A multiplex probe primer set, application and kit thereof

Abstract

The application belongs to the field of biology and discloses a multiplex primer probe set and application thereof, wherein the multiplex primer probe set comprises primers and probes corresponding to seven respiratory tract infection pathogens, i.e., canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, new coronavirus and Bordetella bronchiseptica, and the application further discloses a kit composed of qPCR reaction liquid A1, qPCR reaction liquid A2, enzyme mixture, positive quality control and negative quality control. In the application, the multiplex qPCR kit is simple to operate and short in time consumption, and the seven different respiratory tract infection pathogens can be detected by a two-tube reaction system at one time, and the minimum detection concentration of the seven respiratory tract infection pathogens is 0.1 copies / uL, so the kit is suitable for clinical rapid detection of respiratory tract pathogens and is helpful for timely and correct treatment of the infected pathogens.

Description

Technical Field

[0001] This application relates to the field of biology, and in particular to a multiplex probe primer set and its applications and reagent kits. Background Technology

[0002] Respiratory diseases are common in veterinary clinical diagnosis, occurring year-round, but less frequently in summer, with peak incidence during periods of frequent temperature fluctuations. Canine Infectious Respiratory Disease (CIRD) is an acute, highly contagious disease caused by a variety of infectious pathogens. These pathogens include traditional canine parainfluenza virus (CPIV), canine adenovirus (CAV), canine distemper virus (CDV), and Bordetella bronchiseptica (Bb), as well as emerging pathogens related to CIRD such as canine influenza virus (CIV) and canine respiratory coronavirus (CRCov). Many pathogens may not be immune to humans as previously thought; they may develop this ability in both animals and humans. The scarcity of monitoring methods at the animal-to-human transmission interface provides opportunities for unpredictable and uncontrollable viral evolution. Furthermore, the general lack of immunity in the human population to emerging viruses, coupled with the absence of timely and effective vaccines and drugs, makes strengthening research into pathogen identification and diagnostic techniques, developing multiplex detection technologies, and improving the ability to detect pathogenic microorganisms—achieving the goal of early intervention—a crucial aspect of disease and epidemic prevention and control.

[0003] Chinese patent application 202211275201.3 discloses primers and probes for dual TaqMan quantitative PCR of canine distemper virus (CDV) and canine coronavirus (CCov), wherein the primers and probes for canine distemper virus (CDV) and canine coronavirus (CCov) are as follows:

[0004] CDV-F: AAATCAACGGACCTAAATTAACTGG;

[0005] CDV-R: TCATCTGCCTCAGAATCCAAAC;

[0006] CDV-Probe: HEX-ACTCTGTTTGTGGTCTTACATTTGC-BHQ1;

[0007] CCoV-F: GGTGACAGCGATCTCGTTGC;

[0008] CCoV-R: CTTCAATCTGGTCGCCATCTTC;

[0009] CCoV-Probe: HEX-CATTCTGTTTGGAAGCTATTGGAC-BHQ1.

[0010] This method can detect two different pathogens in a single sample simultaneously. It has the advantages of high specificity, high sensitivity, simple operation and low chance of aerosol contamination, providing technical support for the epidemiological investigation and differential diagnosis of viral diarrhea in fur-bearing animals.

[0011] Chinese patent application 201911179200.7 discloses a quadruple real-time quantitative PCR detection method for canine adenovirus type II (CAV-II), canine distemper virus (CDV), canine parvovirus (CPV), and canine parainfluenza virus (CPIV). The method utilizes primers and probes for these viruses, as described below:

[0012] CAV2-F: GATGTAAATGACCAGTCCTTTGC;

[0013] CAV2-R: AGTAGGGGTCGTAAGGTGAGC;

[0014] CAV2-P: GTCTTCTGCCAACATGCTTTATCCC;

[0015] CDV-F: AGAAACAAGAGGAGCAAAAAAACTG;

[0016] CDV-R: TCAATGCTTGGATCTAGAGGTAATG;

[0017] CDV-P: CCTTTGGAGGAGGACAGTTGCCTTCTTAT;

[0018] CPV-F: TGAACTTGCTACAGGGACATTTTT;

[0019] CPV-R:ATTTCCATTTGAGTTACACCAC;

[0020] CPV-P:ATGGCAAACAAATAGAGCATTGGGCTTACC;

[0021] CPIV-F:CATATGAGCGATTCACACTCACTC;

[0022] CPIV-R: CATTACTGAGAACAATCCGTAGGC;

[0023] CPIV-P: ACTGCAAGATCAGAGTGAGGAAGGTACAATCC.

