the supernatant were purified using PEG6000 (Sigma) the next day for the next round of screening. The second round of screening was solid-phase selection. First, 10 μg of the M1R protein was coated overnight at 4 °C on 5 mL of immunosorbent tubes, and the immunosorbent tubes were washed 3 times with PBS the next day and 1 mL of the VHH library harvested from the first round of screening, 10 12 phages, was added, and the mixture was rotated on a rotary shaker at room temperature for 30 minutes and then incubated statically for 1.5 hours; then the immunosorbent tubes were washed 15 times with PBS-T and PBS by shaking, and 400 μL of elution buffer was added for elution; half of the eluate was added to 5 mL of the TG1 Escherichia coli culture in the logarithmic growth phase and cultured at 37 °C for 1 hour; after the above culture was infected with the helper phage CM13, the culture was expanded overnight and the phages in the supernatant were purified using PEG the next day for the next round of screening. The third and fourth rounds of screening were carried out using a similar method. The third round was liquid-phase screening, and the fourth round was solid-phase screening.

[0085] After the last round of screening, 1,000 single clones were picked for culturing and phage rescue for subsequent identification of positive clones. The identification was performed by phage enzyme-linked immunosorbent assay. The M1R recombinant protein obtained in Example 1 above was diluted to 5 μg / mL, and 50 μL / well was used to coat a 96-well immunoplates (sigma) at 4 °C overnight. Then, the immunoplates were blocked with 2% skim milk. Thereafter, 100 μL / well of the rescued phages obtained from the above screening was added and incubated statically at 37 °C for 1 hour. After washing the plates 9 times with PBST and PBS, HRP-labeled anti-phage antibody Anti-M13 antibody (11973-MM05T-H, purchased from Sino Biological Inc.) was added and incubated at 37 °C for 1 h. After washing the plates 9 times with PBST and PBS as above, TMB substrate (Beijing Solarbio Science & Technology Co., Ltd.) was added and reacted in the dark at 37 °C for 15 minutes. The reaction was terminated by adding the stop solution and the absorbance was read at a wavelength of 450 nm. Negative control and background control were set in the experiment. The ELISA positive clones were sent to a biotechnology service company for sequence determination to obtain the DNA sequence of the inserted fragment, which encodes a heavy chain single domain antibody (nanobody) against M1R. Homology alignment analysis was performed on all positive clone sequences, and the results showed that all positive clones could be enriched into 1 independent clone, numbered M1-01.

[0086] Sequencing showed that the nanobody M1-01 only had the variable region (VHH) of the heavy chain antibody, which was composed of framework region FR1, complementarity-determining region CDR1, framework region FR2, complementarity-determining region CDR2, framework region FR3, complementarity-determining region CDR3, and framework region FR4 in sequence. The specific sequence information was as follows:

[0087] The amino acid sequence of the nanobody M1-01 was as shown in SEQ ID No.1. The 1st to 25th positions of SEQ ID No.1 were the framework region FR1, the 26th to 33rd positions were the complementarity-determining region CDR1, the 34th to 50th positions were the framework region FR2, the 51st to 58th positions were the complementarity-determining region CDR2, the 59th to 96th positions were the framework region FR3, the 97th to 110th positions were the complementarity-determining region CDR3, and the 111th to 123rd positions were the framework region FR4. The nucleotide sequence of the nucleic acid molecule (M1-01 gene) encoding the nanobody M1-01 was as shown in SEQ ID No.2.

[0088] Amino acid sequence of the nanobody M1-01: 5’-QVQLVESGGGLVQAGGSLRLSCAAS GFIF HNFD MGWYRQAPGKEREFVAA ISDNGRST YYADSVKGRFTISRDNAKNTVYLQMN SLKPEDTAVYYC AVAWLSIPDLAEWY DYWGQGTQVTVSS-3’ (SEQ ID No.1).

[0089] The three underlined parts are CDR1, CDR2, and CDR3 in sequence.

