A tRF related to prostate cancer and its application
By detecting and inhibiting tRF-16 expression and utilizing the tRF-16 molecular target to enhance the efficacy of immunotherapy for prostate cancer, the problem of immunosuppression in the tumor microenvironment of prostate cancer was solved, achieving the effect of significantly inhibiting cancer cell growth and improving patient prognosis.
Patent Information
- Application Number
- CN202510829014.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-06-20
AI Technical Summary
Existing immune checkpoint inhibitors have poor therapeutic effects in prostate cancer, mainly due to the presence of immunosuppressive cells such as MDSCs and Tregs in the tumor microenvironment, which inhibit T cell function and make it difficult to effectively identify and eliminate cancer cells.
By detecting and inhibiting the expression of tRF-16, using tRF-16 as a target of prostate cancer-related small RNA molecules, the effect of immunotherapy is enhanced, including the use of tRF-16 inhibitors and PD-1 monoclonal antibody treatment to synergistically enhance the efficacy of immunotherapy for prostate cancer.
Significantly inhibit the growth of prostate cancer, increase the response rate of immunotherapy, improve patient prognosis, predict patient prognosis by detecting tRF-16 expression, and provide a basis for comprehensive treatment of prostate cancer.
Smart Images

Figure CN120330197B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and in particular to a tRF related to prostate cancer and applications thereof. Background Art
[0002] Immune checkpoint inhibitors (ICIs), such as PD-1 / PD-L1 inhibitors, have demonstrated significant efficacy in various cancers, but their effectiveness in prostate cancer is relatively poor. The tumor microenvironment of castration-resistant prostate cancer often exhibits immunosuppressive characteristics, resulting in suppressed function of effector immune cells such as T cells and NK cells, making it difficult for the immune system to effectively recognize and eliminate cancer cells. Studies have identified low mutational burdens and a "cold" tumor microenvironment (i.e., lack of immune cell infiltration) in prostate cancer tumors as key factors for the poor efficacy of immunotherapy. A cold tumor microenvironment harbors a large number of immunosuppressive cells, such as myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs). These cells secrete immunosuppressive factors that inhibit the function of effector T cells and NK cells, leading to an inadequate immune response. MDSCs and Tregs can also weaken anti-tumor immune responses through direct cell-cell contact or secretion of inhibitory cytokines (such as TGF-β and IL-10). Understanding the molecular mechanisms of prostate cancer immune escape and developing novel therapeutic targets to enhance response to ICIs are crucial for improving the prognosis of prostate cancer patients.
[0003] tRNA-derived fragments (tRFs) are a multifunctional class of small RNAs, approximately 14-30 nt in length, that play a crucial role in tumorigenesis and drug resistance. The generation process of tRFs is highly conserved, with tRFs being generated by cleavage from either precursor or mature tRNAs under the action of nucleases. Mature tRNA-derived tRFs are classified into three categories based on the cleavage site: 5'-tRFs, 3'-tRFs, and i-tRFs. The function of tRFs is closely related to their subcellular localization. They can be classified into two modes of action: base pairing and RNA-binding protein-dependent. In recent years, numerous studies have demonstrated that tRFs also play a crucial role in regulating the tumor immune microenvironment. Using deep sequencing, Hoen et al. found that 5'-tRFs are significantly enriched in immune cell vesicles and secreted into the microenvironment, where they function as immune signaling molecules and are delivered to the extracellular space, regulating immune responses. Studies by Chiou et al. have shown that T cells selectively excrete tRFs that inhibit their activation through vesicles, thereby maintaining T cell activation and cytokine production. However, the research on tRFs in tumor immune regulation is still in its infancy, and there are no reports on their regulation of the immune microenvironment of prostate cancer. Summary of the Invention
[0004] The purpose of the present invention is to provide a tRF related to prostate cancer and its application to solve the problems existing in the above-mentioned prior art. By detecting the expression level of tRF, the prognosis of prostate cancer can be clarified. At the same time, inhibiting the expression of tRF can enhance the efficacy of immunotherapy and the effect of treating prostate cancer. This tRF provides a solid theoretical basis and experimental foundation for the comprehensive treatment of prostate cancer.
