Application of DDX3X inhibitor in preparation of medicine for treating myocardial fibrosis

Abstract

The invention provides application of a DDX3X inhibitor in preparation of a medicine for treating myocardial fibrosis, and relates to the technical field of biological medicines. The invention relates to an application of a DDX3X inhibitor in preparation of a medicine for treating myocardial fibrosis. The invention proves that the myocardial cell fibrosis can be inhibited after the DDX3X is knocked down or knocked out, and the DDX3X inhibitor can interfere with the occurrence and development of mouse cardiac fibrosis and improve the cardiac function, thereby prompting that the DDX3X serving as the target of the anti-fibrosis medicine has a good medical transformation prospect, and further providing a research basis for preparing the anti-cardiac fibrosis medicine.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the use of a DDX3X inhibitor in the preparation of a medicament for treating myocardial fibrosis. Background Art

[0002] DDX3X (DEAD-box helicase 3X-linked) is an RNA helicase belonging to the DEAD-box protein family, which is ATP-dependent and widely involved in various biological processes. This protein has multiple conserved domains and is considered to function in both the nucleus and the cytoplasm. Nuclear functions include transcriptional regulation, mRNP assembly, pre-mRNA splicing, and mRNA export. In the cytoplasm, this protein is considered to be involved in translation, cell signaling, and viral replication. Due to the key role of DDX3X in various diseases, it has become a potential target for drug development. For example, inhibitors against DDX3X may be used for cancer treatment. In addition, the role of DDX3X in immune responses has also made it a hot spot for immunotherapy research.

[0003] Myocardial fibrosis is a remodeling process of the cardiac interstitium, which is characterized by abnormal proliferation of cardiac interstitial fibroblasts, excessive accumulation of collagen fibers, significant increase in the collagen concentration and volume fraction per unit mass of myocardium, imbalance in the ratio of various types of collagen, and abnormal distribution. Myocardial fibrosis appears to varying degrees in some common cardiovascular diseases in clinical practice, such as diabetic cardiomyopathy, viral myocarditis, ischemic cardiomyopathy, hypertensive heart disease, etc. Summary of the Invention

[0004] In order to solve the technical problems existing in the prior art, an embodiment of the present invention provides the use of a DDX3X inhibitor in the preparation of a medicament for treating myocardial fibrosis. The technical solution is as follows:

[0005] The use of a DDX3X inhibitor in the preparation of a medicament for treating myocardial fibrosis.

[0006] Optionally, the DDX3X inhibitor is RK-33, siRNA for silencing the DDX3X gene, or sgRNA for targeted knockout of the DDX3X gene.

[0007] An siRNA for silencing the DDX3X gene, and the siRNA is selected from any one of siRNA1, siRNA2, and siRNA3, wherein,

[0008] The sense strand sequence of siRNA1 is as shown in SEQ ID No.10, and the antisense strand sequence is as shown in SEQ ID No.11;

[0009] The sense strand sequence of siRNA2 is shown in SEQ ID No. 12, and the antisense strand sequence is shown in SEQ ID No. 13;

[0010] The sense strand sequence of siRNA3 is shown in SEQ ID No. 14, and the antisense strand sequence is shown in SEQ ID No. 15.

[0011] A kit for silencing the DDX3X gene, which comprises the siRNA described above.

[0012] An sgRNA for targeted knockout of the DDX3X gene, wherein the sgRNA is selected from any one of sgRNA1, sgRNA2, and sgRNA3. Among them, the nucleotide sequence of sgRNA1 is shown in SEQ ID No. 1, the nucleotide sequence of sgRNA2 is shown in SEQ ID No. 2, and the nucleotide sequence of sgRNA3 is shown in SEQ ID No. 3.

[0013] A CRISPR-Cas9 recombinant vector for targeted knockout of the DDX3X gene, wherein the CRISPR-Cas9 recombinant vector comprises the DNA sequence of the sgRNA described above.

[0014] Optionally, the plasmid for constructing the CRISPR-Cas9 recombinant vector is the lentiCRISPR V2 vector.

