HLA genetic typing detection primer group, kit and typing detection method

By designing the HLA gene full-length amplification primer set and nanopore sequencing technology, the problems of low resolution and high cost in the existing HLA genotyping methods are solved, and efficient and low-cost HLA genotyping is achieved, which is suitable for clinical applications.

CN120350104APending Publication Date: 2025-07-22HUBEI UNIV OF CHINESE MEDICINE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510549624.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The existing HLA genotyping methods have problems with low resolution, high cost, cumbersome operation and difficulty in obtaining complete haplotype information. In particular, the accuracy and efficiency of third-generation sequencing technology need to be improved in HLA genotyping.

Method used

Design a full-length amplification primer set for specific HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1/3/4/5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB1 genes, and combine nanopore sequencing technology to achieve efficient full-length amplification and sequencing of 12 HLA genes. Through the optimization of the primer set and the optimization of the amplification conditions, the typing accuracy and resolution are improved.

Benefits of technology

It achieves high accuracy and high resolution typing of HLA genes, which is simple to operate, low cost and short time, and is suitable for clinical applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350104A_ABST
    Figure CN120350104A_ABST
Patent Text Reader

Abstract

The invention discloses an HLA gene typing detection primer group, a kit and a typing detection method.The primer group comprises primer pairs used for amplifying HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB1 genes, specific amplification primer design is combined with nanopore sequencing of amplicons, complete haplotype information can be obtained, and typing accuracy and resolution are higher.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of HLA genotyping, and specifically to a primer set, a kit and a genotyping detection method for HLA genotyping detection. Background Art

[0002] Human Leukocyte Antigen (HLA) is the expression product of the human Major Histocompatibility Complex (MHC), and is an important class of proteins related to the human immune response. Research shows that HLA is closely related to many aspects such as the susceptibility to infectious diseases, drug allergic reactions, immune-related diseases, organ transplantation reactions, and malignant tumors. The HLA-coding genes are located on the short arm of chromosome 6, including a series of closely linked loci, with a total length of about 3.6 Mb, which is currently known to be the most polymorphic region in the human chromosome.

[0003] The HLA genes mainly include three groups. Class I genes mainly include HLA-A, HLA-B, and HLA-C, which are expressed on the surface of most nucleated cells, and the expression products are the main antigens that cause rejection reactions after transplantation. The classical class II genes include three regions, DR, DQ, and DP, and each region contains several A and B genes. HLA class II molecules are mainly expressed on the surface of immune cells and play an important role in the immune response. The class III gene region is located between the HLA-I and II gene regions and is mainly composed of some genes related to the coding of complement and certain inflammatory factors.

[0004] Accurate HLA typing is of great significance in the fields of blood transfusion matching, tissue matching, detection of disease-related alleles, and genetic evolution research. HLA typing methods include serological, cytological, and molecular biological methods. With the development of technology, molecular biological methods have gradually replaced traditional typing methods. Current molecular biological typing methods mainly include PCR-RFLP (Restriction Fragment Length Polymorphism), PCR-SSO (Sequence-Specific Oligonucleotide Probe), PCR-SSP (Sequence-Specific Primer), PCR-SBT (Sequencing-Based Typing), and NGS (Next-Generation Sequencing). Among them, the methods of PCR-RFLP, PCR-SSO, and PCR-SSP have short reaction times and low costs, but they have low resolution, cumbersome operations, and cannot distinguish heterozygotes, nor can they obtain haplotypes and new alleles. The PCR-SBT method is the "gold standard" of HLA typing methods recommended by the World Health Organization (WHO). This method has high resolution and can detect new alleles, but it has low throughput, long time consumption, high cost, and the PCR-SBT method mainly sequences partial exons of the HLA gene and cannot obtain the full-length sequence of the gene, so there will be ambiguous typing results, and the typing results can only reach 4-digit resolution. With the development of high-throughput sequencing technology, NGS has also been widely used in HLA typing. Compared with the previous PCR-SBT method of first-generation gene sequencing, this method reduces costs, solves the problem of low throughput, and improves the typing speed of multiple samples. However, because NGS is prone to incorrect alignment, it is difficult to span repetitive sequences and has GC bias, which affects the accuracy of variant detection. Coupled with the short read length of NGS, the analysis of sequencing results requires dependence on assembly and splicing, and it is difficult to obtain accurate haplotypes.

