Fusion antibacterial peptide expression vector construction method, fusion antibacterial peptide expression purification method and fusion antibacterial peptide expression purification device

Abstract

The invention relates to construction of a fusion antibacterial peptide expression vector as well as an expression purification method and a purification device thereof, and belongs to the technical field of bioengineering. The preparation method comprises the following steps: fusing an antibacterial peptide to a C terminal of RNase denaturation form Onconase (ONC) protein from Rana pipiens, constructing an expression plasmid, and transforming the expression plasmid into escherichia coli to obtain gt; the yield of the inclusion body form fusion peptide is 300 mg / L. Gt is realized through operations of inclusion body washing, redissolving, acid hydrolysis, neutralization and the like; and the low-cost large-scale production of the 95% high-purity antibacterial peptide is realized. As a carrier protein, ONC has the advantages of high expression quantity, low toxicity, small molecular weight, specific pH solubility and the like. In the purification process, the inclusion body is dissolved by using a urea solution, and the purity and the yield of the antibacterial peptide are further improved by combining cation exchange chromatography and an ultrafiltration technology. According to the method and the device, the purification efficiency is remarkably improved, the labor investment is reduced, and the method and the device are suitable for wide industrial application.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a method for constructing a fusion antibacterial peptide expression vector, its expression and purification method, and a purification device. Background Art

[0002] Antibacterial peptides are short peptides with lengths between 5 and 50 amino acid residues and are widely used in research, diagnosis, medicine, and industrial fields. For example, in the medical field, antibacterial peptides are used as antibacterial, anti-inflammatory, anti-cancer, and cell-penetrating peptides; in the industrial field, they are used in applications such as metal surface binding and graphite binding peptides. Although solid-phase chemical synthesis technology is very suitable for small-scale production of short peptides, when peptides with more than 30 amino acids need to be synthesized or for large-scale production, the cost becomes quite high. In addition, antibacterial peptides face many challenges during recombinant production. For example, some peptides are toxic to host cells, and short peptides are also very sensitive to proteases and are easily degraded within cells, resulting in low yields. To overcome these difficulties, fusing antibacterial peptides with carrier proteins has become an effective solution. Carrier proteins can protect the peptides from proteases, neutralize their potential toxic effects, and provide a convenient purification route.

[0003] Existing fusion protein strategies have been widely used in the recombinant production of antibacterial peptides. However, this strategy also has two main drawbacks. First, the fusion protein must be cleaved and the peptide separated from the carrier protein. Usually, common enzymes such as factor Xa, enterokinase, and thrombin can cleave the fusion protein, but due to unfavorable residues and steric hindrance around the cleavage site, the efficiency of enzymatic cleavage is often low. In addition, enzymatic reactions usually need to be carried out under non-denaturing conditions, so when the fusion protein is partially or completely insoluble, the enzymatic cleavage method cannot be used. On the other hand, chemical cleavage reagents such as cyanogen bromide, formic acid, and hydroxylamine are also commonly used to cleave Met-X, Asp-Pro, and Asn-Gly peptide bonds, but the high toxicity of these reagents and the harsh reaction conditions required often lead to non-specific cleavage and side-chain modification. For example, formic acid cleaves the Asp-Pro sequence under conditions of 50-70% concentration at 60 °C, usually resulting in non-specific hydrolysis, formylation, and oxidation reactions of the side chains.

[0004] Although the existing technologies have made certain progress in the production of antimicrobial peptides by fusion proteins, there are still some significant deficiencies. First, the enzymatic cleavage method is inefficient and requires harsh reaction conditions, which limits its application in insoluble fusion proteins. Second, although the chemical cleavage method can overcome some limitations of enzymatic cleavage, due to highly toxic reagents and severe reaction conditions, it often causes non-specific cleavage and side reactions, affecting the purity and yield of the product. In addition, in the fusion protein strategy, the required peptide usually only accounts for a small part of the purified fusion protein, resulting in a low purity of the final product, further increasing the production cost and complexity. Therefore, there is an urgent need to develop an efficient and low-cost method and device for constructing a fusion antimicrobial peptide expression vector and its expression and purification to overcome these deficiencies of the existing technologies and improve the industrial production level of antimicrobial peptides. Summary of the Invention

[0005] The present invention relates to a method and a purification device for constructing a fusion antimicrobial peptide expression vector and its expression and purification, belonging to the technical field of bioengineering. In the present invention, an antimicrobial peptide is fused to the C-terminus of the denatured form Onconase (ONC) protein from Rana pipiens, an expression plasmid is constructed and transformed into Escherichia coli to obtain a fusion peptide in the form of inclusion bodies with a high yield of >300 mg / L. Through operations such as inclusion body washing, reconstitution, acid hydrolysis, and neutralization, large-scale production of antimicrobial peptides with a high purity of >95% at low cost is achieved. ONC, as a carrier protein, has the advantages of high expression level, low toxicity, small molecular weight, and specific pH solubility. During the purification process, urea solution is used to dissolve the inclusion bodies, combined with cation exchange chromatography and ultrafiltration techniques to further improve the purity and yield of the antimicrobial peptides. This method and device significantly improve the purification efficiency and reduce the manual input, and are applicable to a wide range of industrial applications.