[0015] A kit for targeted knockout of the DDX3X gene, which comprises the sgRNA or the CRISPR-Cas9 recombinant vector described above.

[0016] A drug for treating myocardial fibrosis, which comprises a DDX3X inhibitor as the pharmaceutically active ingredient.

[0017] Optionally, the DDX3X inhibitor is RK-33, the siRNA for silencing the DDX3X gene, or the sgRNA for targeted knockout of the DDX3X gene.

[0018] Optionally, the DDX3X inhibitor is the siRNA for silencing the DDX3X gene or the sgRNA for targeted knockout of the DDX3X gene described above.

[0019] The beneficial effects brought by the technical solutions provided in the embodiments of the present invention at least include:

[0020] This study found that DDX3X is closely related to the pathogenesis of myocardial fibrosis, and the DDX3X inhibitor RK-33 can significantly improve cardiac function in a mouse model. Currently, there are no reports on the relationship between DDX3X and myocardial fibrosis. Myocardial fibrosis widely exists in various heart diseases, is related to the occurrence of cardiovascular adverse events, seriously affects the health of patients, and early diagnosis and early intervention can reduce the occurrence of cardiovascular adverse events, but there is currently no specific treatment for myocardial fibrosis. This study reveals the potential therapeutic effect of DDX3X as a new target for inhibiting the progression of cardiac fibrosis. This invention proves that knockdown or knockout of DDX3X can inhibit myocardial cell fibrosis, and the DDX3X inhibitor can intervene in the occurrence and development of cardiac fibrosis in mice and improve cardiac function, suggesting that targeting DDX3X as an anti-fibrotic drug target has good prospects for medical translation, and thus provides a research basis for the preparation of anti-cardiac fibrosis drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1A It is a Western Blot detection diagram after lysing the DDX3X knockout cell line constructed by CRISPR-Cas9 provided in Example 1 of the present invention; Figure 1B It is a diagram showing the level of the myocardial cell fibrosis marker (COL1) inhibited by angiotensin II (ANG) after knocking out DDX3X provided in Example 1 of the present invention;

[0023] Figure 2 It is a diagram showing the level of the myocardial cell fibrosis marker (α-SMA) inhibited by angiotensin II (ANG) after knocking down DDX3X provided in Example 2 of the present invention;

[0024] Figure 3A It is a diagram showing the improvement of cardiac function in a fibrosis animal model by the DDX3X inhibitor RK-33 provided in Example 3 of the present invention; Figure 3B It is a diagram showing the reduction of the level of fibrosis markers in the cardiac tissue of a fibrosis animal model by the DDX3X inhibitor RK-33. DETAILED DESCRIPTION OF THE INVENTION

[0025] The following will describe the technical solutions in the present invention with reference to the drawings.

[0026] Abbreviations:

[0027] EF: Ejection fraction

[0028] FS: Fractional shortening of the left ventricle

[0029] LVIDs: Left ventricular internal diameter at end-systole

[0030] LVIDd: Left ventricular internal diameter at end-diastole

[0031] COL1A2: Collagen Type I Alpha 2 Chain

[0032] ANP: Natriuretic peptides A

[0033] FN1: Fibronectin

[0034] SMA: α-smooth muscle actin

[0035] The DDX3X gene, whose full name is DEAD-box helicase 3 X-linked, is located in the 11.4 segment of the short arm of the X chromosome (Xp11.4). This gene encodes a protein belonging to the DEAD-box helicases family, and the proteins of this family are named after their unique "DEAD" (Asp-Glu-Ala-Asp) amino acid sequence, which confers helicase activity on them. The sequence of the DDX3X gene can be found in NCBI Reference Sequence: NM_001356.5.

[0036] Unless otherwise specified, in the context of the present invention, the DDX3X includes components such as DDX3X nucleotides and the DDX3X protein encoded by the DDX3X nucleotides.

[0037] The DDX3X inhibitor refers to a substance that can specifically down-regulate the expression level of DDX3X and / or the transcription level of its mature mRNA and / or the expression level or activity of the DDX3X protein. For example, methods such as antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking, and / or multi-targets are used to down-regulate the expression level and / or activity of DDX3X, as long as it can achieve a reduction in the level and / or activity of DDX3X.