[0024] This kit is easy to use, highly specific, sensitive, and reproducible. It can be used not only for qualitative identification and detection of canine adenovirus type II, canine distemper virus, canine parvovirus, and canine parainfluenza virus, but also for accurate quantification. It can be applied in quality monitoring and rational vaccine formulation during the vaccine production process.

[0025] The two schemes mentioned above propose detection methods for simultaneously detecting two pathogens and simultaneously detecting four pathogens, respectively, and both can identify them quickly and accurately.

[0026] The problem this solution aims to solve is: how to create a multiplex qPCR kit that can simultaneously detect more pathogens. Summary of the Invention

[0027] The purpose of this application is to provide a multiplex probe primer set and its application, as well as a kit, to solve the technical problems of existing technologies for detecting canine respiratory pathogens, which are mainly single-pathogen detections, which are time-consuming and cannot simultaneously achieve rapid and accurate detection and identification of multiple pathogens, thus addressing the potential threat of canine respiratory pathogens in clinical practice.

[0028] To achieve the above objectives, this application discloses a multiple primer-probe set, characterized in that it includes a first primer set, a first probe, a second primer set, a second probe, a third primer set, a third probe, a fourth primer set, a fourth probe, a fifth primer set, a fifth probe, a sixth primer set, a sixth probe, a seventh primer set, and a seventh probe.

[0029] The first primer set and the first probe were designed using specific gene fragments of canine distemper virus;

[0030] The second primer set and the second probe were designed using specific gene fragments of canine adenovirus type 2;

[0031] The third primer set and the third probe were designed using specific gene fragments of canine parainfluenza virus.

[0032] The fourth primer set and the fourth probe were designed using specific gene fragments of canine influenza virus.

[0033] The fifth primer set and the fifth probe were designed using specific gene fragments of canine respiratory coronavirus.

[0034] The sixth primer set and the sixth probe were designed using specific gene fragments of the novel coronavirus.

[0035] The seventh primer set and the seventh probe were designed using specific gene fragments of Bordetella bronchiseptica.

[0036] Preferably, the first primer set includes a first forward primer and a first reverse primer, the nucleotide sequence of the first forward primer is shown in SEQ ID NO: 1, the nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the first probe is shown in SEQ ID NO: 3;

[0037] The second primer set includes a second forward primer and a second reverse primer. The nucleotide sequence of the second forward primer is shown in SEQ ID NO: 4, the nucleotide sequence of the second reverse primer is shown in SEQ ID NO: 5, and the nucleotide sequence of the second probe is shown in SEQ ID NO: 6.

[0038] The third primer set includes a third forward primer and a third reverse primer. The nucleotide sequence of the third forward primer is shown in SEQ ID NO: 7, the nucleotide sequence of the third reverse primer is shown in SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown in SEQ ID NO: 9.

[0039] The fourth primer set includes a fourth forward primer and a fourth reverse primer. The nucleotide sequence of the fourth forward primer is shown in SEQ ID NO: 10, the nucleotide sequence of the fourth reverse primer is shown in SEQ ID NO: 11, and the nucleotide sequence of the fourth probe is shown in SEQ ID NO: 12.

[0040] The fifth primer set includes a fifth forward primer and a fifth reverse primer. The nucleotide sequence of the fifth forward primer is shown in SEQ ID NO: 13, the nucleotide sequence of the fifth reverse primer is shown in SEQ ID NO: 14, and the nucleotide sequence of the fifth probe is shown in SEQ ID NO: 15.