[0005] Compared with NGS, the third-generation sequencing technology that has emerged in recent years has the characteristic of ultra-long read lengths, and the average sequencing length can reach more than 10 kb. This not only facilitates the assembly of haplotypes but also enables a detailed analysis of complex genomic regions and differences within and between alleles of a certain gene. Using the third-generation sequencing technology, the full-length sequencing of the HLA gene can be achieved, and two clear allele sequences can be directly obtained, which helps to achieve accurate high-resolution HLA typing. Current third-generation sequencing technologies mainly include SMRT sequencing of PacBio (Pacific Bioscience) and nanopore sequencing of ONT (Oxford Nanopore Technologies). Compared with the former, nanopore sequencing requires simpler and more portable equipment, lower sequencing costs, and shorter sequencing times.

[0006] It is necessary to rely on the advantages of nanopore sequencing to design a primer set for full-length amplification of key HLA genes to improve the accuracy and resolution of HLA gene typing. SUMMARY OF THE INVENTION

[0007] The object of the present invention is to provide a primer set for full-length amplification of key HLA genes, so as to improve the accuracy and resolution of HLA gene typing.

[0008] In the first aspect of the present invention, there is provided a primer set for HLA gene typing detection, which comprises primer pairs for amplifying HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1 and HLA-DPB1 genes. The nucleotide sequences of the primer pairs are respectively as shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, SEQ ID NO: 9-10, SEQ ID NO: 11-12, SEQ ID NO: 13-14, SEQ ID NO: 15-16 and SEQ ID NO: 17-18.

[0009] In the second aspect of the present invention, there is provided the use of the primer set described in the first aspect in the preparation of an HLA gene typing detection product.

[0010] In the third aspect of the present invention, there is provided an HLA gene typing detection kit, which includes the primer set described in the first aspect.

[0011] Furthermore, the kit further includes at least one of a nucleic acid extraction reagent, a multiplex PCR reaction reagent, a barcode for differentiating different samples, a barcode ligation PCR reaction reagent and a library construction reagent.

[0012] Preferably, the multiplex PCR reaction reagent includes a DNA polymerase and a buffer; preferably, the DNA polymerase is TaKaRa PrimeSTAR GXL DNA polymerase; the buffer includes Tris-HCl with a concentration of 10-100 mM, glycerol with a content of 5-20 wt%, DTT with a concentration of 1-5 mM, KCl with a concentration of 30-50 mM, MgCl2 with a concentration of 2-8 mM, dNTP with a concentration of 0.1-0.5 mM, DMSO with a content of 5-15 wt%, and betaine with a final concentration of 0.5-1.5 M. More preferably, the buffer components are: Tris-HCl with a concentration of 50 mM, glycerol with a content of 10%, DTT with a concentration of 2.5 mM, KCl with a concentration of 40 mM; MgCl2 with a concentration of 4 mM, dNTP with a concentration of 0.3 mM, DMSO with a content of 10%, and betaine with a final concentration of 1 M.

[0013] Further, the primer pairs for amplifying HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1 genes have a molar ratio of (1 to 1.5):(1 to 1.5):(0.7 to 1):(0.7 to 1):(1.1 to 1.4):(1.1 to 1.4):(1.8 to 2.2):(1.8 to 2.2):(3 to 5):(3 to 5):(2.6 to 3.5):(2.6 to 3.5):(3 to 3.5):(3 to 3.5):(2 to 2.8):(2 to 2.8):(2.4 to 3.0):(2.4 to 3.0).