[0038] RK-33 is a small molecule inhibitor of DDX3X (RNA helicase) and can inhibit the activity of DDX3X. CAS: 1070773-09-9.

[0039] Example 1

[0040] 1. Annealing of the upstream and downstream of sgRNA

[0041] The designed sgRNA sequences are shown in Table 1. Dissolve the upstream and downstream primers of sgRNA (10 μM, synthesized by Sangon Biotech (Shanghai) Co., Ltd.) without ribonuclease. The primer sequences are shown in Table 2, 5 μl each, with a total volume of 10 μl. After 5 minutes at 95 °C, cool down slowly at 2 °C / min until annealing at 25 °C.

[0042] Table 1 Nucleotide sequence information of sgRNA

[0043] DDX3X sgRNA Sequence sgRNA1 AGTGGAAAATGCGCTCGGGC(SEQ ID No.1) sgRNA2 TGGTCCCGGAGAGGCTCTGA(SEQ ID No.2) sgRNA3 TGGTGTTAGATGAAGCTGAC(SEQ ID No.3)

[0044] Table 2 sgRNA primer information

[0045] sgRNA1F CACCG AGTGGAAAATGCGCTCGGGC(SEQ ID No.4) sgRNA1R AAAC GCCCGAGCGCATTTTCCACT C(SEQ ID No.5) sgRNA2F CACCG TGGTCCCGGAGAGGCTCTGA(SEQ ID No.6) sgRNA2R AAACTCAGAGCCTCTCCGGGACCA C(SEQ ID No.7) sgRNA3F CACCG TGGTGTTAGATGAAGCTGAC(SEQ ID No.8) sgRNA3R AAAC GTCAGCTTCATCTAACACCA C(SEQ ID No.9)

[0046] 2. Digestion of lentiCRISPRV2 vector

[0047] Prepare a single enzyme digestion vector sample with 500 ng (0.5 μl) of lentiCRISPRV2 vector (Addgene, 52961), BsmBI (NEB) (20 units / μl) (1 μl), 3×NEB Buffer 3.1 (3 μl), and ddH2O (25.5 μl). The restriction endonuclease BsmbI performs single enzyme digestion on the lentiCRISPR V2 vector (conditions: 37 °C for 2 hours / overnight).

[0048] Use 1% agarose to electrophoretically separate the digested sample (120 V for 30 minutes). Locate and cut the target fragment on the electrophoresis display, and use a gel recovery kit (AXYGEN, AP-GX-50) to recover the target fragment according to the relevant steps of the kit to obtain a recovery product for the next ligation reaction.

[0049] Ligation of annealed sgRNA and digested vector: Ligate the annealed primer (1 μl), digested lentiCRISPRV2 vector (4 μl), T4 ligation buffer, 10× (1 μl), T4 DNA ligase (NEB, M0202) (400 units / μl) (1 μl), and ddH2O (3 μl) at 16 °C for 2 h / overnight.

[0050] Transformation: Take 5 μl of the ligation product and transform it into DH5α competent cells (-80 °C refrigerator). Thaw the DH5α competent cells on ice, aliquot the appropriate amount into pre-chilled sterile centrifuge tubes (1.5 ml), add 5 μl of the ligation product, and let it stand on ice for 30 minutes. Then heat-shock the DH5α competent cells for 60 s (42 °C), immediately place them on ice, and let it stand for 2 minutes. Add 600 μl of antibiotic-free LB medium, shake for 45 min - 1 h at 37 °C and 220 rpm. Centrifuge to pellet the bacteria to the bottom of the tube, discard the supernatant, take out the pellet and spread it on an LB solid medium plate containing ampicillin (Solarbio, A1170, 100 μg / ml). Incubate the plate upside down overnight in an incubator (37 °C).

[0051] 2. Colony sequencing identification of recombinant plasmids

[0052] Pick 3 colonies from the plate and identify positive clones by sequencing from each recombinant plasmid.