[0041] The sixth primer set includes a sixth forward primer and a sixth reverse primer. The nucleotide sequence of the sixth forward primer is shown in SEQ ID NO: 16, the nucleotide sequence of the sixth reverse primer is shown in SEQ ID NO: 7, and the nucleotide sequence of the sixth probe is shown in SEQ ID NO: 18.

[0042] The seventh primer set includes a seventh forward primer and a seventh reverse primer. The nucleotide sequence of the seventh forward primer is shown in SEQ ID NO: 19, the nucleotide sequence of the seventh reverse primer is shown in SEQ ID NO: 20, and the nucleotide sequence of the seventh probe is shown in SEQ ID NO: 21.

[0043] Preferably, the 5' end of the first probe is labeled with the fluorescent group HEX, and the 3' end is labeled with the quenching group BHQ1;

[0044] The second probe is labeled with the fluorescent group FAM at its 5' end and with the quenching group BHQ1 at its 3' end;

[0045] The third probe is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end;

[0046] The fourth probe is labeled with the fluorescent group HEX at its 5' end and the quenching group BHQ1 at its 3' end;

[0047] The fifth probe is labeled with the fluorescent group CY5 at its 5' end and the quenching group BHQ3 at its 3' end.

[0048] The 5' end of the sixth probe is labeled with the fluorescent group Texas Red, and the 3' end is labeled with the quenching group BHQ2;

[0049] The 5' end of the seventh probe is labeled with the fluorescent group CY5, and the 3' end is labeled with the quenching group BHQ3.

[0050] In addition, this application also discloses the use of the multiplex primer-probe set described above in the preparation of multiplex qPCR kits.

[0051] In addition, this application also discloses a kit comprising qPCR reaction solution A1 and qPCR reaction solution A2 containing the above-described multiple probe primer set;

[0052] The qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2, canine influenza virus, Bordetella bronchiseptica, and SARS-CoV-2.

[0053] The qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus, canine parainfluenza virus, and canine respiratory coronavirus.

[0054] Preferably, the concentrations of primers and probes contained in qPCR reaction solution A1 and qPCR reaction solution A2 are both 0.1–1 μM.

[0055] Preferably, it also includes an enzyme mixture, a positive control, and a negative control.

[0056] Preferably, the enzyme mixture consists of dNTPs, Taq enzyme, and MMLV enzyme, and the concentration of dNTPs is 0.2–0.4 mM, the concentration of Taq enzyme is 2.5–10 U, and the concentration of MMLV enzyme is 2.5–10 U.

[0057] The positive control is a plasmid containing the target gene being tested;

[0058] The negative control sample is sterilized water.

[0059] Preferably, the dNTPs in the enzyme mixture are composed of five substances: dATP, dUTP, dCTP, dGTP and dTTP, and the concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP is 1-3:2-4:1-3:1-3:1.

[0060] Preferably, the kit has a minimum detection concentration of 0.1 copies / uL for seven pathogens: canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, SARS-CoV-2, and Bordetella bronchiseptica.

[0061] The beneficial effects of this application are:

[0062] This application provides a multiplex qPCR kit for the simultaneous detection of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb). This kit offers advantages such as high specificity, high sensitivity, and good reproducibility. The kit is simple to use and quick to detect these six common respiratory pathogens in a single two-tube reaction system, providing accurate results. It is suitable for rapid clinical detection of respiratory pathogens, facilitating timely and appropriate treatment. Attached Figure Description

[0063] Figure 1 To determine the applicable concentration range of qPCR primers and probes in reaction solution A1;

[0064] Figure 2 To determine the applicable concentration range of qPCR primers and probes in reaction solution A2.

[0065] Figure 3 CDV multiplex real-time quantitative PCR amplification curve and standard curve;

[0066] Figure 4 CAV-2 multiplex real-time quantitative PCR amplification curve and standard curve;

[0067] Figure 5 For CPIV multiplex real-time quantitative PCR amplification curves and standard curves;

[0068] Figure 6 CIV multiplex real-time quantitative PCR amplification curve and standard curve;

[0069] Figure 7 CRCAV multiplex real-time quantitative PCR amplification curve and standard curve;

[0070] Figure 8 Amplification curves and standard curves for SARS-CoV-2 multiplex real-time quantitative PCR.