[0014] The fourth aspect of the present invention lies in providing the use of the primer set described in the first aspect or the kit described in the third aspect in HLA genotyping detection, and the use is for non-diagnostic purposes.

[0015] The fifth aspect of the present invention lies in providing a method for HLA genotyping detection for non-diagnostic purposes, which includes amplifying the HLA genes of the sample to be tested with the primer set described in the first aspect, then sequencing the amplicons, and comparing the sequencing results with the reference genome to determine the HLA genotype.

[0016] Further, the sequencing is based on nanopore sequencing, including but not limited to using other domestic nanopore sequencing platforms such as ONT and Puyi Biotechnology.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The primer set provided by the present invention can perform full-length amplification on 12 key genes such as HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1. The specific amplification primer design combined with nanopore sequencing of the amplicons can obtain complete haplotype information, with higher genotyping accuracy and resolution.

[0019] The genotyping detection method of the present invention can achieve high-accuracy and high-resolution genotyping based on nanopore sequencing, with simple operation, small and portable sequencing instruments, low cost, and short time, and has broad application prospects in clinical practice. Description of the Drawings

[0020] Figure 1 It is the gel image of the single and multiplex PCR amplification bands of the primer set described in Example 2 of the present invention. Detailed Embodiments

[0021] The technical solution of the present invention will be clearly and completely described below in conjunction with preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0022] In one embodiment, a set of full-length amplification primer sets for key HLA genes, as well as a kit and genotyping method for HLA gene detection using the primer sets are proposed. The primer design refers to the frequency information of the genomes of populations in different regions, which can effectively avoid the problem that ordinary primers have unsatisfactory amplification in some populations. Moreover, the primers used can amplify the full-length sequences of 12 HLA genes in one piece, with fewer primer pairs required, longer amplicon lengths obtained, and the longest amplicon exceeding 15 kb. The kit containing the primers is easy to operate and can achieve one-tube multiplex amplification of 12 HLA genes, greatly reducing the reagent cost. Nanopore sequencing can be used to detect the HLA gene sequences. The sequencing instrument is small and convenient, and the sequencing cost is low. It only takes half an hour to complete the sequencing for a single sample, greatly shortening the detection time. Combining with the genotyping algorithm, by processing the sequencing data and comparing it with the HLA allele database, 6- or even 8-digit high-resolution genotyping of HLA genes can be achieved.

[0023] Example 1 Design of Specific Primers for 12 HLA Genes

[0024] The primer design refers to the genomic sequence of the human hg38 version and is designed using the primer 6.0 tool. Primers are designed in the upstream and downstream regions of the HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQ A1, HLA-DQB1, HLA-DPA1, and HLA-DPB1 genes respectively, so that the primers can amplify all the exon and intron sequences of the genes. For the gene HLA-DRB1 / 3 / 4 / 5, first use the mega software for sequence alignment, and select the conserved sequences in the upstream and downstream regions of the four genes for primer design, so that the same pair of primers can amplify these four genes simultaneously. When designing the primers, the annealing temperature is set between 60-65 °C, and in order to facilitate the addition of barcode sequence bases in the later stage, the primer length does not exceed 25 nt.

[0025] The primer optimization is carried out with reference to the single nucleotide polymorphism site information of the Asian population in the 1000 Genomes Database. The final primers try to avoid the positions containing population polymorphism sites as much as possible. For primers that cannot avoid polymorphism sites, degenerate bases are designed at the polymorphism sites so that the primers can amplify samples from different populations.