[0053] 3. Large-scale extraction of recombinant plasmids

[0054] Inoculate the correctly sequenced bacterial solution into 250 ml of LB liquid medium containing ampicillin (Solarbio, A1170, 100 μg / ml) at a ratio of 1:100, and shake and culture for 16 - 20 hours (37 °C, 220 rpm). Centrifuge for 20 minutes (4 °C, 6000 rpm), discard the supernatant to obtain the precipitated bacterial pellet. Extract the plasmid using the large-scale plasmid extraction kit from ZYMO company. The steps are as follows:

[0055] 1) Add 105 ml of 95% absolute ethanol to 28 ml of ZymoPURE TM Wash in 2 bottles.

[0056] 2) All the following operations are carried out at room temperature, except that P1 is placed in a 4 °C refrigerator and put back into the 4 °C refrigerator after use, and other reagent materials are placed at room temperature.

[0057] The operation steps are as follows:

[0058] 1) Collect the bacteria, pour 50 ml of the bacterial solution into a 50 ml centrifuge tube, centrifuge at 4500 rpm for 10 minutes;

[0059] 2) Discard the supernatant, you can tap the mouth of the centrifuge tube on the absorbent paper;

[0060] 3) Add 8 ml of P1, use a 1 ml pipette tip to disperse the pellet, and vortex thoroughly to mix;

[0061] 4) Add 8 ml of P2, immediately invert and mix 6 times, and let it stand at room temperature for 2 - 3 min;

[0062] 5) Add 8 ml of P3, invert and mix 5 times or more until the color turns yellow.

[0063] 6) Take out ZymoPURE TM Syringe Filter-X, pour in the sample from the previous step, let it stand at room temperature for 5 - 8 minutes to allow the precipitate to float on the upper layer;

[0064] 7) Remove the stopper under ZymoPURE TM Syringe Filter-X, insert the piston, and pipette out the supernatant into a new 50 - milliliter centrifuge tube (more than 20 milliliters);

[0065] 8) Add 8 milliliters of ZymoPURE TM Binding Buffer, invert and mix 8 times;

[0066] 9) Install the Zymo-Spin TM V-PS properly and place it on the vacuum pump;

[0067] 10) Add the clarified liquid from the previous step, turn on the vacuum pump, and suck out the liquid;

[0068] 11) Add 5 milliliters of ZymoPURE TM Wash 1, turn on the vacuum and suck out the liquid;

[0069] 12) Add 5 milliliters of ZymoPURE TM Wash 2, turn on the vacuum and suck out the liquid. Repeat once;

[0070] 13) Remove the small tube with filter membrane below and place it in the collection tube provided in the kit, centrifuge at 16000g for 1 minute to remove the residual washing liquid. Pay attention to marking with a marker pen in this step;

[0071] 14) Remove the small tube and place it in a new 1.5 - milliliter centrifuge tube, add 200 microliters of ZymoPURE TM ElutionBuffer, let it stand at room temperature for 2 minutes, centrifuge at 16000g for 1 minute. Elute at room temperature in the centrifuge;

[0072] 15) Take out EndoZero TM II Spin-Column, place it in a new 1.5 - milliliter centrifuge tube, add all 200 microliters of the eluate from the previous step, let it stand at room temperature for 2 minutes, centrifuge at 10000g for 1 minute;

[0073] 16) Measure the concentration and store the plasmid.

[0074] 5. Lentivirus packaging

[0075] 1) 18 - 20 hours before transfection, seed 293T cells (American Type Culture Collection, ATCC) at approximately 5×10 5 cells per well. When the cell confluence is 30% - 40% for transfection, it should not exceed 60%. Culture in 2 ml of complete medium DMEM per well;

[0076] 2) 1 - 2 hours before transfection, replace with fresh 1×DMEM and incubate in a 37°C, 5% carbon dioxide incubator;

[0077] 3) Take 2 μg of plasmid and mix it in 300 μl of 1×DMEM. Gently mix and let it stand at room temperature for 5 minutes;