[0071] Figure 9 Amplification curves and standard curves for Bb multiplex real-time quantitative PCR.

[0072] Figure 10 To test the accuracy of reaction solution A1, the amplification curve was detected.

[0073] Figure 11 The amplification curve was detected to test the accuracy of reaction solution A2;

[0074] Figure 12 Primer-specific melting curves;

[0075] Figure 13 The results show the detection comparison between the singlet qPCR reaction system and the multiplex qPCR reaction system described in Example 2. Detailed Implementation

[0076] In the description of this application, it should be noted that, unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0077] Example 1

[0078] 1. Design of multiplex qPCR primers and probes and establishment of detection methods

[0079] This application, through sequence comparison of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb), designed primers, conducted experimental verification and screening, and adjusted and re-verified the results, obtaining a set of multiplex qPCR primers and probes that can be used for simultaneous detection. The primer and probe sequences are shown in Table 1, and the corresponding detection method was established.

[0080] Table 1. Primer and probe sequences for multiplex qPCR

[0081]

[0082] 2. Establishment of detection methods

[0083] Based on the multiplex qPCR primers and probes shown in Table 1, this application constructed corresponding detection methods using plasmids containing the target genes of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb). The primers and probes shown in Table 1 were divided into two groups, and the above seven different respiratory pathogens were detected simultaneously using a two-tube reaction system.

[0084] The reaction system consists of 20 μL of qPCR reaction solution A1 or qPCR reaction solution A2, and 5 μL of nucleic acid from the sample to be tested. Specifically, qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), Bordetella bronchiseptica (Bb), and SARS-CoV-2, as well as qPCR reaction buffer; qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus (CDV), canine parainfluenza virus (CPIV), and canine respiratory coronavirus (CRcoV), as well as qPCR reaction buffer.

[0085] The reaction procedure was as follows: 50°C, 2 min, 95°C, 5 min, 1 cycle; 95°C, 5 sec, 60°C, 35 sec (fluorescence collection), 45 cycles.

[0086] This application also optimized the concentrations of primers and probes in qPCR reaction solutions A1 and A2. With other component concentrations remaining constant, the concentrations of qPCR primers and probes in qPCR reaction solutions A1 and A2 were diluted to 0.1 μM, 0.5 μM, and 1 μM, respectively, for qPCR detection to identify suitable concentrations for qPCR detection.

[0087] like Figure 1-2 As shown, in the constructed reaction system, the applicable concentration range of the multiplex qPCR primers and probes is 0.1–1 μM; they are applicable within the above concentration range and the detection efficiency is not significantly different.

[0088] Example 2

[0089] Multiplex qPCR kit for detecting 7 respiratory pathogens

[0090] Based on the multiplex qPCR primers, probes, and detection methods described in Example 1, this application also provides a usable multiplex qPCR kit.

[0091] 1. Components of the reagent kit

[0092] The multiplex qPCR kit for detecting various respiratory pathogens includes qPCR reaction solution A1, qPCR reaction solution A2, enzyme mixture, positive control, and negative control.

[0093] The qPCR reaction solution A1 contains multiplex qPCR primers and probes (as shown in Table 1) and qPCR reaction buffer for detecting canine adenovirus type 2 (CAV-2), canine influenza virus (CIV), Bordetella bronchiseptica (Bb), and SARS-CoV-2.

[0094] qPCR reaction solution A2 contains multiplex qPCR primers and probes (shown in Table 1) and qPCR reaction buffer for detecting canine distemper virus (CDV), canine parainfluenza virus (CPIV), and canine respiratory coronavirus (CRcoV).

[0095] The qPCR reaction buffer has a concentration of 2-5 mM for MgCl2, 20-50 mM for KCl, and 20-50 mM for Tris-HCl.