[0026] After screening and optimization, 9 sets of amplification primers were finally determined, including: the forward amplification primer HLA-A-F for the HLA-A gene and the reverse amplification primer HLA-A-R for the HLA-A gene; the forward amplification primer HLA-B-F for the HLA-B gene and the reverse amplification primer HLA-B-R for the HLA-B gene; the forward amplification primer HLA-C-F for the HLA-C gene and the reverse amplification primer HLA-C-R for the HLA-C gene; the forward amplification primer HLA-DRA-F for the HLA-DRA gene and the reverse amplification primer HLA-DRA-R for the HLA-DRA gene; the forward amplification primer HLA-DRB1 / 3 / 4 / 5-F for the HLA-DRB1 / 3 / 4 / 5 gene and the reverse amplification primer HLA-DRB1 / 3 / 4 / 5-R for the HLA-DRB1 / 3 / 4 / 5 gene; the forward amplification primer HLA-DPA1-F for the HLA-DPA1 gene and the reverse amplification primer HLA-DPA1-R for the HLA-DPA1 gene; the forward amplification primer HLA-DPB1-F for the HLA-DPB1 gene and the reverse amplification primer HLA-DPB1-R for the HLA-DPB1 gene; the forward amplification primer HLA-DQA1-F for the HLA-DQA1 gene and the reverse amplification primer HLA-DQA1-R for the HLA-DQA1 gene; the forward amplification primer HLA-DQB1-F for the HLA-DQB1 gene and the reverse amplification primer HLA-DQB1-R for the HLA-DQB1 gene. Some degenerate bases are included in the primers, where R represents base A or G, and Y represents base C or T. All primers, sequences and sequence numbers are shown in Table 1.

[0027] Table 1: List of HLA gene amplification primers, sequences and sequence numbers

[0028] Primer Sequence (5'-3') Sequence Number HLA-A-F ATCCATGCCGCCAGTGCTTTT SEQ ID NO:1 HLA-A-R TGGACAGGTAAGGAGTGGGAGTC SEQ ID NO:2 HLA-B-F GCAGACAGTGTGACAAAGAGGCTT SEQ ID NO:3 HLA-B-R GAGGAAACACAGRTCAGCATGGGA SEQ ID NO:4 HLA-C-F TCAGGCACACAGTGTGACAAAG SEQ ID NO:5 HLA-C-R GGGAGGGAACACAGGTCAGTGT SEQ ID NO:6 HLA-DRA-F CCTTTGCAAGAACCCTTCCCCTA SEQ ID NO:7 HLA-DRA-R AGGGTTGCCTGCAGATGCACA SEQ ID NO:8 HLA-DRB1 / 3 / 4 / 5-F TGGGAAATGAATGCTCTTACAAGGC SEQ ID NO:9 HLA-DRB1 / 3 / 4 / 5-R ACTTGCTRGCTGGTTTCTCATC SEQ ID NO:10 HLA-DPA1-F AGCTCTCTTGACYACGCTGGTA SEQ ID NO:11 HLA-DPA1-R GGCCTCTTGGCTATACCTCTTTT SEQ ID NO:12 HLA-DPB1-F CACGCTCCCRGTGTAAGGTC SEQ ID NO:13 HLA-DPB1-R TGTGTAAGCTTTTCAGGAGCCA SEQ ID NO:14 HLA-DQA1-F CTGCCAGGGAGGGAAATCRACTC SEQ ID NO:15 HLA-DQA1-R TCCAGTGGAGGACACAGYACC SEQ ID NO:16 HLA-DQB1-F CCACAAGAAACAAACTGCCCCTTA SEQ ID NO:17 HLA-DQB1-R CATTAGTATTGCCCCTRGTCACTGT SEQ ID NO:18

[0029] Example 2 Primer Testing for 12 HLA Genes

[0030] The 9 sets of primers of the present invention are used for the amplification of 12 HLA genes. They can either be used alone for PCR amplification to obtain amplified genes, or be combined arbitrarily for single-tube multiplex PCR amplification, without interference with each other and without causing non-specific amplification. When the 9 sets of primers are placed in 1 tube for multiplex PCR amplification, the full-length sequences of 12 HLA genes (HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1, HLA-DPB1) can be obtained at one time. Figure 1 It is the gel electrophoresis band diagram of single and multiplex amplifications of 9 sets of primers for some samples.