[0078] 4) Take 4 μl of PEI (branched polyethyleneimine, Sigma - Aldrich, 408727) and mix it in 300 μl of 1×DMEM. Gently mix and let it stand at room temperature for 5 minutes;

[0079] 5) Gently mix the above plasmid mixture and the PEI mixture and let it stand at room temperature for 20 - 25 minutes;

[0080] 6) Aspirate the culture medium in the six - well plate, gently add the transfection mixture, shake gently, and incubate in a 5% carbon dioxide incubator at 37°C;

[0081] 7) After 4 - 6 hours, aspirate the transfection mixture and replace it with 2 ml of fresh complete medium. Incubate in a 5% carbon dioxide incubator at 37°C for 48 hours;

[0082] 6) Filter the cell culture supernatant through a 0.45 μm filter for collection, which is the packaged virus.

[0083] 6. Virus infection

[0084] Add 1 ml of virus stock solution and 0.5 ml of complete medium to the six - well plate. After infecting H9c2(2 - 1) (rat cardiomyocytes) (EallBio) cells for 48 - 72 hours, replace with complete medium (Thermofisher C11995, 10% FBS) containing puromycin (invivogen, ant - pr - 1, 600 ng / ml), 2 ml per well, and use the medium containing puromycin to screen for stable transfected cell lines for further subsequent experiments.

[0085] 7. Cell lysis

[0086] 1) Wash twice with PBS (1 ml per time);

[0087] 2) Add 100 - 200 μl of pre - cooled RIPA cell lysis buffer containing protease inhibitor (LABLEAD, C0101, 1X) ([0.1% SDS, 1% Triton X - 100, 1% sodium deoxycholate, 150 mM NaCl, 10 mM tris (pH 7.5), and 1 mM EDTA]), pipette up and down, and place in a 1.5 - ml centrifuge tube;

[0088] 3) Place on ice for 15 min, shake for about 10 s once every 5 min, shake 3 times to fully lyse the cells;

[0089] 4) Centrifuge at 12000 g for 10 min (4 °C), and transfer the supernatant to a new centrifuge tube.

[0090] 8. Gel preparation

[0091] 1) Install the gel - making device: First, clean the glass plates and the gel - making device, and then install and fix the glass plates;

[0092] 2) Prepare the separating gel: According to the instructions, add the lower - layer gel solution and the lower - layer gel buffer, mix them, and then add the modified coagulant;

[0093] 3) After spreading on the plate, fill it completely with anhydrous ethanol;

[0094] 4) After the gel has solidified, pour out the anhydrous ethanol, rinse it thoroughly with ddH2O, and then blot dry;

[0095] 5) Prepare the stacking gel according to the instructions, pour it onto the gel, and insert the comb (note to be quick and level, without small air bubbles);

[0096] 6) After the stacking gel has solidified, remove the glass plates, rinse them thoroughly, soak them in the electrophoresis buffer, and place them in the 4 °C refrigerator for later use.

[0097] 9. Gel electrophoresis and development

[0098] 1) Take out the pre - quantified protein sample from the - 20 °C refrigerator, then place it in a metal bath and boil for 5 minutes, centrifuge at 6000 rpm for 1 minute at 4 °C for subsequent experiments;

[0099] 2) Use SDS - PAGE gel to electrophoretically separate proteins. Usually, the voltage in the stacking gel is 80 V, and the voltage in the separating gel is 180 V;

[0100] 3) When the bromophenol blue runs to a specific position, end the electrophoresis. Place the sandwich in the electro - blotting tank in the order of filter paper - gel - NC membrane - filter paper, and electro - blot at 200 mA on ice for 2 hours. The electro - blotting time can be appropriately extended or shortened according to the protein size;

[0101] 4) After the electrotransfer is completed, place the NC membrane in Ponceau S staining solution, cut out the target band according to the protein size, and then wash it with TBST until no red liquid is precipitated;

[0102] 5) Block with 5% non-fat milk for 1 hour at room temperature;

[0103] 6) Incubate with the primary antibody overnight at 4°C, wash the membrane 3 times with TBST, 10 minutes each time;

