Bispecific antibodies

Abstract

The bispecific antibody is composed of a single-chain unit and a monovalent unit, the single-chain unit has specificity for immune cells, and the monovalent unit has specificity for tumor cells or microorganisms. The single-chain unit comprises a single-chain variable fragment (scFv) fused to an Fc fragment and the monovalent unit comprises a light chain and heavy chain pair. The invention also provides a preparation method of the bispecific antibody, and pharmaceutical application and diagnostic application of the bispecific antibody.

Description

[0001] This application is a divisional application of the application with the application number 202010703147.2, the application date of November 21, 2012, and the invention title of "Bispecific Antibody". Background Art

[0002] Bispecific antibodies (BsAbs) are antibodies or antibody-like molecules with two different binding specificities. BsAbs are widely used in biomedicine, especially in immunotherapy against tumors. Currently, a focus of immunotherapy research is how to utilize the cell-mediated cytotoxicity of BsAbs to kill tumor cells. BsAbs can be designed to simultaneously target tumor cells and effector cells, and at the same time stimulate effector cells to kill tumor cells.

[0003] BsAbs can be prepared by methods such as chemical engineering, cell engineering, and genetic engineering. The advantage of genetic engineering is that it can easily modify antibodies, enabling the design and production of many different forms of bispecific antibody fragments, including diabodies, tandem ScFv, and single-chain diabodies and their derivatives (see Jin and Zhu, in "the design and engineering of IgG-Like bispecific antibodies", RE Kontermann (ed.), Bispecific antibodies). Since these BsAbs do not have the IgG Fc domain, their small size enhances their ability to penetrate tumors, but they have a relatively short half-life in vivo and lack the ADCC effect, which is associated with the constant region of the antibody.

[0004] To enhance stability and therapeutic ability, the heavy chains are genetically engineered to promote their heterodimerization and obtain a higher yield of Fc-containing IgG-like bispecific antibodies. There have been several rational design schemes for modifying the antibody CH3 chain for heterodimerization, namely, disulfide bonds, salt bridges, knobs-into-holes. The basis for generating knobs and holes at juxtaposed positions is that the interaction between the knob and the hole will contribute to the formation of heterodimers, while knob-knob and hole-hole interactions are not conducive to the formation of homodimers due to the lack of favorable interactions. Although the knobs-into-holes scheme solves the problem of heavy chain homodimerization, it does not solve the problem of mismatch between the light and heavy chains from two different antibodies. Although it is possible for two different antibodies to recognize the same light chain, the possibility of constructing BsAbs using two antibody sequences with the same light chain is very small.

[0005] Therefore, there is a need to provide better and easily preparable BsAbs that have good clinical stability and potency and / or reduced systemic toxicity. Summary of the Invention

[0006] Technical problem

[0007] An embodiment of the present application provides an antibody, which comprises: (a) a light chain - heavy chain pair that is specific for tumor cells or microorganisms; and (b) a fusion peptide that comprises a single - chain variable fragment (scFv) and an Fc fragment having a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for immune cells.

[0008] Technical solution

[0009] In some aspects, the light chain - heavy chain pair is specific for a tumor antigen. In one aspect, the tumor antigen is selected from: EGFR, Her2, EpCAM, CD20, CD30, CD33, CD47, CD52, CD133, CEA, gpA33, mucin, TAG - 72, CIX, PSMA, folate - binding protein, GD2, GD3, GM2, VEGF, VEGFR, Integrin, αVβ3, α5β1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP, and Tenascin. In one aspect, the light chain - heavy chain pair is specific for a protein that is overexpressed on tumor cells compared to corresponding non - tumor cells.

[0010] In some aspects, the light chain - heavy chain pair is specific for a virus or a bacterium. In one aspect, the light chain - heavy chain pair is specific for endotoxin.

[0011] In some aspects, the immune cells are selected from T cells, B cells, monocytes, macrophages, neutrophils, dendritic cells, macrophages, natural killer cells, eosinophils, basophils, and mast cells.

[0012] In some aspects, the fusion peptide is specific for an antigen selected from CD3, CD16, CD19, CD28, and CD64.

[0013] In some aspects, the light chain binds to the heavy chain via a disulfide bond. In some aspects, the heavy chain binds to the fusion peptide via one or more disulfide bonds. In one aspect, the heavy chain comprises a human or humanized Fc fragment. In one aspect, the Fc fragment of the heavy chain comprises a human IgG Fc fragment. In one aspect, the Fc fragment of the fusion peptide comprises a human or humanized Fc fragment. In one aspect, the Fc fragment of the fusion peptide comprises a human IgG Fc fragment.

[0014] In some aspects, compared with wild-type antibody fragments, the Fc fragment of the heavy chain and / or the fusion peptide contains one or more substitutions that form an ionic bond between the heavy chain and the Fc fragment. In one aspect, these substitutions are selected from Table 1.

[0015] In some aspects, compared with wild-type antibody fragments, the Fc fragment of the heavy chain and / or the fusion peptide contains one or more substitutions that form a stud-and-socket structure pairing between the heavy chain and the Fc fragment. In one aspect, these substitutions are selected from Table 2.

[0016] In some aspects, the CH2 domain is located between the scFv fragment and the CH3 domain. In one aspect, the fusion peptide does not contain the CH1 domain.

[0017] In one embodiment, the present application also provides a composition comprising the antibody in any of the above embodiments. In one aspect, the carrier is a pharmaceutical carrier.

[0018] Another embodiment provides a complex comprising the antibody in any of the above embodiments that binds to one or more antigens.

[0019] The present application further provides a method for preparing an antibody, the method comprising: mixing (a) a light chain-heavy chain pair that is specific for immune cells and (b) a fusion peptide that comprises a single-chain variable fragment (scFv) and an Fc fragment having a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for tumor cells. In one aspect, the present application provides an antibody obtainable by this method. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Shows the structure of an embodiment of the bispecific antibody of the present application;

[0021] Figure 2 Shows Figure 1 the construction of the expression vector for each chain of the bispecific antibody;

[0022] Figure 3 Is a 1% agarose gel electrophoresis diagram: Lane M: DL2000 indicator (marker); Lane 1: Herceptin VH; Lane 2: Herceptin VL; Lane 3: Human IgG1 CH region (CH1 + hinge + Fc); Lane 4: Human IgCL;

[0023] Figure 4 Is a 1% agarose gel electrophoresis diagram: Lane M: DL1000 DNA indicator; Lane 1: Humanized OKT3 (HOKT3) VH-linker; Lane 2: Linker-HOKT3 VL;

[0024] Figure 5 1% agarose gel electrophoresis pattern: Lane M: DL10000 DNA indicator; Lane 1: HOKT3 single strand;

[0025] Figures 6 - 8 Restriction map of the plasmid for site-directed mutagenesis;

[0026] Figure 9 6% gel SDS-PAGE pattern and Western blot pattern are shown. The sample is the supernatant of 293F cells. Lane M: Protein indicator; Lane 1: Herceptin mAb; Lane 2: T366W-modified HOKT3 single strand + Y407A-modified Herceptin heavy chain + Herceptin light chain; Lane 3: T366W K392D and K409D-modified (TKK) HOKT3 single strand + D356KD399K Y407A-modified (DDY) Herceptin heavy chain + Herceptin light chain; Lane 4: K392D and K409D-modified (KK) HOKT3 single strand + D356K D399K-modified (DD) Herceptin heavy chain + Herceptin light chain; Lane 5: T366W K392D and K409D-modified (TKK) HOKT3 single strand + L368R D399K Y407A-modified (LDY) Herceptin heavy chain + Herceptin light chain; Lane 6: T366W K392D and K409D-modified (TKK) HOKT3 single strand + D399K Y407A-modified (DY) Herceptin heavy chain + Herceptin light chain;

[0027] Figure 10 6% SDS-PAGE gel electrophoresis is shown and stained with Coomassie Brilliant Blue. The figure shows: Lane M: Protein marker; Lane 1: Purified MSBODY; Lane 2: Herceptin; Lane 3: HOKT3 single strand;

[0028] Figure 11 shows flow cytometric analysis of the cell surface binding of anti-Her2 X anti-CD3 MSBODY to BT474 cells (A) and peripheral blood mononuclear cells (PBMC) (B), where the gray line: PBS control; the black solid line: MSBODY; the black dashed line:

[0029] Herceptin;

[0030] Figure 12 Includes four microscopic pictures showing cell aggregation;

[0031] Figures 13 - 14 Antibody-mediated cytotoxicity is shown;

[0032] Figure 15A-E shows the structures of certain antibodies detected in Example 4. A: MSBODY; B: SMBODY; C: SSBODY; D: Herceptin single-chain antibody; E: HOKT3 single-chain antibody;

[0033] Figure 16 A-B shows the binding of anti-Her2x anti-CD3 MSBODY and SMBODY to BT474 cells (A) and PBMC cells (B);

[0034] Figure 17 It shows that MSBODY has higher binding activity to BT474 cells than SMBODY;

[0035] Figure 18 It shows the results of the thermal challenge analysis;

[0036] Figure 19 It shows the results of antibody-mediated cytotoxicity against BT474, MCF-7, and MDA-MB-231 cells. Detailed implementation

[0037] Definition

[0038] It should be noted that an indefinite quantity limitation of an entity shall refer to one or more of such entities; for example, "bispecific antibody" shall be understood to mean one or more bispecific antibodies. Similarly, the terms "one or more" and "at least one" with indefinite quantity limitations are used interchangeably herein.

[0039] The term "polypeptide" as used herein is used to include both the singular "polypeptide" and the plural "polypeptides", and also refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also called peptide bonds). The term "polypeptide" refers to any one or more chains of two or more amino acids, and does not refer to a product of a specific length. Thus, peptides, dipeptides, tripeptides, oligopeptides, "proteins", "amino acid chains", or any other term referring to one or more chains composed of two or more amino acids are included in the definition of "polypeptide", and the term "polypeptide" can replace any one of these terms or be used interchangeably with them. The term "polypeptide" is also used to refer to the product of post-expression modification of polypeptides, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting groups / blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. Polypeptides can be derived from natural biological sources or produced by recombinant techniques, but are not necessarily translated from a specified nucleic acid sequence. It can be produced in any way, including by chemical synthesis.

[0040] As used herein, the term "isolated" with respect to cells, nucleic acids (such as DNA or RNA) refers to a molecule that has been separated from DNA or RNA that is present in other macromolecules of natural origin. The term "isolated" as used herein also refers to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or substantially free of chemical precursors or other chemicals when prepared by chemical synthesis. In addition, "isolated nucleic acid" refers to nucleic acid fragments that include fragments that are not naturally occurring as fragments and that do not exist in nature. The term "isolated" as used herein is also used to refer to cells or polypeptides that have been separated from other cellular proteins or tissues. Isolated polypeptides refer to both purified and recombinant polypeptides.

[0041] As used herein, the term "recombinant", when referring to a polypeptide or polynucleotide, refers to a form of polypeptide or polynucleotide that does not exist in nature, and one non-limiting example of which can be achieved by combining polynucleotides or polypeptides that do not normally occur together.

[0042] "Homology" or "identity" or "similarity" refers to the degree of sequence similarity between two peptide chain molecules or between two nucleic acid molecules. Homology can be determined by comparing the positions in each sequence and can be compared by alignment. When there are the same bases or amino acids at a position in the sequences being compared, the molecules are homologous at that position. The degree of homology between multiple sequences is a function of the number of paired or homologous sites shared by these sequences. An "unrelated" or "non-homologous" sequence has less than 40% homology, but preferably less than 25% homology, with one of the sequences of the present application.

[0043] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%) of "sequence identity" with another sequence means that, upon alignment, that percentage of bases (or amino acids) is identical when the two sequences are compared. Such alignments and percentage homology or sequence identity can be determined using software programs known in the art, e.g., those described by Ausubel et al. (2007) Current Protocols in Molecular Biology. Preferably, default parameters are used for the alignment. BLAST is an alignment program that uses default parameters. Specifically, the programs are BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank+EMBL+DDBJ+PDB+

[0044] GenBank CDS translations+SwissProtein+SPupdate+PIR. Details of these programs can be obtained at the following Internet address: http: / / www.ncbi.nlm.nih.gov / blast / Blast.cgi, last accessed on May 21, 2008. Biologically equivalent polynucleotides are polynucleotides having the specified percentage of homology as mentioned above and encoding polypeptides having the same or similar biological activity.