[0096] The enzyme mixture contains dNTPs, Taq enzyme, and MMLV enzyme. The concentration of the dNTPs is 0.2–0.4 mM, and the concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP in the dNTPs is 2:3:2:2:1. The concentration of Taq enzyme is 2.5–10 U, and the concentration of MMLV enzyme is 2.5–10 U.

[0097] The positive control is a plasmid containing the target gene being tested;

[0098] The negative control sample is sterilized water.

[0099] 2. Instructions for using the kit

[0100] This application also provides a method for using the kit, including the following steps:

[0101] (1) Extracting nucleic acid from the sample to be tested; The reagent used to extract nucleic acid from the sample in this embodiment is a nucleic acid extraction or purification reagent (Su Xi Medical Device Registration No. 20190009) produced by Wuxi Baitaike Biotechnology Co., Ltd., and positive and negative quality control products are extracted simultaneously;

[0102] (2) Perform qPCR reaction; take 10 μL of the extracted sample nucleic acid, add qPCR reaction solution A1 or qPCR reaction solution A2 (17 μL) and enzyme mixture (3 μL), and perform amplification reaction in a real-time fluorescence PCR instrument; the reaction program is: 50℃, 2 min, 95℃, 5 min, 1 cycle; 95℃, 5 sec, 60℃, 35 sec (collect fluorescence), 45 cycles;

[0103] (3) Result determination: The fluorescence channels were selected sequentially as FAM, HEX, Texas Red and Cy5. After qPCR, the negative and positive results of the corresponding pathogen nucleic acid were determined by the different fluorescence channel curves and Ct values.

[0104] When the Ct value corresponding to each channel is ≤ the positive cutoff value and the amplification curve shows a significant exponential increase, the test result of the corresponding channel is interpreted as positive; when the Ct value corresponding to each channel is 35≤Ct≤40 and the amplification curve is not obvious, the test of the corresponding channel needs to be repeated. If the result is still interpreted as positive, when the Ct value is >40 or there is no Ct value, the corresponding channel is interpreted as negative; as shown in Table 2:

[0105] Table 2. Reagent kit evaluation results

[0106]

[0107] If 35 < Ct value < 40, repeated verification should be performed. If the results are valid multiple times, the result is positive, and the Ct values ​​are all lower than those of the negative control.

[0108] Example 3 Sensitivity Test

[0109] This embodiment tested the detection sensitivity of the kit described in Example 2. For example... Figure 3-9 As shown, plasmids of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb) were used as initial samples and diluted to 10⁻⁶. 2 10 3 10 4 10 5 10 6 and 10 7 Samples with a count between copies / µL were used as test samples for sensitivity testing. The reaction system and procedure were performed according to Example 2. The negative or positive results of the corresponding pathogen nucleic acid were determined by different fluorescence channel curves and Ct values.

[0110] The kit described in Example 2 of this application is used to dilute plasmids of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb) to 10⁻⁶. 1 Sensitivity tests were performed at concentrations of 1, 0.1 copies / µL, and the results are shown in Table 3. The results indicate that when the sample concentration is above 0.1 copies / µL, the Ct values ​​of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb) samples are all ≤40, and the amplification curves show significant exponential growth, indicating reliable detection results; even at 0.1 copies / µL, they can be detected.

[0111] Table 3 Sensitivity Test

[0112]

[0113] Example 4 Specificity Test

[0114] To test the detection specificity of the method described in Example 2 of this application, other common pathogens and physiological saline were selected for specificity testing. Physiological saline, parvovirus, and rabies virus were used as specificity references to test the detection specificity of the kit constructed in Example 2 of this application.

[0115] The detection results for other common pathogens and physiological saline are shown in Table 4. It can be seen that the kit described in this application did not produce an amplification curve when detecting other common pathogens, indicating that the kit has good detection specificity and can specifically detect them.