[0104] Antibody list:

[0105] DDX3X, Proteintech, 81903-1-RR;

[0106] Actin, Proteintech, 60008-1-Ig;

[0107] 7) Add the secondary antibody (Anti-mouse IgG, HRP-linked Antibody, CST, 7076; Anti-rabbit IgG, HRP-linked Antibody, CST, 7074), incubate at room temperature for 1 hour, and then wash the membrane 3 times with TBST, 10 minutes each time;

[0108] 8) Add the luminescent solution, develop with a developer, and analyze the western blot results;

[0109] 10. Add the stable transfected cell line obtained in step 6 to Angiotensin II human (Angiotensin II) at 5 μM for one day (add 1 μl of angiotensin II to 2 ml of medium), and then perform western blot to detect COL1. Among them, the western blot detection method is the same as that in steps 7 to 9. Among them, the information of the primary antibody is as follows: COL1, abcam, ab260043.

[0110] Experimental results

[0111] 1. The experimental results of Western Blot detection after lysing the DDX3X knockout cell line constructed by CRISPR-Cas9 are shown in Figure 1A . From Figure 1A it can be seen that the DDX3X in the DDX3X knockout cell constructed by CRISPR-Cas9 was successfully knocked out.

[0112] 2. Stimulate and induce myocardial cell fibrosis with Ang2 (5 μM), and it is found that after knocking out endogenous DDX3X in CRISPR-Cas9 knockout H9C2 cells (rat cardiomyocytes), the degree of myocardial cell fibrosis is significantly reduced.

[0113] Using Ang2 to induce fibrosis in H9C2, it was found that the fibrosis marker Collagen I (COL-1) in H9C2 with DDX3X knocked out was significantly decreased. The relevant index results are as follows Figure 1B shown. From Figure 1B It can be seen that after knocking out the endogenous DDX3X gene in H9C2 using sgRNA and then adding ANG2 for induction, the fibrosis marker Collagen I (COL1) in the cells with the endogenous DDX3X gene knocked out in H9C2 was significantly decreased.

[0114] Example 2

[0115] 1. Cell culture:

[0116] H9c2(2-1) (rat cardiomyocytes) (EallBio), growth medium: DMEM + 10% FBS + 1% P / S (Thermofisher, C11995). Culture conditions: CO2, 5%, temperature: 37°C;

[0117] 2. Knockdown of endogenous DDX3X in H9c2 cells by siRNA:

[0118] 1) Use LipofectamineRNAiMAX (Thermofisher, 13778150) for siRNA transfection (synthesized by Shanghai Shengong Biological Engineering Co., Ltd.), and the siRNA sequences are shown in Table 3;

[0119] Table 3 siRNA sequence information

[0120] DDX3X siRNA Sequence siRNA1 - sense strand GAUGAAGAUGACUGGUCAA(SEQ ID No.10) siRNA1 - antisense strand UUGACCAGUCAUCUUCAUC(SEQ ID No.11) siRNA2 - sense strand GGAACAGAGAAGCUACUAA(SEQ ID No.12) siRNA2 - antisense strand UUAGUAGCUUCUCUGUUCC(SEQ ID No.13) siRNA3 - sense strand GACCUGAACUCUUCAGAUA(SEQ ID No.14) siRNA3 - antisense strand UAUCUGAAGAGUUCAGGUC(SEQ ID No.15)

[0121] 2) Mix 2 μl of siRNA (40 nM) and 6 μl of LipofectamineRNAiMAX, and then add them to the H9c2(2-1) (rat cardiomyocytes) cells in a six-well plate. The number of cells in the six-well plate is 2.5*10 5 ;

[0122] 3) Two days after transfection, add 5 μM of Angiotensin II human (Angiotensin II) (add 1 μl of angiotensin II to 2 ml of medium) and treat for one day, and then perform western blot to detect α-SMA;

[0123] Among them, the western blot detection method is the same as that in steps 7 to 9 of Example 1. Among them, the information of the primary antibody is as follows: SMA, Proteintech, 14395-1-AP.