[0045] The term "equivalent nucleic acid or polynucleotide" refers to a nucleic acid having a degree of homology, or sequence identity, with the nucleotide sequence of the nucleic acid or its complementary sequence. A homolog of a double-stranded nucleic acid refers to a nucleic acid containing a specific nucleotide sequence that has a degree of homology with another nucleic acid or its complementary sequence. In one aspect, homologs of a nucleic acid are capable of hybridizing to the nucleic acid or its complementary sequence. Similarly, "equivalent polypeptides" refer to polypeptides having a degree of homology, or sequence identity, with the amino acid sequence of a reference polypeptide. In some aspects, the sequence identity is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain aspects, the equivalent sequence retains the activity (e.g., antigenic epitope binding) or structure (e.g., salt bridge) of the reference sequence.

[0046] Hybridization reactions can be carried out under different “stringent” conditions. Generally, low-stringency hybridization reactions are carried out at about 40 °C in a solution of about 10×SSC or equivalent ionic strength / temperature. Medium-stringency hybridizations are typically carried out at about 50 °C in about 6×SSC, and high-stringency hybridization reactions are usually carried out at about 60 °C in about 1×SSC. Hybridization reactions can also be carried out under “physiological conditions” well known to those skilled in the art. A non-limiting example of physiological conditions is the temperature, ionic strength, pH, and Mg 2+ concentration that are typically present in cells.

[0047] A polynucleotide consists of a specific sequence of 4 nucleotide bases: adenine (A), cytosine (C), guanine (G), thymine (T), with uracil (U) replacing thymine when the polynucleotide is RNA. Thus, the term “polynucleotide sequence” is an alphabetical representation of a polynucleotide molecule. This alphabetical representation can be entered into a computer database that has a central processing unit and is used for bioinformatics applications such as functional genomics and homology searching. The term “polymorphism” refers to the coexistence of more than one form of a gene or a portion thereof. When a portion of a gene has at least two different forms, i.e., two different nucleotide sequences, that portion of the gene is referred to as a “polymorphic region of the gene”. A polymorphic region can be a single nucleotide whose identity differs among different alleles.

[0048] The terms “polynucleotide” and “oligonucleotide” are used interchangeably and refer to polymeric forms of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can have any known or unknown function. The following are non-limiting examples of polynucleotides: genes or gene fragments (e.g., probes, primers, ESTs, or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA of any arbitrary sequence alone, RNA of any arbitrary sequence alone, nucleic acid probes, and primers. Polynucleotides can include modified nucleotides such as methylated nucleotides and nucleotide analogs. If present, the base structure is modified either before or after assembly of the polynucleotide. The nucleotide sequence can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to double-stranded and single-stranded molecules. Unless otherwise indicated or required, any embodiment of a polynucleotide in this application includes both the double-stranded form and the two known complementary single-stranded forms or cases expected to become double-stranded.

[0049] As used herein, the term "encoding" when applied to a polynucleotide refers to a polynucleotide that is said to "encode" a particular polypeptide which, when in its native state or manipulated by methods well known to those of skill in the art, can be transcribed and / or translated to produce the mRNA and / or a fragment thereof that codes for that polypeptide. The antisense strand is the complement of such nucleic acid and the coding sequence can be deduced therefrom.

[0050] As used herein, the term "detectable label" refers to a compound or composition that can be detected directly or indirectly, which directly or indirectly binds to the composition to be detected (e.g., a polynucleotide or a protein such as an antibody) to obtain a "labeled" composition. The term also includes sequences that are incorporated into the polynucleotide and that provide a signal upon expression of the incorporated sequence, such as green fluorescent protein (GFP) and the like. The label itself can be detected (e.g., a radioisotope label or a fluorescent label) or, in the case of an enzyme label, can catalyze a chemical change in a substrate compound or composition that can be detected. The label can be used for small-scale detection or is more suitable for high-throughput screening. Similarly, suitable labels include, but are not limited to, radioisotopes, fluorescent dyes, chemiluminescent compounds, dyes, and proteins (including enzymes). The label can be merely detected or can be quantified. Reactions that are merely detected typically include those that can only confirm its presence, whereas reactions that can be quantified typically include those that have a quantifiable (e.g., numerically reportable) value such as intensity, polarization, and / or other properties. In luminescence or fluorescence assays, detectable reactions can use directly a lumophore or fluorophore that is actually involved in binding and is associated with the assay component, or indirectly a lumophore or fluorophore that is linked to another (e.g., a reporter molecule or an indicator) component.

[0051] As used herein, "antibody" or "antigen-binding polypeptide" refers to a polypeptide or polypeptide complex that specifically recognizes and binds an antigen. The antibody can be a whole antibody or any antigen-binding fragment or its single chain. Thus, the term "antibody" includes any protein or peptide containing a particular molecule that contains at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen. Examples of such cases include, but are not limited to, the complementarity determining regions (CDRs) of the heavy or light chain or their ligand-binding portions, the variable regions of the heavy or light chain, the constant regions of the heavy or light chain, the framework (FR) regions or any portion thereof, or at least a portion of a binding protein.

[0052] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to a portion of an antibody, such as F(ab')2, F(ab)2, Fab', Fab, Fv, scFv, etc. Regardless of structure, antibody fragments that bind to the same antigen are considered to be intact antibodies. The term "antibody fragment" includes aptamers, aptamer enantiomers (spiegelmers), and diabodies. The term "antibody fragment" also includes any synthetic or genetically engineered protein that, like an antibody, can bind to a specific antigen to form a complex.

[0053] "Single-chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy chain (V H ) and light chain (V L ) of an immunoglobulin. In some aspects, these regions are linked by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycine to be flexible, also contain serine or threonine to be soluble, and can link the N-terminus of V H to the C-terminus of V L , and vice versa. The protein retains the properties of the original immunoglobulin, except that the constant region is removed and a linker is introduced. ScFv molecules are known in the art and are described in U.S. Patent 5,892,019.

[0054] The term antibody includes a wide variety of polypeptide classes that can be biochemically recognized. Those skilled in the art will understand that heavy chains are divided into gamma, mu, alpha, delta, and epsilon (γ, μ, α, δ, ε) and have several subclasses (e.g., γ1-γ4). The nature of this chain determines the "class" of the antibody, such as IgG, IgM, IgA, IgD, or IgE. Immunoglobulin subclasses (isotypes) such as IgG1, IgG2, IgG3, IgG4, IgG5, etc. are well characterized and are functionally specific. Those skilled in the art can readily recognize each modified form of these classes and isotypes by reference to this application, and thus, these forms are within the scope of this application. All immunoglobulin classes are expressly within the scope of this application, and the following discussion will generally be directed to the IgG class of immunoglobulin molecules. With respect to IgG, a standard immunoglobulin molecule contains two identical light chain polypeptides (with a molecular weight of approximately 23,000 daltons) and two identical heavy chain polypeptides (with a molecular weight of 53,000-70,000). These four chains are usually linked together in a "Y" shape by disulfide bonds, where the light chains begin to support the heavy chains at the mouth of the "Y" structure and extend through the variable regions.

[0055] The antibodies, antigen-binding polypeptides, variants or derivatives thereof of the present application include, but are not limited to, polyclonal antibodies, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, primatized antibodies, or chimeric antibodies, single-chain antibodies, antigen epitope-binding fragments, such as Fab, Fab', and F(ab')2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv), fragments containing VL domains or VH domains, fragments generated from Fab expression libraries, and anti-idiotypic (anti-Id) antibodies (including, for example, anti-Id antibodies to LIGHT antibodies disclosed herein). The immunoglobulin molecules or antibody molecules of the present application can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), any class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2) or subclass of immunoglobulin molecules.

[0056] The light chains are divided into kappa or lambda (κ, γ). Each class of heavy chain can bind to either kappa or lambda light chains. Generally, the light and heavy chains are covalently bound together, and when these immunoglobulins are produced by hybridomas, B cells, or genetically engineered host cells, the "tail" portions of the two heavy chains are joined together by covalent disulfide bonds or non-covalent linkages. In this heavy chain, the amino acid sequence extends from the N-terminus at the fork end of the Y-shaped structure towards the C-terminus at the bottom of each chain.

[0057] Both the light and heavy chains are divided into structural and functionally homologous regions. The terms "constant" and "variable" are used functionally. Here, it should be recognized that the light chain variable domain (VL) and the heavy chain variable domain (VH) together determine antigen recognition and specificity. Conversely, the light chain constant domain (CK) and the heavy chain constant domains (CH1, CH2, or CH3) provide important biological properties, such as secretion, transplacental mobility, Fc receptor binding, complement binding, etc. Generally, the number of constant region domains increases with the position away from the antigen-binding site or the amino-terminal end of the antibody. The N-terminal portion is the variable region, while the C-terminal portion is the constant region; the CH3 and CK domains actually contain the carboxyl termini of the heavy and light chains, respectively.

[0058] As described above, this variable region enables the antibody to selectively recognize and specifically bind to an epitope on an antigen. That is, the variable region of the antibody, which is formed by the combination of the VK and VH domains, or subsets of the complementarity determining regions (CDRs), defines a three-dimensional antigen-binding site. This tetravalent antibody structure forms an antigen-binding site at the end of each arm of the Y configuration. More specifically, the antigen-binding site is defined by three CDRs on each VH and VK chain (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3). In some instances, for example, certain immunoglobulins derived from camelids or engineered based on camel immunoglobulins, the complete immunoglobulin molecule may consist only of heavy chains, without light chains. See, e.g., Hamers-Casterman et al., Nature 363:446-448 (1993).

[0059] In naturally occurring antibodies, the six "complementarity determining regions" or "CDRs" present in each antigen-binding domain are short, non-contiguous amino acid sequences that have specific positioning to form the antigen-binding domain, assuming that the antibody is in an aqueous environment in its three-dimensional configuration. The remaining amino acids of the antigen-binding domain, called the "framework" regions, have less intramolecular variability. The framework regions predominantly adopt a β-sheet conformation, and the CDRs form loops that connect the β-sheet structure and sometimes form part of the β-sheet structure. Thus, the framework regions serve to form a scaffold that positions the CDRs in the correct orientation through intrachain, non-covalent interactions. The antigen-binding domain formed by the positioned CDRs defines a surface that is complementary to an immunologically active epitope. This complementary surface facilitates the non-covalent binding of the antibody to its cognate epitope. Those skilled in the art can readily identify the amino acids comprising the CDRs and framework regions, respectively, for any given heavy or light chain variable region, as they have been well defined (see, "Sequences of Proteins of Immunological

[0060] Interest," Kabat, E., et al., U.S. Department of Health and Human Services, (1983); Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987), which are hereby incorporated by reference in their entireties).

[0061] When, within the context of this technology, a term has two or more definitions and is used and / or acceptable, the definition of the term used herein is intended to include all meanings, unless stated to the contrary. A specific example is the use of the term "complementary determining region" ("CDR") to describe the non - contiguous antigen - binding sites present in both the variable regions of heavy and light chain polypeptides. Such specific regions were described by Kabat et al. in U.S. Department of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and by Chothia et al. in J. Mol. Biol. 196:901 - 917 (1987), which are incorporated herein by reference in their entireties. According to the definitions of Kabat and Chothia, the CDR includes amino acid residues, or amino acid sub - structures, that overlap when compared to each other. However, the application of each definition of CDR for an antibody or its variant will fall within the scope of the terms defined and used herein. The appropriate amino acid residues that include the CDR as defined in each of the above - cited references are listed in the table below for comparison. The exact number of residues that comprise a particular CDR will vary with the sequence and size of that CDR. Given the amino acid sequence of the variable region of an antibody, one of ordinary skill in the art can generally determine which residues comprise a particular CDR.

[0062] [Table 1]

[0063] Kabat Chothia CDR - H1 31-35 26-32 CDR - H2 50-65 52-58 CDR - H3 95-102 95-102 CDR - L1 24-34 26-32 CDR - L2 50-56 50-52 CDR - L3 89-97 91-96

[0064] Kabat et al. also defined a numbering system for variable domain sequences that is applicable to any antibody. One of ordinary skill in the art can unambiguously use this "Kabat numbering" system for any variable domain sequence without relying on any experimental data outside of the sequence itself. The "Kabat numbering" used herein refers to the numbering system described by Kabat et al., the content of which is recorded in U.S. Department of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).