[0031] In multiplex PCR amplification reactions, since multiple fragments need to be amplified simultaneously, the lengths of the sequences vary, and the amplification efficiencies are also different. The ratio between primer sets has a relatively large impact on the effect of multiplex amplification. Therefore, a suitable primer input ratio needs to be found. After multiple experimental verifications, the primer molar ratios for multiplex amplification in one tube with 9 sets of primers were determined. The ratio shares of the 9 sets of primers input are shown in Table 2.

[0032] Table 2: Ratio shares of primers for multiplex amplification

[0033] Primer Serial Number Input Proportion Portion HLA-A-F SEQ ID NO:1 1~1.5 HLA-A-R SEQ ID NO:2 1~1.5 HLA-B-F SEQ ID NO:3 0.7~1 HLA-B-R SEQ ID NO:4 0.7~1 HLA-C-F SEQ ID NO:5 1.1~1.4 HLA-C-R SEQ ID NO:6 1.1~1.4 HLA-DRA-F SEQ ID NO:7 1.8~2.2 HLA-DRA-R SEQ ID NO: 8 1.8~2.2 HLA-DRB1 / 3 / 4 / 5-F SEQ ID NO: 9 3~5 HLA-DRB1 / 3 / 4 / 5-R SEQ ID NO: 10 3~5 HLA-DPA1-F SEQ ID NO: 11 2.6~3.5 HLA-DPA1-R SEQ ID NO: 12 2.6~3.5 HLA-DPB1-F SEQ ID NO: 13 3~3.5 HLA-DPB1-R SEQ ID NO: 14 3~3.5 HLA-DQA1-F SEQ ID NO: 15 2~2.8 HLA-DQA1-R SEQ ID NO: 16 2~2.8 HLA-DQB1-F SEQ ID NO: 17 2.4~3.0 HLA-DQB1-R SEQ ID NO: 18 2.4~3.0

[0034] Example 3 HLA Gene PCR Amplification

[0035] After determining the primer ratio for amplification, the amplification reaction system and amplification conditions need to be determined. Since the primers used are for amplifying the full-length sequences of 12 HLA genes and the longest amplicon exceeds 15 kb, a system and conditions suitable for this long-fragment amplification need to be found. We tested different long-fragment DNA polymerases, including TransStart FastPfu Fly DNA Polymerase, TaKaRa PrimeSTAR GXL DNA Polymerase, Phanta Max High-Fidelity DNA Polymerase, NEB LongAmp Taq DNA Polymerase, Hieff Canace Plus High-Fidelity DNA Polymerase, etc. Considering factors such as amplification effect and cost comprehensively, TaKaRa PrimeSTAR GXL DNA Polymerase was finally selected for HLA gene amplification. To optimize the amplification effect, this kit uses GXL DNA Polymerase to optimize an amplification buffer, which includes Tris-HCl with a concentration of 10 - 100 mM, glycerol with a concentration of 5 - 20%, DTT with a concentration of 1 - 5 mM, KCl with a concentration of 30 - 50 mM, MgCl2 with a concentration of 2 - 8 mM, dNTP with a concentration of 0.1 - 0.5 mM, DMSO with a concentration of 5 - 15%, and betaine with a final concentration of 0.5 - 1.5 M. The preferred composition of the amplification buffer is: Tris-HCl with a concentration of 50 mM, glycerol with a concentration of 10%, DTT with a concentration of 2.5 mM, KCl with a concentration of 40 mM; MgCl2 with a concentration of 4 mM, dNTP with a concentration of 0.3 mM, DMSO with a concentration of 10%, and betaine with a final concentration of 1 M. After testing, better amplification effects can be obtained using the optimized buffer.

[0036] Meanwhile, we also tested different amplification conditions, including testing different annealing temperatures, different extension times, etc. The system for HLA gene PCR amplification is shown in Table 3.