[0124] Experimental results

[0125] The endogenous DDX3X protein level in H9C2 was knocked down using siRNA, and the fibrotic marker α-smooth muscle actin (α-SMA) in H9C2 with knocked-down DDX3X was significantly decreased. The relevant results are as Figure 2 shown.

[0126] As Figure 2 can be seen, after knocking down the endogenous DDX3X protein level in H9C2 using siRNA, the expression level of DDX3X protein was significantly decreased. After induction with ANG2, the fibrotic marker α-smooth muscle actin (α-SMA) in cells with knocked-down endogenous DDX3X protein level in H9C2 was significantly decreased.

[0127] Example 3 Animal experiment

[0128] 1. C57BL / 6J mice (Spearf Bio (Beijing) Biotechnology Co., Ltd.), male, 8 weeks old;

[0129] 2. RK-33 (MCE, HY-100455) (25 mg / kg) was intraperitoneally injected three times a week;

[0130] 3. After two weeks, isoprenaline hydrochloride (ISO) (MCE, HY-B0468) was subcutaneously injected to induce cardiac fibrosis in mice for 7 days (5 mg / kg);

[0131] 4. Echocardiography was performed on the mice to detect the ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular internal diameter at end-systole (LVIDs), and left ventricular internal diameter at end-diastole (LVIDd). The specific steps are as follows:

[0132] (1) The hair on the chest of the mice was removed with depilatory cream. After anesthesia with isoflurane at a flow rate of 1.5 ml / min, the mice were placed on an electrode platform at 37°C, and isoflurane was continuously administered to control the mouse heart rate between 450 - 650 bp.

[0133] (2) The coupling agent was applied to the upper chest. A 23 MHz ultrasound probe was used to obtain the left ventricular parasternal long-axis section, and the cardiac function of the mice was recorded in B-Mode and M-Mode respectively. Then the probe was rotated 90 degrees to obtain the left ventricular short-axis section, and the cardiac function of the mice was also recorded in B-Mode and M-Mode respectively;

[0134] 5. After mouse cardiac ultrasound examination, the mice were sacrificed, the mouse hearts were isolated, and RNA was extracted for qPCR. The mRNA levels of fibrosis markers, including COL1A2, ANP, Fibronectin, and α-smooth muscle actin (α-SMA), were detected. The specific steps are as follows:

[0135] a) After grinding the cardiac tissue in a grinder, tissue RNA was extracted according to the instructions of the RNA extraction kit (Vazyme, RC112-01), and the concentration of the extracted RNA was detected, and then it was stored at -80 °C.

[0136] b) The RNA sample from the previous step was operated according to the reverse transcription kit (TOYOBO, FSQ-301), and the resulting suspension was placed in a PCR instrument for reverse transcription reaction: maintained at 37 °C for 15 minutes, 50 °C for 5 minutes, 98 °C for 5 minutes, and finally stored at 4 °C.

[0137] c) The mRNA expression level of the target gene was detected using a fluorescence quantitative PCR instrument. The reaction conditions and time were: pre-denaturation at 94 °C for 30 s, followed by denaturation at 94 °C for 5 s + annealing and extension at 60 °C for 30 s (repeated 40 cycles), then 95 °C for 15 s, then 60 °C for 1 min, and finally 95 °C for 15 s;

[0138] d) Calculate the relative expression levels of each gene: Subsequently, the CT values of the target gene and the internal reference were obtained, and finally, whether there were differences in gene expression between the two groups was compared.

[0139] Experimental results

[0140] In the isoprenaline hydrochloride (ISO)-induced mouse cardiac fibrosis model, when the DDX3X inhibitor RK-33 was administered, it was found that RK-33 could significantly improve mouse cardiac fibrosis, and the cardiac function of the mice (ejection fraction, fractional shortening, end-systolic volume, end-diastolic volume, left ventricular end-systolic dimension, and end-diastolic dimension) was significantly improved. The mRNA levels of fibrosis markers in the mouse cardiac tissue were also significantly reduced.