[0065] In addition to the above table, the CDR regions described by the Kabat numbering system are as follows: CDR-H1 starts at approximately amino acid 31 (i.e., approximately 9 residues after the first cysteine residue), includes approximately 5-7 amino acids, and terminates at the next tryptophan residue. CDR-H2 starts at the 15th residue after the end of CDR-H1, includes approximately 16-19 amino acids, and terminates at the next arginine or lysine residue. CDR-H3 starts at approximately the 33rd amino acid residue after the end of CDR-H2; includes 3-25 amino acids; and terminates at the sequence W-G-X-G, where X is any amino acid. CDR-L1 starts at approximately residue 24 (i.e., after the cysteine residue); includes approximately 10-17 residues; and terminates at the next tryptophan residue. CDR-L2 starts approximately 16 residues after the end of CDR-L1 and includes approximately 7 residues. CDR-L3 starts at approximately the 33rd residue after the end of CDR-L2 (i.e., after the cysteine residue); includes approximately 7-11 residues, and terminates at the sequence F or W-G-X-G, where X is any amino acid.

[0066] The antibodies described herein can be from any animal source, including birds and mammals. Preferably, the antibodies are human, murine, donkey, rabbit, goat, guinea pig, camel, llama, horse, or chicken antibodies. In another embodiment, the variable regions can be from a chondrichthoid (e.g., from a shark).

[0067] The term "heavy chain constant region" as used herein includes the amino acid sequence from an immunoglobulin heavy chain. A polypeptide containing a heavy chain constant region includes at least one of the following: a CH1 domain, a hinge (e.g., an upper hinge region, a middle hinge region, and / or a lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, an antigen-binding polypeptide used in the present application can include a polypeptide chain having a CH1 domain; a polypeptide having a CH1 domain, at least a portion of the hinge domain, and a CH2 domain; a polypeptide chain having a CH1 domain and a CH3 domain; a polypeptide chain having a CH1 domain, at least a portion of the hinge domain, and a CH3 domain, or a polypeptide chain having a CH1 domain, at least a portion of the hinge structure, a CH2 domain, and a CH3 domain. In another embodiment, the polypeptide of the present application includes a polypeptide chain having a CH3 domain. Additionally, an antibody used in the present application may lack at least a portion of the CH2 domain (e.g., all or a portion of the CH2 domain). As described above, but those of ordinary skill in the art should understand that the heavy chain constant regions may be modified such that they are different in amino acid sequence from naturally occurring immunoglobulin molecules.

[0068] The heavy chain constant region of the antibodies disclosed herein can be derived from different immunoglobulin molecules. For example, the heavy chain constant region of a polypeptide can comprise the CH1 domain from an IgG l molecule and the hinge region from an IgG3 molecule. In another example, the heavy chain constant region can comprise a hinge region that is part from an IgG l molecule and part from an IgG3 molecule. In another example, the heavy chain portion can comprise a chimeric hinge that is part from an IgG l molecule and part from an IgG4 molecule.

[0069] As used herein, the term "light chain constant region" includes the amino acid sequence from the light chain of an antibody. Preferably, the light chain constant region includes at least one of the constant kappa domain and the constant lambda domain.

[0070] A "light chain-heavy chain pair" refers to a collection of a light chain and a heavy chain that can form a dimer via a disulfide bond between the CL domain of the light chain and the CH1 domain.

[0071] As noted previously, the subunit structure and three-dimensional structure of the constant regions of the various immunoglobulin classes are known. As used herein, the term "VH domain" includes the amino-terminal variable domain of an immunoglobulin heavy chain, while the term "CH1 domain" includes the first (most often amino-terminal) constant region of an immunoglobulin heavy chain. The CH1 domain is adjacent to the VH domain and is the amino-terminal of the hinge region of the immunoglobulin heavy chain molecule.

[0072] As used herein, the term "CH2 domain" includes a portion of the heavy chain molecule that ranges, for example, from about residue 244 to residue 360 of the antibody, using a conventional numbering scheme (residues 244 to 360, Kabat numbering system; and residues 231 - 340, EU numbering system; see Kabat et al., U.S. Department of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983)). The CH2 domain is unique in that it pairs less tightly with another domain. Instead, two N-linked branched sugar chains are inserted between the two CH2 domains of the intact native IgG molecule. It is documented that the CH3 domain extends from the CH2 domain to the C-terminus of the IgG molecule and contains approximately 108 residues.

[0073] As used herein, the term "hinge region" includes that portion of the heavy chain molecule that links the CH1 domain to the CH2 domain. This hinge region contains approximately 25 residues and is flexible, allowing the two N-terminal antigen-binding regions to move independently. The hinge region can be divided into three distinct domains: the upper, middle, and lower hinge domains (Roux et al., J. Immunol 161:4083 (1998)).

[0074] As used herein, the term "disulfide bond" includes a covalent bond formed between two sulfur atoms. The amino acid cysteine contains a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CK domains are linked by a disulfide bond and the two heavy chains are linked by two disulfide bonds, at positions corresponding to 239 and 242 using the Kabat numbering system (positions 226 or 229, EU numbering system).

[0075] As used herein, the term "chimeric antibody" will be used to refer to any antibody in which its immunoreactive region or site is derived from or obtained from a first species and its constant region (which may be full-length, partial, or modified according to the present application) is derived from a second species. In certain embodiments, the target-binding region or site will be from a non-human source (e.g., mouse or primate) and the constant region will be from human.

[0076] As used herein, "percent humanization" is calculated by determining the number of framework amino acid differences between the humanized domain and the germline domain (i.e., non-CDR differences), subtracting that number from the total number of amino acids, then dividing by the total number of amino acids and multiplying by 100.

[0077] By "specifically binds" or "is specific for" is generally meant that an antibody binds an epitope through its antigen-binding domain and that there must be some complementarity between the antigen-binding domain and the epitope. By this definition, an antibody is considered to "specifically bind" to an epitope when, upon binding to that epitope, binding through the antigen-binding domain is more favorable than binding to a random, unrelated epitope. The term "specificity" is used herein to determine the affinity of a given antibody for a particular epitope. For example, antibody "A" may be considered to have a higher specificity for a given epitope than antibody "B", or antibody "A" may be said to bind to epitope "C" with a higher specificity than it does for a related epitope "D".

[0078] As used herein, the term "treat" (or "treatment") refers to therapeutic treatment and prophylactic or preventive measures, wherein a subject is treated to prevent or slow down (mitigate) an adverse physiological change or disorder, such as the development of cancer. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of the extent of the disorder, stabilization (e.g., preventing worsening) of the state of the disorder, delay or slowing of the progression of the disorder, improvement or palliation of the state of the disorder, and remission (whether partial or total), whether or not detectable. "Treatment" may also refer to prolonging survival as compared to expected survival if not receiving treatment. Conditions that require treatment include those that already have a disease or symptom and those that are predisposed to having a disease or symptom or those that will prevent a disease or symptom.

[0079] As used herein, the terms "subject" or "individual" or "animal" or "patient" or "mammal" refer to any subject, particularly a mammalian subject, that is in need of diagnosis, prognosis, or treatment. Mammalian subjects include humans, domestic animals, farm animals, zoo, sports field, or pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, hamsters, horses, cattle, cows, etc.

[0080] As used herein, phrases such as "a patient in need of treatment" or "a subject in need of treatment" include, for example, mammalian subjects that would benefit from administration of the antibodies and compositions used in this application, such as for detection, diagnostic procedures, and / or treatment.

[0081] Bispecific antibody

[0082] One embodiment of the present application provides a heterodimeric antibody that comprises two different antigen-binding polypeptide units. In some aspects, the heterodimer is of a different size than its corresponding homodimer, and the size difference can be utilized to facilitate separation of the heterodimer and the homodimer.

[0083] In some aspects, one of the two antigen-binding polypeptide units comprises a light chain - heavy chain pair similar to a wild-type antibody. Throughout this application, this unit is also referred to as the "monovalent unit". In some aspects, the other antigen-binding polypeptide unit comprises a single-chain variable fragment (scFv). Such an scFv can be fused to the constant fragment (Fc) of an antibody. This fusion peptide is also referred to as the "single-chain unit" throughout this application.

[0084] Surprisingly, this application demonstrates that such asymmetric antibodies are stable and have high antigen-binding efficiency. This is unexpected because it has been demonstrated that even homodimers of single-chain antibodies are unstable under physiological conditions. For example, Ahmad et al., "scFv Antibody: Principles and Clinical Application," Clinical and Developmental Immunology, 2012:980250 (2012), showed that IgG-like antibodies based on scFv are unstable and require further modification to reduce aggregation and improve stability.

[0085] In addition, because of the asymmetry, the heterodimer has a different molecular weight from the homodimer composed of either of the antigen-binding polypeptide units. Based on the molecular weight difference between the heterodimer and the homodimer, the desired heterodimer can be easily separated from the homodimer.

[0086] The ability to easily separate the heterodimer from the homodimer is particularly advantageous for the preparation of bispecific antibodies in which each of the two antigen-binding polypeptides is specific for a different epitope. This is because neither of the two types of homodimers (i.e., the homodimers containing the monovalent unit or the single-chain unit) has the desired dual specificity, while the heterodimer can provide such dual specificity.

[0087] In one embodiment, such a bispecific antibody is specific for tumor cells or microorganisms and specific for immune cells, which enables the tumor cells or microorganisms to approach the immune cells, resulting in the elimination of the tumor cells or microorganisms through an active immune response.

[0088] In a particular aspect, the monovalent unit is specific for tumor cells or microorganisms, and the single-chain unit is specific for immune cells. An asymmetric bispecific antibody with such an arrangement of specificities is also referred to as a "monovalent single-chain bispecific antibody" or "MSBODY". In contrast, an asymmetric bispecific antibody in which the monovalent unit has specificity for immune cells and the single-chain unit has specificity for tumor cells or microorganisms is called an "SMBODY". Another bispecific antibody has two single-chain units, one of which has specificity for tumor cells or microorganisms and the other has specificity for immune cells, and this antibody is called an "SSBODY".

[0089] An unexpected finding of the present application is that even though MSBODY and SMBODY have the same binding motif and similar molecular weights, MSBODY exhibits higher stability and affinity than SMBODY when binding to target tumor cells. In this case, interestingly, although anti-Her / anti-CD3 MSBODY and SMBODY produced similar cytotoxicity against Her2-high-expressing cells BT474, the MSBODY structure showed higher cytotoxicity against low Her2-expressing breast cancer cell lines (including MCF-7 and MDA-MB-231). Not all tumor cells expressing tumor antigens necessarily express the antigen at a high level, so this ability of MSBODY shows unique advantages in clinical applications.

[0090] Thus, in one embodiment, the provided antibody comprises: (a) a light chain-heavy chain pair that is specific for tumor cells; and (b) a fusion peptide that comprises a single-chain variable fragment (scFv) and an Fc fragment, the Fc fragment including a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for immune cells.

[0091] In another embodiment, the provided antibody comprises: (a) a light chain-heavy chain pair that is specific for microorganisms, such as GP120 for HIV, HA2 for influenza, and Shiga-like toxin 2B for Escherichia coli (E. Coli); and (b) a fusion peptide that comprises a single-chain variable fragment (scFv) and an Fc fragment, the Fc fragment containing a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for immune cells.

[0092] Figure 1 Shows an embodiment of the bispecific antibody of the present application. The left half (monovalent unit) of the antibody is composed of a light chain (6) and heavy chains (3 and 4).

[0093] Figure 1 It is also shown that, on the one hand, the light chain (6) includes a CL domain and a VL domain, VLa, targeting the epitope "a". Similarly, in addition to containing putative CH2 and CH3 domains, the heavy chain also contains a CH1 domain and a VH domain, VHa, which also targets the epitope "a". On the one hand, the light chain and the heavy chain are bound by disulfide bonds, for example, between CL and CH1.

[0094] Figure 1 It is also shown the single-chain unit, which comprises a single-chain Fv (scFv) fragment (5) and a constant region (3), the constant region including CH2 and CH3. The scFv fragment is composed of VL (VLb) and VH (VHb) domains, both of which target the epitope "b", which is different from the epitope "a".