[0090] Nucleotide sequence of the M1-01 gene: 5’-CAGGTGCAGCTGGTGGAATCGGGTGGGGGATT GGTTCAGGCGGGGGGAAGTTTACGCTTATCGTGTGCGGCATCTGGTTTCATTTTCCATAACTTCGACATGGGTTGGTATCGCCAGGCACCAGGTAAAGAACGTGAATTCGTTGCCGCTATTTCTGACAACGGCCGTTCTACCTACTACGCGGACTCAGTGAAAGGCCGCTTCACTATCTCCCGTGATAATGCTAAGAACACCGTTTATCTGCAGATGAATTCTTTGAAACCTGAAGACACTGCCGTTTATTATTGCGCAGTTGCTTGGCTGTCTATCCCGGACCTGGCTGAATGGTACGACTACTGGGGTCAGGGAACCCAGGTTACGGTTTCTTCT-3’ (SEQ ID No.2).

[0091] The above nanobody is a nanobody against the membrane protein M1R of monkeypox virus, that is, a nanobody specifically binding to the M1R protein (also known as M1R nanobody).

[0092] The sequences of the complementarity-determining regions are defined according to the Kabat numbering system.

[0093] Example 3: Expression and purification of M1R nanobody in a prokaryotic expression system

[0094] After the screening in Example 2 above, the complete open reading frame of the positive clone M1-01 was amplified using a high-fidelity enzyme (Takara). The PCR product was electrophoresed and a band of about 380 bp was excised and recovered. The recovered PCR band was recombinantly ligated with the pET-22b vector (the restriction enzyme sites are NcoI and XhoI) to construct a prokaryotic expression plasmid for the M1-01 nanobody. In the same way as the expression and purification method in Example 1 above, an antibody protein with a purity greater than 90% was finally obtained, aliquoted and stored frozen at -80 °C for later use. The SDS-PAGE result of the purification of the nanobody M1-01 is as Figure 1 shown.

[0095] Example 4: Expression and purification of the M1-01-Fc fusion antibody in eukaryotic cells

[0096] As mentioned in this article, a variety of well-known methods in the art can be used to obtain variants of the nanobody, such as constructing bivalent and multivalent nanobodies, fusion nanobodies, etc., to improve the activity of the nanobody. In this example, a fusion nanobody M1-01-Fc fused with murine IgG2a-Fc fragment was specifically constructed, and the specific implementation steps are as follows:

[0097] 1. Construction of recombinant expression vector

[0098] According to the sequencing results, the complete open reading frame of the positive clone M1-01 was amplified using a high-fidelity enzyme (Takara). The PCR product was electrophoresed and a band of about 380 bp was excised and recovered (containing the M1-01 gene with the nucleotide sequence of SEQ ID No.2 and the restriction enzyme sites at both ends). The above antibody gene was inserted between EcoRI and XhoI of the expression vector pFuse-mIgG2a-Fc2, and the plasmid was extracted using a plasmid extraction kit. The pFuse-mIgG2a-Fc2 vector was modified from the pFuse-hIgG1-Fc2 vector (in vivoGen, catalog number #pfuse-hg1fc2). A murine IgG2a-Fc gene fragment was inserted into the XhoI and NheI restriction enzyme sites of the pFuse-hIgG1-Fc2 vector. The nucleotide sequence of the murine IgG2a-Fc gene fragment is shown in SEQ ID No.3, and the amino acid sequence it encodes (the Fc of murine IgG2a) is shown in SEQ ID No.4.

[0099] The constructed recombinant vector was named pFuse-mIgG2a-Fc2-M1-01, and this recombinant vector expresses the nanobody M1-01-Fc with the murine IgG2a-Fc gene fused at the C-terminus.

[0100] 2. Expression and purification of fusion protein (nanobody M1-01-Fc)

[0101] One day before transfection, Freestyle 293F cells were seeded at 1×10 6Plate the cells at a density of Figure 2 cells / mL, and place all reagents at room temperature for 10 minutes before transfection. The following operations are based on 30 mL of cells: Prepare two clean centrifuge tubes, dilute 15 μg of plasmid DNA (recombinant vector pFuse-mIgG2a-Fc2-M1-01) to 3 mL of serum-free expi293 medium (Gibco), and pipette 3-4 times; Add 22.5 μL of transfection reagent FectroPro (polyplus) to another tube. Add all the diluted PEI transfection reagent to the transfection reagent at once, and immediately pipette 3-4 times; Let it stand at room temperature for 10 minutes. Drop the transfection mixture evenly into the cell culture flask, gently shake it to disperse the transfection complex evenly, and add 15 μL of booster within 0-4 hours to enhance the protein expression efficiency. Place the cell culture flask in an 8% CO2, 37 °C constant temperature shaker, collect the cell culture medium after 5 days, detect the protein expression level, and purify the antibody by affinity chromatography, and analyze the purification result by SDS-PAGE electrophoresis. The SDS-PAGE result of the purification of nanobody M1-01-Fc is as

[0102] shown. The amino acid sequence of nanobody M1-01-Fc is shown in SEQ ID No. 5, and the nucleotide sequence is shown in SEQ ID No. 6.