[0005] To achieve the above object, the present invention provides the following solutions:
[0006] The present invention provides a tRF associated with prostate cancer, wherein the tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1.
[0007] The present invention also provides use of a reagent for detecting the tRF expression level in preparing a kit for predicting the prognosis of prostate cancer patients.
[0008] Preferably, the higher the tRF expression level, the worse the prognosis of the prostate cancer patient.
[0009] The present invention also provides the use of an inhibitor of tRF expression in the preparation of a drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer. The tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1.
[0010] Preferably, the inhibitor comprises the reverse complementary sequence of the sequence shown in SEQ ID NO.1, and the immunotherapy is PD-1 monoclonal antibody therapy.
[0011] The present invention also provides a kit for predicting the prognosis of prostate cancer patients, comprising a reagent for detecting the expression level of the tRF.
[0012] The present invention also provides a drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer, wherein the drug is a drug that inhibits the expression of tRF.
[0013] The present invention discloses the following technical effects:
[0014] The present invention provides a tRF-16 molecular target that can be used for prognosis evaluation of prostate cancer patients and immunotherapy sensitization.
[0015] The present invention experimentally found that tRF-16, which was significantly overexpressed in the anti-PD-1 treatment non-response group, was most significantly correlated with progression-free survival, and the higher the expression level, the shorter the patient's progression-free survival. tRF-16 expression in tumor tissue was significantly higher than in adjacent normal tissue, and the expression level in advanced patients was significantly higher than that in early-stage patients. Furthermore, the higher the expression level, the shorter the patient's overall survival and the worse the prognosis. These characteristics indicate that tRF-16 can be used as one of the important indicators for determining the clinical outcomes of prostate cancer patients.
[0016] In vivo experiments in this study revealed that prostate cancer escapes the immune system and inhibits the therapeutic effects of PD-1 monoclonal antibodies. Knockdown of tRF-16 significantly inhibited tumor growth in immunocompetent (Balb / c) mice but did not affect tumor growth in immunodeficient (Nudemice) mice. Further treatment of immunocompetent tumor-bearing mice with PD-1 monoclonal antibodies revealed that knockdown of tRF-16 further enhanced the inhibitory effect of PD-1 monoclonal antibodies on tumor growth. This suggests that knockdown of tRF-16 can promote the immune system's killing of prostate cancer and synergistically enhance the therapeutic effects of PD-1 monoclonal antibodies. Single-cell sequencing combined with flow cytometry revealed that tRF-16 promotes the chemotaxis and infiltration of Treg cells within tumors. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0018] Figure 1 To screen tRFs related to prostate cancer; A: CD8 + Up / downregulated tRFs in T-depleted regions relative to non-depleted regions; B: Correlation analysis between differentially expressed tRFs and TCGA prostate cancer patient survival; C: Correlation analysis between 10 tRFs and patient survival validated in the prostate cancer cohort of Qilu Hospital of Shandong University; D: Correlation analysis between tRF-16 expression and overall survival of prostate cancer patients; E: Correlation analysis between tRF-16 expression and progression-free survival of prostate cancer patients; F: Differential analysis of tRF-16 expression in prostate cancer and adjacent adjacent tissues; G: Differential analysis of tRF-16 expression in cancer tissues of patients at different stages;
[0019] Figure 2To investigate the effect of tRF-16 on the prostate cancer microenvironment; A: Growth curve of RM-1 cell subcutaneous xenografts in Balb / c nude mice; B: Growth curve of RM-1 cell subcutaneous xenografts in C57BL / 6N mice;
[0020] Figure 3 To investigate the outcomes of specific immune cell classes regulated by tRF-16 in the prostate cancer tumor microenvironment;
[0021] Figure 4 Results of a study on the molecular mechanism by which tRF-16 promotes Treg cell infiltration; A: tRF-16 pulldown assay verifies the binding of tRF-16 to DDX5; B: tRF-16 expression is altered to detect changes in DDX5 protein stability; C: tRF-16 expression is altered to detect DDX5 protein ubiquitination levels using IP assay;
[0022] Figure 5 The effects of tRF-16 on chemokine expression, Treg cells and CD8 + Effects of T cell numbers; A: Experimental flow chart to verify whether DDX5 participates in the regulation of gene transcription as a transcriptional cofactor; B: Prostate cancer cells knock down tRF-16 and DDX5 respectively, and RNAseq is performed to identify downregulated candidate differentially expressed genes; C: Experimental flow chart to verify whether tRF-16 affects the chemotaxis of Treg cells; D: Changing the expression of tRF-16 in prostate cancer cells and detecting the chemotaxis of culture supernatants on Treg cells; E: Treg and CD8 + T cells were co-cultured at different ratios to detect CD8 + T cell proliferation ability; F: Treg and CD8 + T cells were co-cultured at different ratios, and the production of IFN-γ was detected. DETAILED DESCRIPTION
[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0024] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.