[0095] In some aspects, the heavy chain of the monovalent unit is bound to the fusion peptide by one or more disulfide bonds. In one aspect, the one or more disulfide bonds are formed between amino acid residues in the hinge region between the CH1 (or VLb) and CH2 domains.

[0096] In some aspects, the CH2 domain of the single-chain unit is located between the scFv fragment and the CH3 domain. In other words, the scFv fragment is linked to the CH2 terminus of the Fc fragment. In some aspects, the single-chain unit does not contain a CH1 domain.

[0097] In one aspect, one or both of the monovalent unit and the single-chain unit contain a human antibody sequence or a humanized sequence. For example, in one aspect, the heavy chain of the monovalent unit contains a human or humanized Fc fragment. In a specific aspect, the Fc fragment of the heavy chain contains a human IgG Fc fragment.

[0098] Similarly, in one aspect, the Fc fragment of the fusion peptide contains a human or humanized Fc fragment. In a specific aspect, the Fc fragment of the fusion peptide contains a human IgG Fc fragment.

[0099] The antibody can be modified to further stabilize or enhance the activity of the antibody. For example, in one aspect, compared to a wild-type antibody fragment, the Fc fragment of the heavy chain of the monovalent unit and / or the Fc fragment of the fusion peptide may contain one or more substitutions that form ionic bonds between them.

[0100] In one aspect, one of the Fc fragments contains one or more substitutions with amino acid residues that are positively charged under physiological conditions, while the other Fc fragment contains one or more substitutions with one or more amino acid residues that are negatively charged under physiological conditions. In one aspect, the positively charged amino acid residue can be arginine (R), histidine (H), or lysine (K). In another aspect, the negatively charged amino acid residue can be aspartic acid (D) or glutamic acid (E). The amino acid residues that can be substituted include, but are not limited to, D356, E357, L368, K370, K392, D399, and K409. Table 1 below lists non-limiting examples of combinations of these substitutions.

[0101] Table 1. Combinations of amino acid substitutions that result in the formation of ionic bonds between the monovalent unit and the single-chain unit

[0102]

[0103]

[0104] In some aspects, compared to wild-type antibody fragments, the Fc fragment of the monovalent unit heavy chain and / or the Fc fragment of the fusion peptide may contain one or more substitutions that form a knob-into-hole structure pair between these substitutions. The knob-into-hole configuration is known in the art. See, for example, Ridgway et al., “‘Knob-into-holes’ engineering of antibody C H 3 domains for heavy chain heterodimerization,” Protein Engineering 9(7):617-21(1996).

[0105] In one aspect, K366 on one Fc fragment is replaced with a relatively large amino acid residue, such as tyrosine (Y) or tryptophan (W). Then, Y407 on another Fc fragment can be replaced with a relatively small amino acid residue, such as threonine (T), alanine (A), or valine (V). Table 2 below shows some non-limiting examples of combinations of these substitutions.

[0106] Table 2. Combinations of amino acid substitutions that result in the formation of a knob-into-hole structure pair between the monovalent unit and the single-chain unit

[0107] Combination number Replacement on one Fc Replacement on the other Fc 1 T366W Y407A 2 T366W Y407V 3 T366Y Y407A 4 T366Y Y407V

[0108] In some aspects, the antibody may contain ionic bonds or a knob-into-hole structure or both. Table 3 below shows some examples in this regard.

[0109] Table 3. Combinations of amino acid substitutions

[0110]

[0111]

[0112] In some aspects, the monovalent unit of the bispecific antibody of the present application is specific for tumor cells. In one aspect, the monovalent unit specifically recognizes a tumor antigen.

[0113] A “tumor antigen” is an antigenic substance produced in tumor cells, i.e., it triggers an immune response in the host. Tumor antigens are used to identify tumor cells and are used as potential candidates in cancer treatment. Normal proteins in the body are not antigens. However, during tumorigenesis, certain proteins are produced or overexpressed, thus appearing “foreign” to the body. This may include normal proteins that are well hidden from the immune system, proteins that are normally produced in very small amounts, proteins that are normally produced only at certain developmental stages, or proteins whose structure has been modified due to mutations.

[0114] A large number of tumor antigens are known in the art and new tumor antigens can be readily identified by screening. Non-limiting examples of tumor antigens include EGFR, Her2, EpCAM, CD20, CD30, CD33, CD47, CD52, CD133, CEA, gpA33, mucin, TAG-72, CIX, PSMA, folate-binding protein, GD2, GD3, GM2, VEGF, VEGFR, integrin, αVβ3, α5β1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP, and tenascin.

[0115] In certain aspects, the monovalent unit is specific for a protein that is overexpressed on tumor cells relative to the corresponding non-tumor cells. As used herein, "corresponding non-tumor cells" refers to non-tumor cells of the same cell type as the origin of the tumor cells. It is noted that such a protein is not necessarily different from a tumor antigen. Non-limiting examples include carcinoembryonic antigen (CEA) overexpressed in most colon, rectal, breast, lung, pancreatic, and gastrointestinal cancers, heregulin receptors (HER-2, neu, or c-erbB-2), which are typically overexpressed in breast, ovarian, colon, lung, prostate, and cervical cancers; epidermal growth factor receptor (EGFR), which is highly expressed in a range of solid tumors, including breast tumors, head and neck tumors, non-small cell lung tumors, and prostate tumors; asialoglycoprotein receptor; transferrin receptor; serine protease inhibitor enzyme complex receptor, which is expressed on hepatocytes; fibroblast growth factor receptor (FGFR), which is overexpressed in pancreatic ductal adenocarcinoma cells; vascular endothelial growth factor receptor (VEGFR) for anti-angiogenic gene therapy; folate receptor, which is selectively overexpressed in 90% of non-mucinous ovarian cancers; cell surface polysaccharide protein complex; carbohydrate receptor; and polymeric immunoglobulin receptor, which is used to deliver genes to respiratory epithelial cells and is promising for the treatment of lung diseases such as cystic fibrosis.

[0116] In certain aspects, the monovalent unit is specific for a microorganism. Non-limiting examples of microorganisms include microbial surface receptors and endotoxins. Examples of endotoxins include, but are not limited to, lipopolysaccharide (LPS) and lipooligosaccharide (LOS).

[0117] In certain aspects, the single-chain unit is specific for an immune cell. In one aspect, the immune cell is selected from T cells, B cells, monocytes, macrophages, neutrophils, dendritic cells, phagocytes, natural killer cells, eosinophils, basophils, and mast cells.

[0118] On the one hand, the single-chain unit specifically recognizes an antigen selected from the following: CD3, CD16, CD19, CD28, and CD64.

[0119] Exemplary sequences of each polypeptide chain in the bispecific ligand are provided herein. On the one hand, the fusion peptide of the single-chain unit has the amino acid sequence shown in SEQ ID NO: 1. On the one hand, the heavy chain of the monovalent unit has the amino acid sequence shown in SEQ ID NO: 3. On the one hand, the light chain of the monovalent unit has the amino acid sequence shown in SEQ ID NO: 5.

[0120] Any of the above antibodies or polypeptides may also include additional polypeptides, for example, encoded polypeptides as described herein, signal peptides of antibody constant regions for guiding secretion, or other heterologous polypeptides as described herein.

[0121] Those of ordinary skill in the art should also understand that the antibodies described herein may be modified such that their amino acid sequences are different from those of naturally occurring binding polypeptides from which they are derived. For example, a polypeptide or amino acid sequence from a designated protein may be similar to the starting sequence, for example, having a certain percentage identity with the starting sequence, for example, it may have 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity with the starting sequence.

[0122] In addition, nucleotide or amino acid substitutions, deletions, or insertions may also be made to effect conservative substitutions or changes in "non-essential" amino acid regions. For example, a polypeptide or amino acid sequence from a designated protein may be identical to the starting sequence except for the substitution, insertion, or deletion of one or more individual amino acids, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more individual amino acid substitutions, insertions, or deletions. In certain embodiments, the polypeptide or amino acid sequence from a designated protein has 1 to 5, 1 to 10, 1 to 15, or 1 to 20 individual amino acid substitutions, insertions, or deletions relative to the starting sequence.

[0123] In certain embodiments, the antigen-binding polypeptide contains an amino acid sequence or one or more groups that do not normally bind to an antibody. Exemplary modifications are described in more detail below. For example, the single-chain Fv antibody fragment of the present application may contain a flexible linker sequence or may be modified to add functional groups (such as polyethylene glycol (PEG), drugs, toxins, or markers).

[0124] The antibodies, variants or derivatives of the present application include modified derivatives, i.e., any type of molecule is covalently linked to the antibody and the covalent linkage does not prevent the antibody from binding to the antigen epitope. For example, but not limited to, the antibody can be modified, e.g., by glycosylation, acetylation, PEGylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, attachment to a cell ligand or other protein, etc. Any of a number of chemical modifications can be carried out by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formylation, tunicamycin metabolic synthesis, etc. In addition, the antibody can contain one or more non-classical amino acids.

[0125] In other embodiments, the antigen-binding polypeptides of the present application may contain conservative amino acid substitutions.

[0126] "Conservative amino acid substitution" is where an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, non-essential amino acid residues of the immunoglobulin polypeptide are preferably replaced with other amino acid residues from the same side chain family. In another embodiment, a string of amino acids can be replaced with a structurally similar string that differs in sequence and / or in the composition of the side chain family.

[0127] Non-limiting examples of conservative amino acid substitutions are provided in the following table, where a similarity score of 0 or higher indicates a conservative substitution between the two amino acids.

[0128] C G P S A T D E N Q H K R V M I L F Y W W -8 -7 -6 -2 -6 -5 -7 -7 -4 -5 -3 -3 2 -6 -4 -5 -2 0 0 17 Y 0 -5 -5 -3 -3 -3 -4 -4 -2 -4 0 -4 -5 -2 -2 -1 -1 7 10 F -4 -5 -5 -3 -4 -3 -6 -5 -4 -5 -2 -5 -4 -1 0 1 2 9 L -6 -4 -3 -3 -2 -2 -4 -3 -3 -2 -2 -3 -3 2 4 2 6 I -2 -3 -2 -1 -1 0 -2 -2 -2 -2 -2 -2 -2 4 2 5 M -5 -3 -2 -2 -1 -1 -3 -2 0 -1 -2 0 0 2 6 V -2 -1 -1 -1 0 0 -2 -2 -2 -2 -2 -2 -2 4 R -4 -3 0 0 -2 -1 -1 -1 0 1 2 3 6 K -5 -2 -1 0 -1 0 0 0 1 1 0 5 H -3 -2 0 -1 -1 -1 1 1 2 3 6 Q -5 -1 0 -1 0 -1 2 2 1 4 N -4 0 -1 1 0 0 2 1 2 E -5 0 -1 0 0 0 3 4 D -5 1 -1 0 0 0 4 T -2 0 0 1 1 3 A -2 1 1 1 2 S 0 1 1 1 P -3 -1 6 G -3 5 C 12

[0129] In some embodiments, the antibody can bind to a therapeutic agent, a prodrug, a peptide, a protein, an enzyme, a virus, a lipid, a biologic response modifier, an agent or a PEG.

[0130] The antibody can be linked to or fused to a therapeutic agent, which can include a detectable label such as a radiolabel, an immunomodulator, a hormone, an enzyme, an oligonucleotide, a photoactive therapeutic agent or a diagnostic agent, a cytotoxic agent, which can be a drug or a toxin, an ultrasound enhancer, a non-radiolabel, combinations thereof and other such components known in the art.

[0131] The antibody is detectably labeled by coupling it to a chemiluminescent compound. Then, the presence of the chemiluminescently labeled antigen-binding polypeptide is determined by detecting the luminescence produced during the chemical reaction. Examples of chemiluminescent labeling compounds that are particularly useful include luminol, isoluminol, thermatic acridinium esters, imidazoles, acridinium salts, and oxalates.

[0132] The antibody can also be detectably labeled using a fluorescent-emitting metal such as 152Eu, or other lanthanide labels. These metals can be linked to the antibody using metal chelating groups such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA). Techniques for linking multiple groups to an antibody are well known, see, for example, Arnon et al., “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy”, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. (1985)); Hellstrom et al., “Antibodies For Drug Delivery”, in Controlled Drug Delivery (2nd ed.), Robinson et al. (eds.), Marcel Dekker, Inc., pp. 623-53 (1987); Thorpe, “Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review”, in Monoclonal Antibodies'84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); “Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy”, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), Academic Press pp. 303-16 (1985), and Thorpe et al., “The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates”, Immunol. Rev. (52:119-58 (1982)).