[0037] Table 3: Multiplex PCR system for HLA genes

[0038] Component Volume (μL) Amplification Buffer 15 Multiplex Amplification Primer 4 Sample DNA 1 Total 20

[0039] Example 4 HLA Gene Nanopore Sequencing

[0040] According to the foregoing, the HLA gene amplification product can be up to more than 15 kb in length. Moreover, due to the high polymorphism of the HLA gene, there are many SNPs between different alleles. The accurate identification of these SNPs and the complete haplotype detection are crucial for HLA typing. In this example, nanopore sequencing technology is selected to sequence and analyze the HLA gene. This solution is applicable to all nanopore sequencing platforms, not limited to other domestic nanopore sequencing platforms such as ONT and Puyi Biotechnology. Through continuous research and development and upgrading, the sequencing accuracy of the nanopore sequencing platform is continuously improved, and a high-precision basecalling model is adopted. By generating a consensus sequence, the sequencing accuracy can reach 99.9%, thus meeting the requirements of HLA 8-digit typing. The DNA library preparation process of the present invention is adapted to the detection of long-fragment DNA, and the configurations of the end repair system, adapter ligation system, and library preparation system are carried out according to Tables 4, 5, and 6 respectively:

[0041] Table 4: DNA End Repair System

[0042] Component Volume (μL) DNA (600 - 800 ng) 25 End Prep Mix 7.5 Total Volume 32.5

[0043] Table 5: DNA Adapter Ligation System

[0044] Component Volume (μL) Purified DNA (400 - 600 ng) 17.5 Ligation buffer 25 DNA Ligase 5 Ligation Adapter 2.5 Total 50

[0045] Table 6: DNA Library Preparation System

[0046] Component Volume (μL) Sequencing Buffer 37.5 Library Beads 25.5 DNA library (30 - 50 ng) 12 Total 75

[0047] Composition of HLA Typing Detection Kit in Example 5

[0048] The cost of single library construction and sequencing by nanopore sequencing is relatively high. Multiple samples can be detected simultaneously in one sequencing to share the cost and significantly reduce the single-sample detection cost. This kit designs 96 barcode sequence tags, which are connected to the specific products of one-round amplification through a common sequence. 96 samples can be detected simultaneously in one sequencing, but not limited to detecting 96 samples. If there is a detection requirement, it can be extended to 384 samples. A kit for HLA gene typing detection based on targeted nanopore sequencing includes an HLA gene primer set, multiplex PCR reaction reagents, barcode ligation PCR reaction reagents, and library construction reagents. The components of the kit are shown in Table 7:

[0049] Table 7: Components of HLA Typing Detection Kit

[0050]

[0051] Method for HLA Gene Detection and Typing in Example 6

[0052] (1) Pretreatment of Samples and Nucleic Acid Extraction

[0053] Take 2 - 5 mL of the blood sample to be tested and extract DNA from it. It is recommended to use the nucleic acid extraction or purification reagent from Tiangen (product number DP329), and the specific extraction method shall be carried out according to the corresponding instruction manual.

[0054] After the nucleic acid extraction is completed, take 1 μL for nucleic acid concentration detection, and use the Equalbit 1×dsDNA HS AssayKit to detect the nucleic acid concentration. Dilute the product to 50 ng / μL with nuclease - free water and then use it for subsequent amplification experiments.

[0055] (2) Preparation for PCR Amplification

[0056] Take out the reaction solution PCR Mix and primer pool Primer Mix from the kit in the reagent preparation room, thaw them on ice, take N (N = the number of samples to be tested) PCR reaction tubes, configure the amplification system according to Table 3, mix well, and centrifuge briefly to remove air bubbles.

[0057] (3) PCR Amplification

[0058] Put the PCR reaction tubes into a PCR amplifier for amplification detection, and set the cycling parameters as shown in Table 8.