[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0028] Example 1
[0029] Tissue samples were collected from 41 prostate cancer patients receiving anti-PD-1 treatment at Qilu Hospital of Shandong University (treatment response group CR / PR, n=11; treatment non-response group SD / PD, n=30) for tRF&tiRNA sequencing. This part of the work was completed by the sequencing company Digital Spectrum Biotechnology.
[0030] A large amount of immunohistochemical data in the early stage showed that CD8 + T cell exhaustion region (CD8 + PD-1 + T cells) and CD8 + T cell non-exhausted region (CD8 + PD-1 - To find tRFs that can affect the efficacy of ICIs in prostate cancer, the applicants circled CD8 + T cell exhaustion region and CD8 + T cells were harvested from non-depleted areas of the target region using LCM capture, and RNA was extracted for tRF PCR array analysis. This experiment used the nrStar™ tRF & tiRNA PCR Chip Kit (Digital Bio) according to the manufacturer's instructions.
[0031] The results showed that CD8 + Compared with the non-exhausted area of T cells, CD8 +In the T cell exhaustion zone, 30 tRFs were significantly up-regulated and 8 tRFs were significantly down-regulated. Figure 1 A. These significantly different tRFs were correlated with the survival of prostate cancer patients in the TCGA database, and 10 tRFs were significantly correlated (see Figure 1 In a cohort of 100 prostate cancer patients from Qilu Hospital of Shandong University, only tRF-16-RP9830D (tRF-16 for short) was significantly associated with the survival of prostate cancer patients, and patients with high tRF-16 expression had shorter overall survival and progression-free survival (see Figure 1 The above results indicate that tRF-16 is significantly correlated with the prognosis of prostate cancer patients.
[0032] tRF-16 expression in tissue samples was detected by qRT-PCR. The specific steps were as follows: total RNA was extracted from prostate cancer tissues of 41 patients and amplified by qPCR. The upstream primer was shown in SEQ ID NO. 2, with a specific sequence of 5'-CGCGCGGGTAGTGTGG-3'; the downstream primer was shown in SEQ ID NO. 3, with a specific sequence of 5'-AGTGCAGGGTCCGAGGTATT-3'. The upstream and downstream primers were designed and synthesized by Shanghai Jima Biotechnology Co., Ltd. The total qPCR system was a 10 μL system: 5 μL of 2×SYBR Green Pro Taq Premix, 1 μL of cDNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer, and 3.6 μL of enzyme-free sterile water. The two-step qPCR amplification procedure was as follows: 95°C for 30 seconds; 95°C for 5 seconds, 60°C for 30 seconds, and 40 cycles.
[0033] The results showed that the expression level of tRF-16 in adjacent tissues was significantly lower than that in cancer tissues; the expression level in advanced patients (stage III / IV) was significantly higher than that in early patients (stage I / II). Figure 1 The nucleotide sequence of tRF-16 is shown in SEQ ID NO. 1, specifically 5'-GGTAGTGTGGCCGAGC-3'.