[0133] Polynucleotides encoding the antibody and methods for preparing the antibody

[0134] The present application also provides isolated polynucleotides or nucleic acid molecules encoding the antibodies, variants or derivatives of the present application.

[0135] For example,Figure 2 Display encoding Figure 1 The structures of three polynucleotides of each peptide chain of the antibody shown in

[0136] Exemplary sequences encoding each polypeptide chain in the bispecific ligand are provided herein. In one aspect, the fusion peptide of the single-chain unit is encoded by the nucleic acid sequence of SEQ ID NO: 2. In one aspect, the heavy chain of the monovalent unit is encoded by the nucleic acid sequence of SEQ ID NO: 4. In one aspect, the light chain of the monovalent unit is encoded by the nucleic acid sequence of SEQ ID NO: 6.

[0137] The polynucleotides of the present application can encode the entire heavy and light chain variable regions of the antigen-binding polypeptide, its variants or derivatives, either with the same polynucleotide molecule or with separate polynucleotide molecules. Additionally, the polynucleotides of the present application can encode a portion of the heavy and light chain variable regions of the antigen-binding polypeptide, its variants or derivatives, either with the same polynucleotide molecule or with separate polynucleotide molecules.

[0138] Methods for preparing antibodies are well known in the art and are described herein. In some embodiments, the variable and constant regions of the antigen-binding polypeptide of the present application are fully human. Fully human antibodies can be prepared using the techniques described in the prior art and as described herein. For example, fully human antibodies against a specific antigen can be prepared by administering the antigen to a transgenic animal that has been modified to produce such antibodies in response to antigen stimulation, but whose endogenous loci have been disabled. Exemplary techniques that can be used to make such antibodies are described in U.S. Patents: 6,150,584, 6,458,592, 6,420,140, the entire contents of which are incorporated herein by reference.

[0139] In some embodiments, the prepared antibodies do not produce harmful immune responses in the animal to be treated (e.g., a human). In one embodiment, the antigen-binding polypeptides, variants or derivatives thereof of the present application are modified by techniques well known in the art to reduce their immunogenicity. For example, the antibodies can be made humanized, primatized, deimmunized, or chimeric antibodies. These types of antibodies are derived from non-human antibodies, typically murine or primate antibodies, which retain or substantially retain the antigen-binding properties of the parental antibody but are less immunogenic in the human body. This can be achieved by a variety of methods, including (a) grafting the entire non-human variable domain onto the human constant region to produce a chimeric antibody; (b) grafting at least a portion of one or more non-human complementarity-determining regions (CDRs) onto the human framework and constant regions, with or without retention of key framework residues, or (c) transplanting the entire non-human variable domain but "masking" them with human-like moieties by replacing surface residues. Such methods are disclosed in Morrison et al., Proc. Natl. Acad. Sci. USA 57:6851-6855 (1984); Morrison et al., Adv. Immunol. 44:65-92 (1988); Verhoeyen et al., Science 239:1534-1536 (1988); Padlan, Molec. Immunol. 25:489-498 (1991); Padlan, Molec. Immunol. 31:169-217 (1994), and U.S. Patent Nos. 5,585,089, 5,693,761, 5,693,762 and 6,190,370, all of which are hereby incorporated by reference in their entirety into this text.

[0140] Deimmunization can also be used to reduce the immunogenicity of antibodies. As used herein, the term "deimmunization" includes modifying an antibody to modify T cell epitopes (see, e.g., International Application Publication Nos. WO / 9852976A1 and WO / 0034317A2). For example, in the present application, the variable heavy chain and variable light chain sequences from a starting antibody were analyzed, and a human T cell epitope "map" was generated from each V region, which shows the positions of epitopes related to the complementarity determining regions (CDRs) and other key residues in the sequence. Individual T cell epitopes from this T cell epitope map can be analyzed to identify alternative amino acid substitutions that have a low risk of altering the final antibody activity. A series of alternative variable heavy chain and light chain sequences, including combinations of amino acid substitutions, were designed in the present application, and these sequences were then incorporated into a series of binding polypeptides. Typically, 12 to 24 different antibodies are generated and tested for binding and / or functionality. The complete heavy and light chain genes, including the modified variable regions and human constant regions, are then cloned into an expression vector, and the resulting plasmid is introduced into a cell line for production of the whole antibody. These antibodies are then compared by appropriate biochemical and biological assays, and the optimal variants are identified.

[0141] The binding specificity of the antigen-binding polypeptides of the present application can be measured by in vitro assays, such as immunoprecipitation, radioimmunoassay (RIA), or enzyme-linked immunosorbent assay (ELISA).

[0142] Alternatively, the techniques described for preparing single-chain units (U.S. Patent No. 4,694,778; Bird, Science 242:423-442 (1988); Proc. Natl. Acad. Sci. USA 55:5879-5883 (1988) by Huston et al.; and Nature 334:544-554 (1989) by Ward et al.) can be used to generate the single-chain units of the present application. The heavy and light chain fragments of the Fv region are linked by an amino acid bridge to form a single-chain unit, obtaining a single-chain fusion peptide. Techniques for synthesizing functional Fv fragments in Escherichia coli (E. coli) (Science 242:1038-1041 (1988) by Skerra et al.) can also be used.

[0143] Examples of techniques that can be used to generate single-chain Fvs (scFvs) and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., Proc. Natl. Sci. USA 90:1995-1999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For certain applications, including in vivo use of antibodies in humans and in vitro diagnostic assays, it may be preferred to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different parts of the antibody are from different animal species, e.g., an antibody containing the variable regions from a murine monoclonal antibody and the constant regions of a human immunoglobulin. Methods for making chimeric antibodies are known in the art. See, e.g., Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., J. Immunol. Methods 125:191-202 (1989); U.S. Pat. Nos. 5,807,715; 4,816,567 and 4,816397, the entire contents of which are incorporated herein by reference.

[0144] A humanized antibody is an antibody molecule from a non-human species that binds the desired antigen and has one or more complementarity determining regions (CDRs) from a non-human species and framework regions from a human immunoglobulin molecule. Typically, framework residues in the human framework regions will be altered by replacement with the corresponding residues from the CDR donor antibody, preferably to enhance antigen binding. These framework replacements are identified by methods known in the art, e.g., by modeling the interactions of the CDRs and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., U.S. Pat. No. 5,585,089 to Queen et al.; Riechmann et al., Nature 332:323 (1988), the entire contents of which are incorporated herein by reference). A variety of techniques known in the art can be used to humanize an antibody, including, e.g., CDR-grafting (EP 239,400; PCT Publication No. WO

[0145] 91 / 09967; U.S. Pat. Nos. 5,225,539; 5,530,101 and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology

[0146] 28(4 / 5):489 - 498(1991); Studnicka et al., Protein Engineering 7(6):805 - 814(1994); Roguska et al., Proc. Natl. Sci. USA 91:969 - 973(1994)), and chain shuffling (U.S. Patent No. 5,565,332, the entire content of which is incorporated herein by reference).

[0147] Fully human antibodies are particularly desirable for the treatment of human patients. Human antibodies can be prepared by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT Publication Nos. WO 98 / 46645, WO 98 / 50433, WO 98 / 24893, WO 98 / 16654, WO 96 / 34096, WO 96 / 33735, and WO 91 / 10741, each of which is incorporated herein by reference.

[0148] Human antibodies can also be produced using transgenic mice that are unable to express functional endogenous immunoglobulins but can express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be randomly or by homologous recombination introduced into murine embryonic stem cells. Alternatively, in addition to the human heavy and light chain genes, human variable, constant, and diversity regions can be introduced into murine embryonic stem cells. The murine heavy and light chain immunoglobulin genes can be non-functionally given separately or simultaneously into the human immunoglobulin locus by homologous recombination. Specifically, homozygous deletion of the JH region prevents the production of endogenous antibodies. The modified embryonic stem cells are expanded and microinjected into blastocysts to generate chimeric mice. The chimeric mice are then bred to produce homozygous offspring that express human antibodies. The transgenic mice are immunized in the normal way with a selected antigen, for example, using all or a portion of the desired target polypeptide. Monoclonal antibodies against the antigen can be obtained from the immunized transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes carried by the transgenic mice rearrange during B cell differentiation and are subsequently subject to class switching and somatic mutation. Thus, using this technique, therapeutically useful IgG, IgA, IgM, and IgE antibodies can be produced. An overview of this technique for producing human antibodies is found in Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995). For a detailed discussion of techniques for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, for example, PCT Publication Nos. WO 98 / 24893; WO 96 / 34096; WO 96 / 33735; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which are incorporated herein by reference in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and GenPharm ((San Jose, Calif.) can provide human antibodies against selected antigens, obtained using techniques similar to those described above.

[0149] Fully human antibodies that recognize selected antigenic epitopes can also be produced using a technique called "guided selection." In this method, a selected non-human monoclonal antibody, for example, a murine antibody, is used to direct the selection of a fully human antibody that recognizes the same antigenic epitope. (Jespers et al., Bio / Technology 72:899-903 (1988). See also, U.S. Patent No. 5,565,332, which is incorporated herein by reference in its entirety).

[0150] In another embodiment, the DNA encoding the desired monoclonal antibody is readily isolated and sequenced using conventional methods (e.g., by using oligonucleotide probes that are capable of specifically binding to the genes encoding the heavy and light chains of the murine antibody). Separate and subcloned hybridoma cells are the preferred source of such DNA. After isolation, the DNA can be placed in an expression vector, which can then be transfected into a prokaryotic or eukaryotic host cell such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that do not produce immunoglobulins. More specifically, the individual DNA (which can be synthesized as described herein) can be used to clone the constant and variable region sequences for the preparation of antibodies, such as U.S. Patent No. 5,658,570, filed Jan. 25, 1995 by Newman et al., which is incorporated herein by reference. In essence, this involves extracting RNA from the selected cells, converting it to cDNA, and amplifying it by PCR using Ig-specific primers. Suitable primers for this purpose are also described in U.S. Patent No. 5,658,570. As will be discussed in more detail below, the transfected cells expressing the desired antibody can be cultured in relatively large amounts to provide immunoglobulins for clinical and commercial applications.

[0151] In addition, using conventional recombinant DNA techniques, one or more CDRs of the antigen-binding polypeptides of the present application can be inserted into framework regions, e.g., into human framework regions to humanize non-human antibodies. The framework region can be a naturally occurring or consensus framework region, and is preferably a human framework region (see, e.g., Chothia et al., J. Mol. Biol. 278:457-479 (1998), a list of human framework regions). Preferably, the combination of the framework region and the CDRs results in a polynucleotide encoding a polypeptide that specifically binds to at least one antigenic epitope of the desired polypeptide, e.g., LIGHT. Preferably, one or more amino acid substitutions can be made within the framework region, and preferably, the amino acid substitutions improve the antigen-binding ability of the antibody. In addition, this method can be used to obtain amino acid substitutions or deletions of one or more variable region cysteine residues (which cysteine residues are involved in the formation of intrachain disulfide bonds), thus producing antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are included within the scope of the present application and are within the scope of the prior art.

[0152] In addition, techniques for producing "chimeric antibodies" by gene splicing from murine antibody molecules can be used (Morrison et al., Proc. Natl. Acad. Sci. USA: 851-855 (1984); Neuberger et al., Nature 372: 604-608 (1984); Takeda et al., Nature 314: 452-454 (1985)), together with human antibody molecule genes having appropriate biological activity and suitable antigen specificity. As used herein, a chimeric antibody is a molecule in which different portions are from different animal species, e.g., an antibody containing the variable region from a murine monoclonal antibody and the constant region of a human immunoglobulin.

[0153] However, another highly efficient method for generating recombinant antibodies is disclosed in Newman, Biotechnology 10: 1455-1460 (1992). Specifically, this technique results in the production of primatized antibodies containing simian variable domains and human constant sequences. This document is incorporated herein by reference in its entirety. In addition, this technique is also described in co-owned U.S. Patent Nos. 5,658,570, 5,693,780, and 5,756,096, each of which is incorporated herein by reference.