[0059] Table 8: PCR Reaction Conditions

[0060]

[0061] (4) Preparation for barcode Ligation

[0062] Take out the reaction solution PCR Mix and Barcode primers from the kit, thaw them on ice, take N PCR reaction tubes, and configure the reaction system according to Table 9. Tighten the tube caps, mix well, and centrifuge briefly to remove air bubbles:

[0063] Table 9: barcode Ligation System

[0064] Component Volume (μL) PCR Mix 6 Barcode 2 Product of the Previous Step 1 DNA Polymerase 1 NFW 10 Total 20

[0065] (5) Second - round PCR Amplification

[0066] Put the PCR reaction tubes into a PCR amplifier for amplification detection, and set the cycling parameters as shown in Table 10.

[0067] Table 10: Second - round PCR Reaction Conditions

[0068]

[0069]

[0070] (6) Mixing and Purification

[0071] 6.1 Take 10 μL of the product from the previous round of all samples and place it in a 1.5 mL EP tube, and mix well.

[0072] 6.2 Vortex the magnetic beads to mix well and let stand at room temperature for 30 min.

[0073] 6.3 Take the processed PCR product, add (0.6×) volume of magnetic beads, vortex to mix well, let stand at room temperature for 5 min, centrifuge briefly, place the sample tube on the magnetic stand for 2 min, and carefully remove the supernatant after the solution is completely clear.

[0074] 6.4 Keep the sample on the magnetic stand all the time, add 200 μL of freshly prepared 80% ethanol to wash the magnetic beads, let stand at room temperature for 30 - 60 s, and carefully remove the supernatant.

[0075] 6.5 Repeat step 6.4 once, for a total of two washes.

[0076] 6.6 Keep the sample on the magnetic stand all the time, and dry the magnetic beads with the lid open at room temperature for about 2 - 3 min.

[0077] 6.7 Take the sample out of the magnetic stand, add 10 μL of elution buffer, vortex, let stand at room temperature for 5 min, centrifuge briefly, place on the magnetic stand for 2 min, and carefully aspirate 9 μL of the supernatant into a new centrifuge tube after the solution is clear. If not used immediately, store at -20 °C.

[0078] 6.8 Take 1 μL of the purified product and detect the purity concentration using the Equalbit 1×dsDNA HS Assay Kit.

[0079] (7) End Repair and Purification

[0080] 7.1 Take out the end repair mixture from the kit, thaw it on ice and centrifuge. Configure the end repair system in the PCR reaction tube according to Table 4 (subsequent operations are prohibited from vortexing).

[0081] 7.2 Place the PCR reaction tube on the PCR instrument; program: 30 °C for 5 min, 65 °C for 5 min. (The reaction time is 5 min - 15 min. To shorten the detection time, 5 min can meet the reaction requirements. If to improve the reaction effect, the reaction time can be appropriately extended).

[0082] 7.3 Transfer the product to a new 1.5 mL EP tube, add 65 μL of AMPure XP magnetic beads, perform magnetic bead purification according to the method in step (6), and elute with 25 μL of NFW to obtain purified DNA.

[0083] (8) Adapter Ligation and Purification

[0084] 8.1 Prepare the adapter ligation system according to Table 5.

[0085] 8.2 Place the PCR reaction tube on the PCR instrument; Program: 24 °C for 10 min. (The reaction time is 10 min - 30 min. To shorten the detection time, 10 min can meet the reaction requirements. If you want to improve the reaction effect, the reaction time can be appropriately extended)

[0086] 8.3 Transfer the PCR product to a new 1.5 mL EP tube, add 80 μL of AMPure XP magnetic beads, perform magnetic bead purification according to the method in step (6), replace 80% ethanol with Long Fragment Buffer (LFB) for washing, and elute with 20 μL of EB to obtain purified DNA.

[0087] 8.4 Take 1 μL of the purified product and detect the concentration using the Qubit dsDNA HS Assay Kit.

[0088] (9) Sequencing on the Machine

[0089] This detection kit can be used for sequencing with different nanopore platforms, including but not limited to the ONT sequencing platform of Oxford Nanopore, all domestic nanopore sequencing platforms such as Puyi Biotechnology, MGI, and Jingshi Technology. Perform the operation on the machine according to the operation manual of the nanopore sequencer.