[0103] Example 5: Affinity determination of M1R nanobody and Fc fusion antibody

[0104] Use a BIAcore T-200 biomolecular interaction analyzer (GE Life Sciences) to determine the affinity of the antibody. Biacore T200 is a versatile and highly sensitive surface plasmon resonance (SPR) system. When measuring the interaction between M1R protein and the above-mentioned nanobody and Fc fusion antibody, first coat the M1R protein on the sensor chip, and then use the nanobody as the mobile phase to measure the binding constant, dissociation constant and affinity constant.

[0105] 1. Coupling of M1R protein to CM5 chip: The coupling temperature of the RBD protein is 25 °C, and the buffer is PBS-P (PBS, 0.05% P20, pH 7.4). Select the CM5 chip channel 4 amino coupling in the program template Immuobilization, the ligand is 10 μg / mL M1R recombinant protein, the protein buffer system is sodium acetate at pH 5.5 (NaAC5.5), the target coupling amount is 300 RU, and the eluent is 50 mM NaOH. The chip activator is 50 mmol / L N-hydroxysuccinimide (NHS) and 200 mmol / L 3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) to activate the chip, and the blocking agent is 1 mol / L ethanolamine hydrochloride.

[0106] 2. Affinity and Kinetics Determination of M1R, Nanobody, and Fc-Fused Antibody: Select a multi-cycle kinetics template. The measurement temperature is 25 °C, the buffer is PBS-P, the sample flow path is 4-3, the sample binding time is 180 s, the flow rate is 30 μL / min, the dissociation time is 300 s, the regeneration eluent is Glycine-HCL 2.5, the regeneration solution binding time is 30 s, the flow rate is 30 μL / min, the stabilization time is 0 s, and the nanobody concentration is serially diluted. The finally obtained data is analyzed using Biacore Evaluation Software to calculate the association constant (ka), dissociation constant (kd), and affinity constant (KD). The chips, reagents, and buffers used in the above Biacore analysis are all purchased from GE Life Sciences.

[0107] The SPR detection results of the binding kinetics of nanobody M1-01 are as Figure 3 shown, and the SPR detection results of the binding kinetics of nanobody M1-01-Fc are as Figure 4 shown. The binding kinetics of M1-01 and M1-01-Fc were detected by two-fold dilution starting from initial concentrations of 500 nM and 100 nM, respectively. The results of the affinity determination of the nanobody and M1R protein are shown in Table 1. The KD value of the affinity constant of the nanobody obtained in the present invention and the M1R protein is less than 0.4 nM. KD is the equilibrium dissociation constant between an antibody and its antigen, that is, the ratio of ka / kd. KD is inversely proportional to the affinity. The KD value is related to the concentration of the antibody (the amount of antibody required for a specific experiment). Therefore, the lower the KD value (the lower the concentration), the higher the affinity of the antibody. Thus, the antibodies obtained in the present invention all have an ideal affinity for the M1R protein.

[0108] Table 1. Results of Affinity Determination of Nanobody and M1R Protein

[0109] Antibody name ka (1 / Ms) kd (1 / s) KD (M) M1-01 3.733E+4 0.001608 4.308E-8 M1-01-Fc 2.478E+5 4.445E-4 1.794E-9

[0110] Example 6. Neutralizing Activity Determination of M1R Nanobody and Fc-Fused Antibody