[0154] Alternatively, antibody-producing cell lines can be selected and cultured using techniques well known to those of skill in the art. Such techniques are described in a variety of laboratory manuals and major publications. In this regard, techniques suitable for use herein are described below in Current Protocols in Immunology, Coligan et al. eds., Green Publishing Associates and Wiley-Interscience, John Wiley and Sons, New York (1991), which is incorporated herein by reference in its entirety, including supplementary references.

[0155] In addition, standard techniques well known to those skilled in the art can be used to introduce mutations into the nucleotide sequences encoding the antibodies of the present application, including, but not limited to, site-directed mutagenesis and PCR-mediated mutagenesis, which result in amino acid substitutions. Preferably, the variants (including derivatives), relative to the reference variable heavy chain region, CDR-H1, CDR-H2, CDR-H3, light chain variable region, CDR-L1, CDR-L2, or CDR-L3, encode fewer than 50 amino acid substitutions, fewer than 40 amino acid substitutions, fewer than 30 amino acid substitutions, fewer than 25 amino acid substitutions, fewer than 20 amino acid substitutions, fewer than 15 amino acid substitutions, fewer than 10 amino acid substitutions, fewer than 5 amino acid substitutions, fewer than 4 amino acid substitutions, fewer than 3 amino acid substitutions, or fewer than 2 amino acid substitutions. Alternatively, mutations can be introduced randomly along all or part of the coding sequence, for example, by saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutations that retain activity.

[0156] Therapeutic and diagnostic methods

[0157] The antigen-binding polypeptides, variants, or derivatives of the present application described herein can be used in certain therapeutic and diagnostic methods related to cancer or infectious diseases.

[0158] The present application also relates to antibody-based therapies, which include administering the bispecific antibodies of the present application to a patient, such as an animal, mammal, and human, for treating one or more of the diseases or conditions described herein. The therapeutic compounds of the present application include, but are not limited to, the antibodies of the present application (including their variants and derivatives as described herein) and nucleic acids or polynucleotides encoding the antibodies of the present application (including their variants and derivatives as described herein).

[0159] The antibodies of the present application can also be used for treating, inhibiting or preventing diseases, disorders or conditions, including malignant diseases, disorders, or conditions associated with such diseases or disorders, such as diseases associated with increased cell survival or inhibition of apoptosis, such as cancer (e.g., follicular lymphoma, cancers with p53 gene mutations, hormone-dependent tumors, including but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, gastric cancer, neuroblastoma, myxoma, uterine fibroids, lymphoma, endothelioma, osteoblastoma, giant cell tumor of bone, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer), autoimmune disorders (e.g., multiple sclerosis, Sjogren's syndrome, Grave's disease, Hashimoto's thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis, autoimmune gastritis, autoimmune thrombocytopenic purpura and rheumatoid arthritis) and viral infections (e.g., herpes virus, poxvirus and adenovirus), inflammation, graft-versus-host disease (acute and / or chronic), acute graft rejection, and chronic graft rejection. The antigen-binding polypeptides of the present application, their variants or derivatives are used for inhibiting the growth, development and / or metastasis of cancer, particularly those listed above or in the following paragraphs.

[0160] Other diseases or conditions related to increased cell survival that can be treated, prevented, diagnosed, and / or predicted using the antibodies, variants, or derivatives of the present application, including but not limited to, the development and / or metastasis of malignancies, and related diseases such as leukemia (including acute leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia (including granulocytic, promyelocytic, myelomonocytic, monocytic, erythroleukemia)) and chronic leukemia (e.g., chronic myelogenous (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, papillary cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumors, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, oligodendroglioma, acoustic neuroma, menangioma, melanoma, neuroblastoma, and retinoblastoma.

[0161] The antibodies of the present application can also be used to treat infectious diseases caused by microorganisms, or to kill microorganisms, which is achieved by targeting the microorganisms and immune cells to eliminate the microorganism. In one aspect, the microorganisms include viruses of RNA viruses and DNA viruses, Gram-positive bacteria, Gram-negative bacteria, protozoa, or fungi. Non-limiting examples of infectious diseases and related microorganisms are provided in Table 4 below.

[0162] Table 4. Infectious diseases and related microbial sources.

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169] The specific dosage and treatment regimen for use in any particular patient will depend on a variety of factors, including the specific antigen-binding polypeptide used, its variants or derivatives, the patient's age, weight, general health, sex and diet, and the time of administration, the rate of excretion, drug combinations, and the severity of the specific disease to be treated. The judgment of these factors by a healthcare provider is within the ordinary skill in the art. The dosage will also depend on the individual patient to be treated, the route of administration, the type of formulation, the characteristics of the compound used, the severity of the disease, and the desired effect. The amount used can be determined by the principles of pharmacology and pharmacokinetics known in the art.

[0170] Methods of administering the antigen-binding polypeptide, its variants or derivatives include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The antigen-binding polypeptide or composition can be administered by any convenient route, such as by infusion or bolus injection, absorption through epithelial or mucosal linings of the skin (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and can be administered together with other bioactive agents. Thus, the pharmaceutical compositions containing the antigen-binding polypeptide of the present application can be administered orally, rectally, parenterally, intracisternally, vaginally, intraperitoneally, topically (e.g., by powder, ointment, drops or transdermal patch), bucally, or as an oral or nasal spray.

[0171] As used herein, the term "parenteral" refers to a mode of administration that includes intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, and intra-articular injection and infusion.

[0172] Administration can be systemic or local. In addition, it may also be necessary to introduce the antibodies of the present application into the central nervous system by any suitable route, including intraventricular and intrathecal injection; a ventricular catheter can facilitate ventricular injection, for example, by connecting the catheter to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be carried out, for example, by using an inhaler or nebulizer, with a nebulized formulation.

[0173] It may also be necessary to locally administer the antigen-binding polypeptide or composition of the present application to the area in need of treatment, which can be achieved by, for example but not limited to, local perfusion during surgery, topical application, such as in combination with a postoperative wound dressing, by injection, by catheter, by suppository, or by an implant, the implant being a porous, non-porous, or gel-like material, including membranes such as sialastic membranes or fibers. Preferably, when administering the proteins (including antibodies) of the present application, care must be taken to use materials that do not absorb proteins.

[0174] In another embodiment, the antigen-binding polypeptide or composition can be delivered in vesicles, particularly liposomes (see Langer, 1990, Science 249:1527-1533; Treat et al. in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; ibid.).

[0175] In yet another embodiment, the antigen-binding polypeptide or composition can be delivered by a controlled release system. In one embodiment, a pump can be used (see Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et al., 1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In another embodiment, a polymeric material can be used (see, Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres. Boca Raton, Fla. (1974); Controlled Drug

[0176] Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983, Macromol. Sci. Rev. Macromol. Chem. 23:61; also see Levy et al., 1985, Science 228:190; During et al., 1989, Ann. Neurol.

[0177] 25:351; Howard et al., 1989, J. Neurosurg. 71:105). In yet another embodiment, the controlled release system can be placed near the treatment target, i.e., near the brain, thus requiring a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled release systems are discussed in the review by Langer (1990, Science 249:1527-1533).

[0178] In a specific embodiment, the composition of the present application comprises a nucleic acid or polynucleotide encoding a protein, which nucleic acid can be administered in vivo to promote the expression of the protein encoded thereby by constructing it as part of a suitable nucleic acid expression vector and administering it to enter into cells, e.g., by using a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by using particle bombardment (such as a gene gun, Biolistic, Dupont), or by coating with lipids or cell surface receptors or transfection agents, by linking it to a homeodomain peptide and administering, which homeodomain peptide is known to enter the nucleus (see, e.g., Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88:1864-1868), etc. Alternatively, the nucleic acid can be introduced intracellularly and integrated into the host cell DNA for expression by homologous recombination.

[0179] The amount of the antibody of the present application is effective in treating, inhibiting, and preventing inflammatory, immune, or malignant diseases, disorders, or symptoms that can be determined by standard clinical techniques. In addition, in vitro experiments can optionally be used to help determine the optimal dose range. The exact dose used in the formulation will also depend on the route of administration and the severity of the disease, disorder, or condition, and should be determined according to the judgment of the physician and the specific circumstances of each patient. The effective dose can be extrapolated from the dose-response curve from in vitro or animal model test systems.

[0180] As a general proposition, the dosage of the antigen-binding polypeptides of the present application for administration to a patient is typically from 0.1 mg / kg to 100 mg / kg of patient body weight, between 0.1 mg / kg and 20 mg / kg of patient body weight, or between 1 mg / kg and 10 mg / kg of patient body weight. Generally, human antibodies have a longer half-life in the human body than antibodies from other species, due to the immune response to foreign polypeptides. Thus, lower dosages of human antibodies, with reduced dosing frequency, are generally permitted. Additionally, the dosage and frequency of administration of the antibodies of the present application can be reduced by enhancing the absorption and tissue penetration of the antibody (e.g., into the brain), which enhancement is achieved by modification such as lipidation.

[0181] A method of treating an infectious or malignant disease, condition or disorder, the method comprising administering an antibody of the present application, a variant of such antibody, the treatment typically being tested in vitro and then in vivo for the desired therapeutic or prophylactic activity in an acceptable animal model and then used in humans. Suitable animal models, including transgenic animals, are known to those of ordinary skill in the art. For example, the in vitro assays described herein for demonstrating the therapeutic efficacy of antigen-binding polypeptides include the effect of the antigen-binding polypeptides on cell lines or patient tissue samples. The effect of the antigen-binding polypeptides on cell lines and / or tissue samples can be determined using techniques known to those of skill in the art, such as the assays disclosed elsewhere herein. According to the present application, in vitro assays can be used to determine whether administration of a particular antigen-binding polypeptide is indicated, including in vitro cell culture assays in which patient tissue samples are cultured in a medium and exposed to or otherwise administered a compound and the effect of such compound on the tissue sample is observed.

[0182] A variety of delivery systems are known and can be used to administer the antibodies of the present application or polynucleotides encoding the antibodies of the present application, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), construction of a nucleic acid as part of a retroviral or other vector, etc.

[0183] In another embodiment, the compositions of the present application are combined with an anti-tumor agent, an anti-viral agent, an anti-bacterial agent or an antibiotic agent or an anti-fungal agent. Any of these agents known in the art can be administered in the compositions of the present application.

[0184] In another embodiment, the compositions of the present application are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered together with the compositions of the present application include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and actinomycin D); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon α-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytarabine, cyclophosphamide, estramustine phosphate, hydroxyurea, procarbazine, mitomycin, busulfan, cisplatin, and vincristine sulfate), hormones (e.g., medroxyprogesterone acetate, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., melphalan, chlorambucil (nitrogen mustard), and thiotepa); steroids and their combinations (such as sodium bethamethasone phosphate); and others (e.g., dacarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).

[0185] In other embodiments, the compositions of the present application are administered in combination with cytokines. Cytokines that can be co-administered with the compositions of the present application include, but are not limited to, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, anti-CD40, CD40L, and TNF-α.

[0186] In other embodiments, the compositions of the present application are administered in combination with other therapeutic or prophylactic regimens, e.g., radiotherapy.

[0187] Composition

[0188] The present application also provides pharmaceutical compositions. Such compositions include an effective amount of the antibody and an acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" refers to those approved by a regulatory agency of the Federal or State government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeias for use in animals and, more particularly, in humans. Additionally, a "pharmaceutically acceptable carrier" is generally a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or any type of formulation aid.

[0189] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle used in the administration of therapy. Such pharmaceutical carriers can be sterile liquids such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Aqueous solutions of salts and glucose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, ethylene glycol, water, ethanol and the like. If desired, the composition may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents such as acetates, citrates or phosphates. Antibacterial agents such as benzyl alcohol or methylparaben, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, and agents for regulating tonicity such as sodium chloride or glucose can also be used. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, using traditional binders and carriers such as triglycerides. Oral formulations may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate and the like. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E.W. Martin, incorporated herein by reference. Such compositions contain a therapeutically effective amount of an antigen-binding polypeptide, preferably in purified form, together with a suitable amount of carrier in order to provide a form suitable for administration to a patient. The formulation should be suitable for the mode of administration. The parenteral formulations can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0190] In one embodiment, the composition is formulated, according to conventional procedures, as a pharmaceutical composition suitable for intravenous administration to a human. Ordinarily, compositions for intravenous administration are sterile isotonic aqueous buffers. Where necessary, the composition may also contain solubilizing agents and local anesthetics such as lidocaine to relieve pain at the injection site. Usually, these components are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or an anhydrous concentrate in a sealed container such as an ampoule or sachette indicating the quantity of the active agent. When the composition is administered by infusion, an infusion bottle containing pharmaceutically sterile water or saline may be dispensed with. When the composition is administered by injection, an ampoule of sterile water for injection or saline may be provided so as to mix the components before administration.