[0090] (10) Result Analysis

[0091] Perform bioinformatics analysis on the data downloaded from the machine, and use the HLA typing software HLA-VBSeq to analyze the detection results.

[0092] Sample Detection and Verification in Example 7

[0093] Use the method of the above example to detect the HLA class I genes of 10 known samples. The detection results are shown in Table 11. Among them, the reference typing is the typing result of Sanger sequencing, and the detection typing is the result analyzed by this method. The Sanger sequencing result can obtain a 4-digit typing, and this method can obtain an 8-digit typing result. The detection results show that the coincidence rate of the 4-digit typing results of this method is 100%.

[0094] Table 11: Comparison of HLA class I gene typing results of known samples

[0095]

[0096]

[0097]

[0098] The 11 HLA genes of another 10 known samples were detected using the method of the above embodiment, and the detection results are shown in Table 12. The PacBio sequencing results can obtain 6-digit typing, and the method of the present invention can obtain 8-digit typing results. The detection results show that the coincidence rate of the 6-digit typing results of the method of the present invention is 100%. In addition, combined with the second-generation NGS sequencing and the first-generation site verification, the statistical comparison shows that the accuracy rate of the 8-digit typing consistency reaches 95%.

[0099] Table 12: Comparison of the typing results of 11 HLA genes of known samples

[0100]

[0101]

[0102]

[0103]

[0104]

[0105] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. HLA gene typing detection primer set, characterized in that, Primer pairs for amplifying HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1 genes, and the nucleotide sequences of the primer pairs are respectively as shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, SEQ ID NO: 9-10, SEQ ID NO: 11-12, SEQ ID NO: 13-14, SEQ ID NO: 15-16, and SEQ ID NO: 17-18.

2. Use of the primer set according to claim 1 in the preparation of an HLA genotyping detection product.

3. HLA gene typing detection kit, characterized in that, Comprising the primer set according to claim 1.

4. The kit according to claim 3, characterized in that, Further comprising at least one of a nucleic acid extraction reagent, a multiplex PCR reaction reagent, a barcode for differentiating different samples, a barcode ligation PCR reaction reagent, and a library construction reagent.

5. The kit according to claim 4, wherein The multiplex PCR reaction reagent comprises a DNA polymerase and a buffer.

6. The kit according to claim 5, wherein The DNA polymerase is TaKaRa PrimeSTAR GXL DNA polymerase; and / or, the buffer comprises Tris-HCl at a concentration of 10-100 mM, glycerol at 5-20 wt%, DTT at 1-5 mM, KCl at 30-50 mM, MgCl2 at 2-8 mM, dNTP at 0.1-0.5 mM, DMSO at 5-15 wt%, and betaine at a final concentration of 0.5-1.5 M.

7. The kit according to claim 3, characterized in that, The molar ratio of the primer pairs for amplifying HLA-A, HLA-B, HLA-C, HLA-DRA, HLA-DRB1 / 3 / 4 / 5, HLA-DQA1, HLA-DQB1, HLA-DPA1, and HLA-DPB1 genes is (1-1.5):(1-1.5):(0.7-1):(0.7-1):(1.1-1.4):(1.1-1.4):(1.8-2.2):(1.8-2.2):(3-5):(3-5):(2.6-3.5):(2.6-3.5):(3-3.5):(3-3.5):(2-2.8):(2-2.8):(2.4-3.0):(2.4-3.0).

8. Use of the primer set according to claim 1 or the kit according to any one of claims 3-7 in HLA genotyping detection, and the use is for non-diagnostic purposes.

9. A method for HLA genotyping detection, for non-diagnostic purposes, characterized in that, Comprising amplifying the HLA gene of the sample to be tested with the primer set according to claim 1, then sequencing the amplicon, and comparing the sequencing result with the reference genome to determine the HLA genotype.

10. The method according to claim 9, characterized in that, The sequencing is based on nanopore sequencing.