[0034] Example 2
[0035] In vivo experiments have found that tRF-16 does not affect the growth of nude mouse transplanted tumors, suggesting that it may indirectly affect the tumor microenvironment. In vivo experiments have been conducted to investigate the effects of tRF-16 on the prostate cancer microenvironment. The specific procedures are as follows:
[0036] Stable transgenic cells stably overexpressing and knocking down tRF-16 were constructed as follows: a random control sequence, a tRF-16 sense chain sequence, and a tRF-16 antisense chain sequence (the reverse complementary sequence of the sequence shown in SEQ ID NO.1) were cloned into the lentiviral plasmid vector pLent-U6-shRNA-CMV-luciferase-P2A-puro vector, respectively, to construct recombinant vectors. The recombinant vectors and the lentiviral packaging plasmids were co-transfected into 293T cells to prepare lentivirus. The lentiviral particles were collected and used to infect RM-1 cells. After resistance screening, RM-1 cells transfected with an empty vector, RM-1 cells stably overexpressing tRF-16, or RM-1 cells stably knocking down tRF-16 were obtained.
[0037] The RM-1 (mouse-derived cell) subcutaneous transplant tumor models were established in Balb / c nude mice and C57BL / 6N mice to investigate the effect of tRF-16 on tumor growth. 6 RM-1 cells (RM-1 cells transfected with an empty vector, RM-1 cells stably overexpressing tRF-16, or RM-1 cells stably knocking down tRF-16) were inoculated subcutaneously on the back of mice to establish a subcutaneous xenograft tumor model. Tumor volume was measured using a vernier caliper, and tumor growth rates were compared among the groups. Measurements were taken at one, two, and three weeks after model establishment. RM-1 cells transfected with an empty vector served as the control group.
[0038] The results are as follows Figure 2 As shown in the Balb / c nude mouse model, the growth rate of transplanted tumors in the tRF-16 knockdown group was not significantly different from that in the control group (see Figure 2 The results of the C57BL / 6N mouse model showed that the growth rate of transplanted tumors in the tRF-16 knockdown group was significantly slower than that in the control group (see Figure 2 Middle B) suggests that in the process of malignant progression of prostate cancer, the inhibitory effect of tRF-16 on the tumor immune microenvironment may play a more important role than its pro-proliferative effect on tumor cells themselves.
[0039] Example 3
[0040] To investigate the specific immune cell types regulated by tRF-16 in the prostate cancer tumor microenvironment, we used control / stable tRF-16 knockdown RM-1 cell lines to establish a subcutaneous xenograft tumor model in C57BL / 6N mice. Tumor tissues were dissociated for single-cell sequencing. Bioinformatics analysis revealed that the proportion of Treg cells in the tRF-16 knockdown group was significantly decreased (see Figure 3 ).
[0041] To verify the results of single-cell sequencing, RM-1 cell lines with stable overexpression / knockdown of tRF-16 were used to establish subcutaneous tumor models in C57BL / 6N mice. Tumor tissues were dissociated and flow cytometry was used to detect the infiltration of Treg cells in subcutaneous tumors of RM-1 cells in C57BL / 6N mice. The analysis found that the tRF-16 overexpression group had more Treg cell infiltration in the tumor; conversely, the opposite result was obtained when tRF-16 was knocked down. Figure 3 .
[0042] The above results suggest that tRF-16 induces increased Treg cell infiltration in prostate cancer tissues.
[0043] Example 4
[0044] To further explore the molecular mechanism by which tRF-16 promotes Treg cell infiltration, RNA pulldown combined with protein profiling (see "Inflammatory cytokine-regulated tRNA-derived fragment tRF-21 suppresses pancreatic ductal adenocarcinoma progression," PMID: 34779408) identified DDX5 as potentially binding to tRF-16. Protein lysates from DU-145 and PC-3 prostate cancer cells were collected and incubated with biotin-labeled probes containing either the sense or antisense complement of tRF-16 for in vitro binding assays. A nontargeting sequence (UUGUACUACACAAAAGUACUG, SEQ ID NO. 4) served as a negative control.