[0191] The compounds of the present application can be formulated in neutral or salt form. Pharmaceutically acceptable salts include those formed with anions such as salts from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and those formed with cations such as salts from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2 - ethylaminoethanol, histidine, procaine, etc.

[0192] Example

[0193] Preparation of the anti - Her2 / neu–anti - CD3 bispecific antibody in Example 1.

[0194] Materials

[0195] The polynucleotides encoding the VL and VH of the humanized monoclonal antibody Herceptin against human Her2, the polynucleotides encoding the VL and VH of the humanized monoclonal antibody HOKT3 against human CD3, the polynucleotide encoding the CH1 of the IgG1 heavy chain constant region, the polynucleotides encoding the hinge region of the hinge and Fc, and the polynucleotide of the kappa chain constant region of CL were obtained from Life Technologies Inc. (Carlsbad, CA). The linker sequence (GGGGS)3 connecting OKT3 ScFv and VL and VH was synthesized using conventional methods.

[0196] Methods and Results

[0197] 1. Construction of Expression Vectors

[0198] pcDNA3.1(-) was used as an expression vector to prepare the Herceptin heavy chain expression construct. pcDNA3.1(+)Hygro was used as an expression vector to prepare the Herceptin light chain expression construct and the HOKT3 single chain construct. Primers were designed according to the sequences of VL, VH, ScFv, CH1, and Fc and the multiple cloning sites of the pcDNA3.1(-) and pcDNA3.1(+)Hygro vectors (Table 5). The VL and CL, VH and CH1, CH1 and Fc, ScFv VL and VH, and ScFv and Fc fragments were ligated using the overlap extension PCR method.

[0199] Table 5. PCR Primer Sequences

[0200]

[0201]

[0202] The PCR amplification conditions for VL, CL, VH, and CH1 included: incubation at 95 °C for 5 minutes, followed by 25 cycles: denaturation at 95 °C for 30 seconds, annealing at 56 °C for 30 seconds, extension at 72 °C for 1 minute; and final extension at 72 °C for 10 minutes. Figure 3 Gel pictures showing the PCR products were provided.

[0203] The PCR amplification conditions for Fc and ScFv were similar, except that each cycle in 25 cycles included denaturation at 95 °C for 1 minute, annealing at 56 °C for 1 minute, and extension at 72 °C for 2 minutes. Figure 4 Gel pictures showing the PCR products were provided.

[0204] VH and CH1 of Herceptin, and VL and CL were ligated using overlap extension PCR. Equal amounts of recovered VH and CH1, or VL and CL, and CH1 and Fc were used as templates and primers for each other respectively. Other conditions were similar to conventional PCR, and the conditions for 2 cycles were: denaturation at 95 °C for 2 minutes, annealing at 55 °C for 2 minutes, and extension at 72 °C for 2 minutes. Then, VH 5'-terminal oligonucleotide primer and CL 3'-terminal primer were added, and 25 cycles were carried out under the following conditions: denaturation at 95 °C for 1 minute, annealing at 56 °C for 1 minute, and extension at 72 °C for 2 minutes. The final extension included extension at 72 °C for 10 minutes.

[0205] The conditions for overlap extension PCR ligation of VH-CH1 and Fc, ScFv and Fc included using recovered VHCH1 and equal amounts of Fc, ScFv and Fc as templates and primers. The initial incubation included 2 cycles of the following reaction: denaturation at 95 °C for 2 minutes, annealing at 55 °C for 2 minutes, and extension at 72 °C for 3 minutes. Then, VH 5'-terminal oligonucleotide primer and CL 3'-terminal primer were added, and then 25 cycles of reaction were carried out under the following conditions: denaturation at 95 °C for 1 minute, annealing at 56 °C for 1 minute, and extension at 72 °C for 3 minutes. The final extension included extension at 72 °C for 10 minutes. Figure 5 Gel pictures showing the PCR products were provided.

[0206] The PCR products were collected using a DNA fragment recovery kit, and the VH-CH1-Fc fragment was separated by double digestion with NheI and Xhol. Then, this fragment was inserted into the pcDNA3.1(-) vector and named pcDNA3.1(-)-Herceptin heavy chain. Similarly, the ScFv-Fc fragment for HOKT3 (digested with Nhel and Xhol), and the VL-CL fragment of Herceptin (digested with Nhel and BamHI) were also inserted into the pcDNA3.1(+) Hygro vector and named pcDNA3.1(+) Hygro-HOKT3 single chain and pcDNA3.1(+) Hygro-Herceptin light chain respectively.

[0207] 2. Point mutation

[0208] The point mutation utilized a kit Performed with Site-Directed Mutagenesis Kit and primers for pcDNA3.1(-)-Herceptin heavy chain and pcDNA3.1(+)Hygro-HOKT3 single chain Fc (Table 6). The reaction was carried out according to the kit instructions. The mutation was determined by sequencing (the sequencing vector is shown in Figures 6 - 8 ).

[0209] Table 6. Site-directed mutagenesis primer sequences

[0210] Primers Sequences SEQ ID NO. D356K - F CCCCCATCCCGGAAGGAGCTGACCAAGA 25 D356K - R TCTTGGTCAGCTCCTTCCGGGATGGGGG 26 E357R - F CCCCCATCCCGGGATAGGCTGACCAAGAAC 27 E357R - R GTTCTTGGTCAGCCTATCCCGGGATGGGGG 28 T366W - F ACCAGGTCAGCCTGTGGTGCCTGGTCAAA 29 T366W - R TTTGACCAGGCACCACAGGCTGACCTGGT 30 L368R - F GTCAGCCTGACCTGCCGGGTCAAAGGCTTCTAT 31 L368R - R ATAGAAGCCTTTGACCCGGCAGGTCAGGCTGAC 32 L368K - F GTCAGCCTGACCTGCAAGGTCAAAGGCTTCTAT 33 L368K - R ATAGAAGCCTTTGACCTTGCAGGTCAGGCTGAC 34 K370D - F CTGACCTGCCTGGTCGATGGCTTCTATCCCAGC 35 K370D - R GCTGGGATAGAAGCCATCGACCAGGCAGGTCAG 36 K392D - F GGAGAACAACTACGATACCACGCCTCCCGT 37 K392D - R ACGGGAGGCGTGGTATCGTAGTTGTTCTCC 38 D399K - F CGCCTCCCGTGCTGAAGTCCGACGGCTCCTTC 39 D399K - R GAAGGAGCCGTCGGACTTCAGCACGGGAGGCG 40 Y407A - F TCCTTCTTCCTCGCCAGCAAGCTCACCGT 41 Y407A - R ACGGTGAGCTTGCTGGCGAGGAAGAAGGA 42 Y407V - F TCCTTCTTCCTCGTCAGCAAGCTCACCGT 43 Y407V - R ACGGTGAGCTTGCTGACGAGGAAGAAGGA 44 K409D - F CTTCCTCTACAGCGATCTCACCGTGGACA 45 K409D-R TGTCCACGGTGAGATCGCTGTAGAGGAAG 46

[0211] Table 7 below shows the sequences of each chain of the anti-Her2 / neu–anti-CD3 bispecific antibody.

[0212] Table 7. Polypeptide and nucleic acid sequences of the bispecific antibody

[0213]

[0214]

[0215]

[0216] 3. Amplification

[0217] The recombinant plasmid was transformed into Escherichia coli (E. coli) TOP10. Single colonies were picked and grown in LB medium containing 100 mg / L ampicillin and cultured for 16 hours under shaking conditions at 37 °C. Then the bacteria were collected by centrifugation at 8000 × g for 10 minutes. The plasmid was isolated using the Tiangen endotoxin kit and the plasmid was dissolved in 1 ml of elution EB buffer. The plasmid was precipitated with 1.42 ml of isopropanol and 0.42 ml of NaCl, then washed twice with 0.5 ml of 70% ethanol, then air-dried in a laminar flow hood, and then dissolved in sterile ultrapure water (1 mL). The plasmid concentration was measured at OD260 / 280.

[0218] An OD260 / 280 value between 1.8 and 1.9 indicates that it is highly pure plasmid DNA.

[0219] 4. Transfection and expression of MSBODY in mammalian cells 293F

[0220] Twenty-four hours before transfection, at 37 °C, 8% CO2, and 130 rpm, 1 × 10 6293F cells were seeded in 28 ml of 293 freestyle medium in a 125 ml flask. 100 μl of 293fectin was added to 1 ml of OptiMEM and incubated at room temperature for 5 minutes under stirring conditions. Meanwhile, the recombinant plasmids pcDNA3.1(+)Hygro-HOKT3 single chain LDY, pcDNA3.1-Herceptin heavy chain TKK(-) and pcDNA3.1(+)Hygro-Herceptin light chain were mixed at a ratio of 3:2:1. The total amount of DNA was 30 μg, dissolved in 1 ml of OptiMEM. The DNA and 293fectin were completely mixed and the total volume was 2 ml, incubated at room temperature for 15 minutes. Then the mixture was added to the cell culture. The cells were cultured at 37 °C in an incubator with 5% CO2 and cultured at 130 rpm for 5 days. Antibody expression in the cell supernatant was detected by SDS-PAGE and Western blotting( Figure 9 ). This antibody, designated MSBODY, contains a monovalent light chain / heavy chain unit specific for Her2 / neu and a single chain unit specific for CD3.

[0221] 5. Antibody purification.

[0222] The cell culture was centrifuged at 2000×g, the supernatant was collected and filtered through a 0.22 μm filter. The collected liquid was diluted 10-fold (by volume) with binding buffer (9.5 mM NaH2PO4 + 40.5 mM Na2HPO4, pH 7.0), and then purified by Sepharose Fast Flow protein A affinity chromatography column (purchased from GE, 5 ml volume), Fab Affinity KBPAgarose affinity packing (purchased from ACROBiosystems, 5 ml volume), and SP cation exchange chromatography column (purchased from GE, 10 ml) according to the operation manual. The purified protein was detected by 6% gel SDS-PAGE and Coomassie Brilliant Blue staining (see Figure 10 ).

[0223] Example 2 Analysis of the binding activity of bispecific antibodies

[0224] The ability of the anti-Her2 / neu-anti-CD3 bispecific antibody (MSBODY) to bind to cells with Her2 and CD3 was detected using BT474 and peripheral blood mononuclear cells (PBMC).

[0225] 3×10 were collected from the cell culture 5BT474 cells were incubated with 50 μl of PBS, 10 nM Herceptin, or 10 nM bispecific antibody. After 30 minutes, the cells were washed twice with 1% FBS / PBS and then mixed with 2.5 μl of PE-labeled anti-human IgG Fc. The mixture was incubated for 30 minutes at room temperature and the cells were washed again with 1% FBS / PBS. The samples were then analyzed on a FACS device.

[0226] As Figure 11A shown, both Herceptin (black dashed line) and the anti-Her2×anti-CD3 MSBODY (black solid line) bispecific antibody bound to the breast cancer cell line BT474, with the grey line as the negative control. The results showed that the bispecific antibody could effectively bind to Her2-expressing cancer cells.

[0227] Peripheral blood mononuclear cells (PBMCs) also express CD3. 1.5×10 6 PBMC cells were incubated with 50 μl of PBS, 12.5 nM hOKT3, or 12.5 nM bispecific antibody. The abundance of PBMC cells bound by the bispecific ligand (black solid line) was as high as that of cells bound by HOKT3 (black dashed line) ( Figure 11B ).

[0228] Example 3 Cytotoxicity test of bispecific antibody on BT-474 cells

[0229] BT-474 cells were used as target cells and seeded in 96-well plates (10,000 cells / well). After 24 hours, isolated human PBMCs (effector cells) were added and the mixture was co-incubated with HOKT3 antibody, MSBODY, human IgG protein, or PBS alone (effector cell-target cell (E-T) ratio of 40:1). Figure 12 Pictures of cell aggregation for each antibody were provided. It was clear that the control group samples (PBS) and human IgG samples had no cell aggregation, while MSBODY induced the same number of cell aggregations as HOKT3.