[0116] Table 4 Specificity Tests

[0117] template A1 reaction solution A2 reaction solution Mixture 1 (physiological saline, parvovirus, rabies virus, canine distemper virus) - + Mixture 2 (physiological saline, parvovirus, rabies virus) - - Mixture 3 (physiological saline, parvovirus, rabies virus, canine influenza virus) + - physiological saline - - Rabies virus - - Parvovirus - -

[0118] Note: "+" indicates specificity, and "-" indicates non-specificity.

[0119] Example 5 Precision Test

[0120] This embodiment tested the detection precision of the kit described in Example 2. The pre-determined positive plasmid was used as a precision reference, with a final concentration of 10 for each pathogen in the precision reference. 2 and 10 4For each template, 3 copies / µL were prepared according to the kit usage method described in Example 2, and 3 replicates were prepared for each replicate. The coefficient of variation of the precision reference at each concentration was calculated.

[0121] The coefficient of variation of the kit described in Example 2 of this application for different concentrations of precision reference material is shown in Table 5.

[0122] Table 5. Coefficients of variation of precision reference materials at different concentrations

[0123]

[0124] Example 6 Accuracy Test

[0125] This application prepared low concentrations (specifically, concentrations of 10) of [material name missing]. 2 After obtaining plasmids (copies / µL), detection was performed using the method described in Example 2.

[0126] Test results as follows Figure 10-11 As shown, the kit described in Example 2 of this application showed positive results for the corresponding positive reference samples of each pathogen, indicating accurate detection results. Furthermore, when the sample tested was canine influenza virus, the primers and probes used for detection, including canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb), showed no amplification curves. This indicates that the primers and probes in the reaction system do not cross-react with other pathogens.

[0127] Example 7: Actual Detection of Clinical Samples

[0128] This application collected clinical samples from suspected cases of upper respiratory tract infection and conducted actual testing on the clinical samples using the kit described in Example 2.

[0129] Oropharyngeal swab clinical samples were collected from 80 suspected cases of upper respiratory tract infection. Nucleic acid was extracted from the clinical samples using nucleic acid extraction or purification reagent (Su Xi Medical Device Registration No. 20190009) produced by Wuxi Biotech Co., Ltd. Positive and negative control samples in the kit were used simultaneously for extraction. 5 μL of the extracted nucleic acid sample was taken and amplified according to the kit usage method described in Example 2. After qPCR, the negative and positive results of the corresponding pathogen nucleic acid were determined by different fluorescence channel curves and Ct values, using the same method as in Example 2.

[0130] Among the 80 suspected respiratory infection clinical samples tested, 7 were positive for canine parainfluenza virus, 6 for canine respiratory coronavirus, 2 for canine influenza virus, 1 for canine distemper virus, 1 for canine adenovirus, 1 for novel coronavirus, and 1 for Bordetella bronchiseptica. This application also sequenced the amplification results of the above-mentioned positive clinical samples. The sequencing alignment results were identical to the kit's detection results, indicating that the kit's detection accuracy reached 100%, further demonstrating the clinical detection accuracy of the detection system and method constructed in this application for simultaneously detecting seven respiratory pathogens.

[0131] Comparative Example 1

[0132] This application utilized primer design software to design multiple sets of qPCR primers and probes targeting the nucleic acid sequences of canine distemper virus (CDV), canine adenovirus type 2 (CAV-2), canine parainfluenza virus (CPIV), canine influenza virus (CIV), canine respiratory coronavirus (CRcoV), SARS-CoV-2, and Bordetella bronchiseptica (Bb). However, single-channel qPCR assays revealed that the specificity of some primer pairs did not meet the requirements. For example, the primers designed in this application for detecting canine influenza virus (CIV) have the following sequences:

[0133] CIV-M-F1-115bp: TCCTGTCACCTTTAACTAA

[0134] CIV-M-R1-115bp:TCTCCATTCCCATTTAGG

[0135] This application utilizes the aforementioned primers to perform dye-based qPCR detection using physiological saline as a sample, detecting... Figure 12 As shown, nonspecific amplification occurred, and the dissolution peaks of the primer pairs were not uniform.