[0045] The results are as follows Figure 4 As shown, when tRF-16 is overexpressed or knocked down, DDX5 mRNA levels remain unchanged, but protein levels are significantly upregulated or downregulated, suggesting that tRF-16 binding to DDX5 may affect its post-translational modification. Further studies revealed that tRF-16 knockdown significantly decreased DDX5 protein stability. In vitro IP experiments demonstrated that tRF-16 overexpression significantly reduced DDX5 ubiquitination; conversely, tRF-16 knockdown had the opposite effect, suggesting that tRF-16 inhibits DDX5 ubiquitination and degradation.
[0046] The above results indicate that tRF-16 binds to DDX5 and inhibits its ubiquitination and degradation.
[0047] Example 5
[0048] DDX5, as a transcriptional cofactor, can participate in regulating gene transcription. In order to find downstream effector genes regulated by both tRF-16 and DDX5, control cells (DU-145), tRF-16 KD (tRF-16 knockdown) and DDX5 KD (DDX5 knockdown) prostate cancer cells were collected for RNA-seq. Among them, the construction method of DDX5 KD prostate cancer cells refers to Example 2, and the siRNA sequence for knocking out DDX5 is GCUCUAAGUGGAUUGGAUATT (SEQ ID NO.5). The above experimental flow chart is shown in Figure 5 Middle A.
[0049] like Figure 5 As shown in Figure B, bioinformatics analysis results indicate that both tRF-16 KD and DDX5 KD downregulate the expression of key genes in the chemokine signaling pathway. Among the 19 key genes downregulated by both tRF-16 and DDX5 KD, CCL22, CCL28, and CXCL12 are known Treg cell chemokines. However, the specific chemokine expression regulated by tRF-16 and DDX5, as well as the specific regulatory mechanisms, require further investigation.
[0050] To verify whether tRF-16 affects Treg cell chemotaxis, culture supernatants of control cells, tRF-16 OE (tRF-16 overexpression) and tRF-16 KD (tRF-16 knockdown) prostate cancer cells were collected (see the flowchart for Figure 5 C) and placed in the lower chamber of the transwell, peripheral blood mononuclear cells (PBMCs) were isolated from human whole blood and placed in the upper chamber, and after 6 hours, cells that migrated from the upper chamber were collected for flow cytometry analysis. Figure 5 As shown in Figure D, the results showed that more Treg cells migrated from the tRF-16 OE group, while fewer migrated from the tRF-16 KD group, suggesting that tRF-16 may recruit Treg cells by regulating chemokine expression. + T cells were co-cultured at different cell number ratios (0:1, 1:8, 1:4, 1:2, 1:1) to detect CD8 + T cell proliferation and IFN-γ production. Figure 5 As shown in Figure EF, the results showed that Treg cells inhibited CD8 + T cell proliferation and IFN-γ production.
[0051] These results indicate that tRF-16 regulates chemokine expression, recruits Treg cells and inhibits CD8 + T cell proliferation.
[0052] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. Use of a reagent for detecting tRF expression in a tissue sample of a prostate cancer patient in the preparation of a kit for predicting the prognosis of a prostate cancer patient, characterized in that: The tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1; The prostate cancer patient is a patient receiving anti-PD-1 treatment.
2. The use according to claim 1, characterized in that The higher the tRF expression level, the worse the prognosis of prostate cancer patients.
3. Use of an inhibitor of tRF expression in the preparation of a drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer, characterized in that: The tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1; The inhibitor includes the reverse complementary sequence of the sequence shown in SEQ ID NO.1, and the immunotherapy is PD-1 monoclonal antibody therapy.
Citation Information
Patent Citations
Blood marker for cervical cancer diagnosis and application thereof
CN120290726A