[0230] Antibody-induced cytotoxicity was measured for MSBODY, Herceptin, HOKT3, and Herceptin + HOKT3, using human IgG as a control. BT-474 cells (target cells) were first stained with 5 μM CFSE and then mixed with human PBMCs (effector cells: E-T ratio: 5:1). The same concentrations of Herceptin, HOKT3, Herceptin + HOKT3, MSBODY, and human IgG were added to the cell cultures. After incubation for 24 hours, the cells were collected and stained with 1 μg / ml PI, and counted using a flow cytometer (MoFlo XDP, Beckman Coulter). Cells that were double-stained with CFSE and PI were counted as dead cells. The cell death rate was calculated as the ratio between the number of dead cells and the total number of cells. The cytotoxicity was calculated as the difference between the measured cell death rate and the natural cell death rate. The results are shown in Figure 13 in Figure 13 which showed that MSBODY induced the highest cytotoxicity compared to Herceptin and HOKT3, and even compared to the combination of Herceptin and HOKT3.

[0231] Another cytotoxicity study was performed using human T lymphocytes as effector cells and BT-474 as target cells. BT-474 cells were first stained with 5 μM CFSE. The next day, human PBMCs were mixed with 50 nM human IgG, Herceptin + HOKT3, MSBODY, or PBS and incubated at room temperature for 30 minutes. The cells were washed twice with 1% FBS-PBS and then resuspended in 20% FBS. Then the treated PBMC cells were added to the BT-474 cells at effector-to-target ratios of 20:1, 10:1, 5:1, 2.5:1, and 1.25:1. The mixed cells were incubated for 48 hours ( Figure 14 ). Then the collected cells were stained and counted. As Figure 14 shown, the PBMCs incubated with MSBODY had the largest number of lethal cells compared to PBMCs pre-mixed with Herceptin and HOKT3.

[0232] This example unexpectedly showed that MSBODY was as effective as HOKT3 in causing cell aggregation and had higher cytotoxicity than both Herceptin and HOKT3.

[0233] Example 4 Comparison between antibodies

[0234] This example compared MSBODY with other types of antibodies that are specific for one or both of Her2 / neu and CD3, and showed the unexpectedly high activity and high stability of MSBODY.

[0235] The various types of antibodies tested in this example are shown in Figure 15A-E medium. Figure 15A Displays an MSBODY, where the monovalent unit has the VH and VL of Herceptin, and the single-chain unit contains the VH and VL of HOKT3. Figure 15B The antibody in is almost a mirror image of the MSBODY, called "SMBODY". The SMBODY has a monovalent unit and a single-chain unit. The monovalent unit contains the VH and VL of HOKT3, and the single-chain unit contains the VH and VL of Herceptin.

[0236] Figure 15C The antibody in, called "SSBODY", contains two single-chain units, one having the VH and VL of Herceptin and the other having the VH and VL of HOKT3. As shown, the MSBODY, SMBODY, and SSBODY all contain optional salt bridges and a "pestle"-"mortar" structure.

[0237] Figure 15D Displays a bispecific single-chain antibody (called "Herceptin single-chain"), where both single-chain units contain the VH and VL of Herceptin. The antibody has single specificity. Finally, Figure 15E Displays a bispecific single-chain antibody that has two single-chain units that contain the VH and VL of HOKT3, which is referred to herein as "HOKT3 single-chain".

[0238] To compare the binding affinity of MSBODY and SMBODY for Her2-expressing cells, 3×10 5 BT-474 cells were incubated with different dilution concentrations of purified MSBODY or SMBODY in 50 μl of Dulbecco’s PBS + 1% fetal bovine serum (1% FBS-PBS) with gentle stirring at room temperature (RT) for 30 minutes. The cells were then washed twice with 1% FBS-PBS and incubated in 50 μl of 1% FBS-PBS containing 10 μg / ml of PE-conjugated mouse anti-human IgG Fc antibody (Biolegend, 409304) for 30 minutes. The cells were washed twice again, resuspended in 1% FBS-PBS, and analyzed by flow cytometry.

[0239] The BT-474 cells used in the binding assay described above were analyzed using a flow cytometer (MoFlo XDP, Beckman Coulter) to detect the antibody bound to the cells ( Figure 16 A and B). Numerical and graphical analyses were obtained using (GraphPad Prism5). The mean fluorescence intensity measured was plotted as a function of antibody concentration to determine the Kd by the one-site binding (hyperbola) method. The results are shown in Figure 17 in. Figure 17It shows that the affinity of MSBODY for binding to Her2-expressing cells is approximately twice that of SMBODY.

[0240] The thermal stability of MSBODY was measured by thermal challenge analysis in comparison with SMBODY and various single-chain antibodies. Herceptin, Herceptin single-chain, MSBODY, and SSBODY were diluted to 0.5 mg / mL and incubated at various temperature levels (5°C increments) between 37°C and 82°C for one hour.

[0241] Her2 protein (2.5 μg / ml) was incubated overnight at 4°C and then treated with 3% FBS for 2 hours. After washing 3 times with PBST, the antibody was diluted to 1 nM and reacted with Her2 for 1 hour. Subsequently, anti-human IgG Fc-HRP (1:10K) was added and incubated at the reaction temperature for half an hour. Then the sample was washed 5 times with PBST and stained with TMB, and the absorbance was read at OD450. Figure 18 The thermal challenge curves are shown. The Y-axis is temperature, T 50 , indicating the temperature at which 50% of the antibody still retains its binding ability to Her2 after thermal challenge. The binding curve was normalized to 100% maximum binding. It can be seen that MSBODY retains higher thermal stability than SMBODY, SSBODY, and Herceptin single-chain antibody, which is close to that of full-size Herceptin. This result is very unexpected because single-chain antibodies are known to be unstable.

[0242] The antibody-induced cytotoxicity of MSBODY and SMBODY was measured, using human IgG as a control. High Her2 BT-474 cells that express Her2 protein at a relatively high level, and low Her2 cells such as MCF-7 and MDA-MB-231 that express Her2 protein at a relatively low level, were first stained with 5 μM CFSE and then mixed with human PBMC (effector cells) (E-T ratio: 5:1). The same concentration of MSBODY, SMBODY, and human IgG was added to the cell culture. After incubation for 48 hours, the cells were collected and stained with 1 μg / ml PI, and counted using a flow cytometer (MoFlo XDP, Beckman Coulter). Cells that were double-stained with CFSE and PI were counted as dead cells. The cell death rate was calculated as the ratio between the number of dead cells and the total number of cells. The cytotoxicity was calculated as the difference between the measured cell death rate and the natural cell death rate. The results are shown in Figure 19 in Figure 19 It shows that both MSBODY and SMBODY produce similar cytotoxicity against high Her BT474 cells. However, MSBODY shows significantly higher cytotoxicity against low Her2 breast cancer cell lines such as MCF-7 and MDA-MB-231.

[0243] Preparation of Other Monovalent Single-chain Bispecific Antibodies in Example 5

[0244] The above examples demonstrate a method for preparing and testing specific monovalent single-chain bispecific antibodies (MSBODYs), which contain a monovalent unit specific for Her2 / neu and a single-chain unit specific for CD3. Using the same method, other such MSBODYs can be prepared and used, each having a monovalent unit that recognizes tumor cells and a single-chain unit that recognizes effector cells.

[0245] For example, an MSBODY can contain a monovalent unit having a modified light chain and heavy chain of an antibody, such as rituximab, anti-AC133 antibody, and cetuximab. The heavy chain and light chain sequences of the rituximab sequence are shown in the table below.

[0246]

[0247] The heavy chain and light chain sequences of the anti-AC133 antibody sequence are shown in the table below.

[0248]

[0249]

[0250] The heavy chain and light chain of cetuximab are shown in the table below.

[0251]

[0252] Each of the heavy chains as described above can be modified to introduce salt bridges and / or a "pestle" into a "mortar". Examples of such modifications are shown in Tables 1-3.

[0253] This application is not limited to the scope of the specific embodiments described, which are used as separate descriptions of various aspects of this application, and any composition and method that is functionally equivalent is within the scope of this application. It is obvious to those skilled in the art that various modifications and changes can be made to the methods and compositions of this application without departing from the spirit or scope of this application. Therefore, it should be understood that this application covers the modifications and variations of this application as long as they are within the scope of the appended claims and their equivalents.

[0254] All publications and patent applications mentioned in this specification are hereby incorporated by reference herein to the same extent as if each individual publication or patent application was specifically and individually incorporated by reference.

Claims

1. A bispecific antibody, comprising: (a) a light chain - heavy chain pair specific for tumor cells or microorganisms, wherein the light chain binds to the heavy chain via a disulfide bond; and (b) a fusion peptide, the fusion peptide comprising a single - chain variable fragment (scFv) and an Fc fragment having a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for immune cells.

2. The antibody according to claim 1, wherein The light chain - heavy chain pair is specific for a tumor antigen.

3. The antibody according to claim 2, wherein, The tumor antigen is selected from: EGFR, Her2, EpCAM, CD20, CD30, CD33, CD47, CD52, CD133, CEA, gpA33, mucin, TAG - 72, CIX, PSMA, folate - binding protein, GD2, GD3, GM2, VEGF, VEGFR, integrin, αVβ3, α5β1, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP, and tenascin.

4. The antibody according to claim 1, wherein The light chain - heavy chain pair is specific for a protein that is overexpressed on tumor cells relative to corresponding non - tumor cells.

5. The antibody according to claim 1, wherein The light chain - heavy chain pair is specific for a virus or bacteria.

6. The antibody according to claim 5, wherein The light chain - heavy chain pair is specific for endotoxin.

7. The antibody according to any one of claims 1-6, characterized in that, The immune cells are selected from T cells, B cells, monocytes, macrophages, neutrophils, dendritic cells, phagocytes, natural killer cells, eosinophils, basophils, and mast cells.

8. The antibody according to any one of claims 1-7, characterized in that, The fusion peptide is specific for an antigen selected from CD3, CD16, CD19, CD28, and CD64.

9. The antibody according to any one of claims 1-8, characterized in that, The heavy chain binds to the fusion peptide via one or more disulfide bonds.

10. The antibody according to any one of claims 1-9, characterized in that, The heavy chain comprises a human or humanized Fc fragment.

11. The antibody according to claim 10, wherein The Fc fragment of the heavy chain comprises a human IgG Fc fragment.

12. The antibody according to any one of claims 1-11, wherein The Fc fragment of the fusion peptide comprises a human or humanized Fc fragment.

13. The antibody according to claim 12, wherein, The Fc fragment of the fusion peptide comprises a human IgG Fc fragment.

14. The antibody according to any one of claims 1-13, characterized in that, Compared with the wild - type antibody fragment, the Fc fragment of the heavy chain and / or the fusion peptide comprises one or more amino acid substitutions that form an ionic bond between the heavy chain and the Fc fragment.

15. The antibody according to claim 14, wherein The substitutions are selected from Table 1.

16. The antibody according to any one of claims 1-15, characterized in that, Compared with the wild - type antibody fragment, the Fc fragment of the heavy chain and / or the fusion peptide comprises one or more substitutions that form a stud - socket structure pairing between the heavy chain and the Fc fragment.

17. The antibody according to claim 16, wherein, The substitutions are selected from Table 2.

18. The antibody according to any one of claims 1-17, characterized in that, The antibody further comprises a detectable tag.

19. The antibody according to any one of claims 1-18, characterized in that, The CH2 domain is located between the scFv fragment and the CH3 domain.

20. The antibody according to any one of claims 1-19, characterized in that, The fusion peptide does not comprise a CH1 domain.

21. A composition, comprising the antibody according to any one of claims 1 - 20 and a carrier.

22. The composition according to claim 21, wherein The carrier is a pharmaceutical carrier.

23. A complex, the complex comprising the antibody according to any one of claims 1 - 20, the antibody binding to one or more antigens.

24. A method for preparing an antibody, the method comprising: Mixing (a) a light chain-heavy chain pair and (b) a fusion peptide, wherein the light chain-heavy chain pair is specific for immune cells and the fusion peptide comprises a single-chain variable fragment (scFv) and an Fc fragment having a CH2 domain and a CH3 domain, wherein the fusion peptide is specific for tumor cells.

25. An antibody produced by the method according to claim 24.

Images