[0141] A. After RK-33 was administered in the mouse cardiac fibrosis model, echocardiography detected that cardiac function indexes such as ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular internal diameter at end-systole (LVIDs), and left ventricular internal diameter at end-diastole (LVIDd) were significantly improved. The relevant results are as Figure 3A shown. From Figure 3AIt can be seen that after RK-33 was administered in the mouse cardiac fibrosis model, echocardiography detected significant improvements in cardiac function indices such as ejection fraction (EF), left ventricular fractional shortening (FS), left ventricular internal diameter at end-systole (LVIDs), and left ventricular internal diameter at end-diastole (LVIDd). Among them, the mock group refers to the negative control group, the ISO group refers to the mouse cardiac fibrosis model group, and the ISO+RK-33 group refers to the mouse cardiac fibrosis model group + the RK-33 treatment group.

[0142] B. After RK-33 was administered in the mouse cardiac fibrosis model, mouse heart tissues were collected and fibrosis markers were detected, and it was found that the mRNA levels of COL1A2, ANP, Fibronectin, and α-smooth muscle actin (α-SMA) were significantly decreased. The relevant index results are as Figure 3B shown. From Figure 3B It can be seen that after RK-33 was administered in the mouse cardiac fibrosis model, mouse heart tissues were collected and fibrosis markers were detected, and it was found that the mRNA levels of COL1A2, ANP, Fibronectin, and α-smooth muscle actin (α-SMA) were significantly decreased. Among them, the mock group refers to the negative control group, the ISO group refers to the mouse cardiac fibrosis model group, and the ISO+RK-33 group refers to the mouse cardiac fibrosis model group + the RK-33 treatment group.

[0143] As described above, the above are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention can easily think of changes or substitutions, which should be covered by the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Claims

1. Use of DDX3X inhibitor in the preparation of a medicament for treating myocardial fibrosis.

2. The application according to claim 2, characterized in that, The DDX3X inhibitor is RK-33, siRNA for silencing DDX3X gene, or sgRNA for targeted knockout of DDX3X gene.

3. An siRNA for silencing the DDX3X gene, characterized in that, The siRNA is selected from any one of siRNA1, siRNA2, and siRNA3, wherein the sense strand sequence of siRNA1 is as shown in SEQ ID No.10, and the antisense strand sequence is as shown in SEQ ID No.11; the sense strand sequence of siRNA2 is as shown in SEQ ID No.12, and the antisense strand sequence is as shown in SEQ ID No.13; the sense strand sequence of siRNA3 is as shown in SEQ ID No.14, and the antisense strand sequence is as shown in SEQ ID No.

15.

4. A kit for silencing the DDX3X gene, characterized in that, It includes the siRNA according to claim 3.

5. An sgRNA for targeted knockout of the DDX3X gene, characterized in that, The sgRNA is selected from any one of sgRNA1, sgRNA2, and sgRNA3, wherein the nucleotide sequence of sgRNA1 is as shown in SEQ ID No.1, the nucleotide sequence of sgRNA2 is as shown in SEQ ID No.2, and the nucleotide sequence of sgRNA3 is as shown in SEQ ID No.

3.

6. A CRISPR-Cas9 recombinant vector for targeted knockout of the DDX3X gene, characterized in that, The CRISPR-Cas9 recombinant vector includes the DNA sequence of the sgRNA according to claim 3.

7. A kit for targeted knockout of the DDX3X gene, characterized in that, It includes the sgRNA according to claim 5 or the CRISPR-Cas9 recombinant vector according to claim 6.

8. A drug for treating myocardial fibrosis, characterized in that, It includes a DDX3X inhibitor as a pharmaceutically active ingredient.

9. The drug for treating myocardial fibrosis according to claim 8, wherein, The DDX3X inhibitor is RK-33, siRNA for silencing DDX3X gene, or sgRNA for targeted knockout of DDX3X gene.

10. The drug for treating myocardial fibrosis according to claim 8, characterized in that, The DDX3X inhibitor is the siRNA for silencing DDX3X gene according to claim 3 or the sgRNA for targeted knockout of DDX3X gene according to claim 5.

Images