[0111] Cell preparation: One day before the neutralization experiment, BS-C-1 cells were seeded in 48-well plates so that the monolayer cells covered the bottom of the wells the next day. First, prepare the antibody + virus mixture according to the following protocol during the experiment: Dilute the antibody using serum-free DMEM medium at a 3-fold dilution ratio with an initial concentration of 50 μg / mL. A total of 7 concentration gradients were set. Subsequently, mix the antibody with 100 PFU Vaccine virus (strain WR (ATCC VR-119)). The volume ratio of the antibody to the virus was 1:1, and the infection dose per well was 100 μL (i.e., 50 μL of the antibody and 50 μL of the virus). Three replicates were set for each gradient, and an antibody concentration of 0 and an empty cell control group were set on each plate. After incubating the above mixture in an incubator at 37 °C and 5% carbon dioxide for 1 h, discard the cell culture medium. Add the above mixture to the BS-C-1 monolayer cells at 100 μL / well. Place the plate in the incubator for infection for 2 h, and gently shake the well plate every half hour or so during this period. Subsequently, discard the infectant, add 1 mL of MEM medium containing 1% methyl cellulose and 2.5% serum to each well, and culture in an incubator at 37 °C for 2 - 3 days. Then, discard the medium, fix the cells with 4% paraformaldehyde at room temperature for 30 min, add 0.1% crystal violet solution for staining, and count the plaques.

[0112] The results are as Figure 5 shown. It can be seen that the neutralization NT 50 value of the nanobody M1-01 is 28.04 μg / mL, and the neutralization NT 50 value of the nanobody M1-01-Fc is 1.99 μg / mL.

[0113] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. Nanobody that specifically binds to the M1R protein, characterized in that, The nanobody comprises complementarity-determining region CDR1 of amino acid residues 26-33 of SEQ ID No.1, complementarity-determining region CDR2 of amino acid residues 51-58 of SEQ ID No.1, and complementarity-determining region CDR3 of amino acid residues 97-110 of SEQ ID No.

1.

2. The nanobody according to claim 1, wherein, The amino acid sequence of the nanobody is SEQ ID No.1 or an amino acid sequence having at least 80% identity with SEQ ID No.1 and having the same function.

3. Fusion protein, characterized in that, The fusion protein comprises the nanobody according to claim 1 or 2 and a constant region, and the sequence of the constant region is selected from the sequences of any one of the constant regions of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, IgD.

4. A biological material, characterized in that, The biomaterial is any one of the following: A1) A nucleic acid molecule encoding the nanobody according to claim 1 or 2; A2) A nucleic acid molecule encoding the fusion protein according to claim 3; A3) An expression cassette containing the nucleic acid molecule described in A1) or A2); A4) A recombinant vector containing the nucleic acid molecule described in A1) or A2); A5) A recombinant host cell containing the nucleic acid molecule described in A1) or A2).

5. The biomaterial according to claim 4, characterized in that, The nucleic acid molecule is any one of the following: B1) A DNA molecule whose nucleotide sequence or coding sequence is SEQ ID No.2 or SEQ ID No.6; B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and having the same function.

6. Use of the nanobody according to claim 1 or 2, the fusion protein according to claim 3, and / or the biomaterial according to claim 4 or 5 in any one of the following: C1) Use in the preparation of a medicament for preventing or treating poxvirus infection; C2) Use in the preparation of a product for detecting the level of poxvirus and / or poxvirus M1 antigen; C3) Use in the preparation of a product for diagnosing or assisting in the diagnosis of a disease caused by poxvirus infection; C4) Use in the preparation of a medicament for inhibiting or neutralizing the activity of poxvirus; C5) Use in the preparation of a product for binding to the M1R protein.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains the nanobody according to claim 1 or 2 or the fusion protein according to claim 3, and a pharmaceutically acceptable carrier.

8. Kit, characterized in that, The kit contains the nanobody according to claim 1 or 2 or the fusion protein according to claim 3, and the kit has any one of the following uses: D1) Detecting the level of poxvirus and / or poxvirus M1 antigen; D2) Diagnosing or assisting in the diagnosis of a disease caused by poxvirus infection; D3) Binding to the M1R protein.

9. The preparation method of the nanobody according to claim 1 or 2, characterized in that, The method includes: constructing a recombinant expression vector containing a nucleic acid molecule encoding the nanobody according to claim 1 or 2; introducing the recombinant expression vector into a host cell to obtain a recombinant cell expressing the nanobody; culturing the recombinant cell, and obtaining the nanobody through separation and purification.

10. The preparation method according to claim 9, characterized in that, The nucleic acid molecule encoding the nanobody according to claim 1 or 2 is any one of the following: F1) A DNA molecule whose nucleotide sequence or coding sequence is SEQ ID No.2; A DNA molecule having 75% or more identity with the nucleotide sequence defined in F1) and having the same function.