[0136] Comparative Example 2

[0137] Furthermore, even single primers and probes with high screening specificity and sensitivity may not be suitable for multiplex pathogen detection systems. As shown below:

[0138] CDV-P-F2-85bp:GTCGGGGAATTTAGAATGA;

[0139] CDV-P-R2-85bp: CCATGAATCGCCTCAAAG.

[0140] Specifically, the primer CDV-P-F2 / R2 for detecting canine distemper virus is used to replace CDV-F / R in the qPCR reaction solution A2 described in this application (the comparison results of single and multiplex qPCR of the primer and probe sets selected in this application are as follows). Figure 13 As shown in Table 6, the nucleic acid of the positive sample was used for detection, and the reaction system and conditions were the same as in Example 2. The primer pair showed good specificity and sensitivity for the target nucleic acid of the canine distemper virus in a single detection system, but the amplification of low-concentration nucleic acid of the canine distemper virus target gene was significantly inhibited in a multiplex detection system, making the primer unsuitable for use in multiplex detection systems.

[0141] Table 6 Primer pair detection results

[0142]

[0143] In summary, the multiplex qPCR kit provided in Example 2 of this application can accurately detect seven viruses simultaneously using a two-tube system: canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, SARS-CoV-2, and Bordetella bronchiseptica, with a minimum detection concentration of 0.1 copies / µL; and when the pathogen concentration is 10... 2 copies / uL or 10 4 The coefficient of variation is between 1.04 and 1.29% or 0.51 and 0.68% for copies / µL, indicating that the reagent kit of this application has high precision.

[0144] Furthermore, as shown in Comparative Examples 1-2, when primers for seven other pathogens are used to replace the seven sets of primers in this application, such as replacing CIV-F / R with CIV-M-F1 / R1, the dissolution peak of the primer pair is not singular, and non-specific amplification occurs. Alternatively, when single primers and probes with good specificity and high sensitivity are used to replace the primers and probes in the multiplex qPCR kit of this application, the detection effect of the kit will also decrease. Therefore, it can be seen that this application can accurately detect the corresponding pathogens by using specific primer sets and probes. The primer sets and probes of this application cannot be replaced.

[0145] The above embodiments are preferred embodiments of this application, but the implementation of this application is not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of this application shall be considered equivalent substitutions and shall be included within the protection scope of this application.

Claims

1. A multiplex primer-probe set, characterized in that, It includes the first primer set, the first probe, the second primer set, the second probe, the third primer set, the third probe, the fourth primer set, the fourth probe, the fifth primer set, the fifth probe, the sixth primer set, the sixth probe, the seventh primer set, and the seventh probe; The first primer set and the first probe were designed using specific gene fragments of canine distemper virus; The second primer set and the second probe were designed using specific gene fragments of canine adenovirus type 2; The third primer set and the third probe were designed using specific gene fragments of canine parainfluenza virus. The fourth primer set and the fourth probe were designed using specific gene fragments of canine influenza virus. The fifth primer set and the fifth probe were designed using specific gene fragments of canine respiratory coronavirus. The sixth primer set and the sixth probe were designed using specific gene fragments of the novel coronavirus. The seventh primer set and the seventh probe were designed using specific gene fragments of Bordetella bronchiseptica. The first primer set includes a first forward primer and a first reverse primer. The nucleotide sequence of the first forward primer is shown in SEQ ID NO: 1, the nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the first probe is shown in SEQ ID NO:

3. The second primer set includes a second forward primer and a second reverse primer. The nucleotide sequence of the second forward primer is shown in SEQ ID NO: 4, the nucleotide sequence of the second reverse primer is shown in SEQ ID NO: 5, and the nucleotide sequence of the second probe is shown in SEQ ID NO:

6. The third primer set includes a third forward primer and a third reverse primer. The nucleotide sequence of the third forward primer is shown in SEQ ID NO: 7, the nucleotide sequence of the third reverse primer is shown in SEQ ID NO: 8, and the nucleotide sequence of the third probe is shown in SEQ ID NO:

9. The fourth primer set includes a fourth forward primer and a fourth reverse primer. The nucleotide sequence of the fourth forward primer is shown in SEQ ID NO: 10, the nucleotide sequence of the fourth reverse primer is shown in SEQ ID NO: 11, and the nucleotide sequence of the fourth probe is shown in SEQ ID NO:

12. The fifth primer set includes a fifth forward primer and a fifth reverse primer. The nucleotide sequence of the fifth forward primer is shown in SEQ ID NO: 13, the nucleotide sequence of the fifth reverse primer is shown in SEQ ID NO: 14, and the nucleotide sequence of the fifth probe is shown in SEQ ID NO:

15. The sixth primer set includes a sixth forward primer and a sixth reverse primer. The nucleotide sequence of the sixth forward primer is shown in SEQ ID NO: 16, the nucleotide sequence of the sixth reverse primer is shown in SEQ ID NO: 7, and the nucleotide sequence of the sixth probe is shown in SEQ ID NO:

18. The seventh primer set includes a seventh forward primer and a seventh reverse primer. The nucleotide sequence of the seventh forward primer is shown in SEQ ID NO: 19, the nucleotide sequence of the seventh reverse primer is shown in SEQ ID NO: 20, and the nucleotide sequence of the seventh probe is shown in SEQ ID NO:

21.

2. The multiple primer-probe set according to claim 1, characterized in that, The first probe is labeled with the fluorescent group HEX at its 5' end and with the quenching group BHQ1 at its 3' end; The second probe is labeled with the fluorescent group FAM at its 5' end and with the quenching group BHQ1 at its 3' end; The third probe is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end. The fourth probe is labeled with the fluorescent group HEX at its 5' end and the quenching group BHQ1 at its 3' end; The fifth probe is labeled with the fluorescent group CY5 at its 5' end and with the quenching group BHQ3 at its 3' end. The 5' end of the sixth probe is labeled with the fluorescent group Texas Red, and the 3' end is labeled with the quenching group BHQ2; The 5' end of the seventh probe is labeled with the fluorescent group CY5, and the 3' end is labeled with the quenching group BHQ3.

3. Use of the multiplex primer-probe set as described in any one of claims 1-2 in the preparation of a multiplex qPCR kit.

4. A reagent kit, characterized in that, The kit includes qPCR reaction solution A1 and qPCR reaction solution A2 containing the multiple primer and probe sets as described in any one of claims 1-2; The qPCR reaction solution A1 contains multiplex qPCR primers and probes for detecting canine adenovirus type 2, canine influenza virus, Bordetella bronchiseptica, and SARS-CoV-2. The qPCR reaction solution A2 contains multiplex qPCR primers and probes for detecting canine distemper virus, canine parainfluenza virus, and canine respiratory coronavirus.

5. The reagent kit according to claim 4, characterized in that, The primers and probes contained in the qPCR reaction solutions A1 and A2 are both 0.1–1 μM.

6. The reagent kit according to claim 4, characterized in that, It also includes enzyme mixtures, positive control samples, and negative control samples.

7. The reagent kit according to claim 6, characterized in that, The enzyme mixture consists of dNTPs, Taq enzyme, and MMLV enzyme, with the concentration of dNTPs being 0.2–0.4 mM, the concentration of Taq enzyme being 2.5–10 U, and the concentration of MMLV enzyme being 2.5–10 U. The positive control is a plasmid containing the target gene being tested; The negative control sample is sterilized water.

8. The reagent kit according to claim 7, characterized in that, The enzyme mixture contains dNTPs composed of five substances: dATP, dUTP, dCTP, dGTP, and dTTP, with a concentration ratio of dATP:dUTP:dCTP:dGTP:dTTP of 1–3:2–4:1–3:1–3:

1.

9. The reagent kit according to claim 4, characterized in that, The kit has a minimum detection limit of 0.1 copies / uL for seven pathogens: canine distemper virus, canine adenovirus type 2, canine parainfluenza virus, canine influenza virus, canine respiratory coronavirus, SARS-CoV-2, and Bordetella bronchiseptica.

Images