[0006] The object of the present invention can be achieved by the following technical solutions:

[0007] A method for constructing a fusion antimicrobial peptide expression vector, comprising the following steps:

[0008] A1. Design a fusion expression cassette containing ONC, 6×His tag, GTGDP linker, and GKY20 sequence according to the characteristics of ONC, perform sequence optimization using Escherichia coli-preferred codons, and add NdeI and HindIII restriction enzyme sites and protection bases at both ends to obtain Sequence No. 1;

[0009] A2. Synthesize and clone Sequence No. 1 into the pET-21b+ expression vector;

[0010] A3. Transform the expression vector into BL21(DE3) competent cells.

[0011] As a preferred technical solution of the present invention, the Sequence No. 1 is:

[0012] CATATGCAGGAATGGCTGACCTTCCAGAAAAAACACATCACCAACACCCGTGAAGTTGAATACGAAAACATCATGTCTACCAACCTGTTCCACTACAAAGAAAAAAACACCTTCATCTACTCTCGTCCGGAACCGGTTAAAGCTATCCTGAAAGGTATCATCGCTTCTAAAAACGTTCTGACCACCTCTGAATTCTACCTGTCTGAATACAACGTTACCTCTCGTCCGTACAAATACAAACTGAAAAAATCTACCAACAAATTCATCGTTACCATCGAAAACCAGGCTCCGGTTCACTTCGTTGGTGTTGGTTCTCACCACCACCACCACCACGGTACCGGTGACCCGGGTAAATACGGTTTCTACACCCACGTTTTCCGTCTGAAAAAATGGATCCAGAAAGTTATCTAAGCTT。

[0013] The described method for expressing and purifying a fusion antibacterial peptide comprises the following steps:

[0014] B1. Transform the expression vector into BL21(DE3), coat it on a plate for culture, pick a single colony for culture, and after successful plasmid extraction and sequencing, it is a recombinant strain of the fusion antibacterial peptide;

[0015] B2. Expand the culture of the recombinant strain of the fusion antibacterial peptide until the OD600 reaches 0.8 - 1.0, add IPTG with a final concentration of 0.1 - 1 mM for induced expression for 12 - 18 h;

[0016] B3. Place the Escherichia coli broth expressing the antibacterial peptide in a stirred tank, add lysozyme for cell lysis, filter through a hollow fiber microfiltration column to remove cell debris and part of the water, retain the inclusion bodies, wash the soluble proteins on the surface of the inclusion bodies with a washing solution until the conductivity < 500 μs / cm, and leave the inclusion body solution;

[0017] B4. Dissolve the inclusion body solution with a mixed solution of the same volume of 16 mol / L urea and 100 mM PB with a pH of 7.6, then filter through a hollow fiber microfiltration column and use a cation exchange resin chromatography column equilibrated with the urea and PB mixed solution. Load the inclusion body solution onto the chromatography column, and then elute the bound antibacterial peptide protein with an eluent and collect the target protein;

[0018] B5. The target protein removes inorganic salts such as urea, sodium chloride, and phosphate through hollow fiber ultrafiltration, washes the antimicrobial peptide protein with deionized water until the conductivity ≤ 100 μs / cm, and acidifies the antimicrobial peptide solution.

[0019] B6. Use a hollow fiber ultrafiltration column to remove impurities from the acidified antimicrobial peptide solution until the conductivity ≤ 10 μs / cm, then concentrate the antimicrobial peptide solution to 1 - 10 g / L and collect and store it.

[0020] As a preferred technical solution of the present invention, the washing solution in step B3 is 90 - 110 mM NaCl, 1.9 - 2.1 mol / L urea, and 1.9 - 2.1% Triton X - 100, and the balance is deionized water; the mass ratio of the Escherichia coli bacterial solution, lysozyme, and the washing solution is 1:0.0002 - 0.0005:0.33 - 0.5.

[0021] As a preferred technical solution of the present invention, the elution solution in step B4 is 0.5 mol / L NaCl, 8 mol / L urea, 50 mM PB with a pH of 7.6, and the balance is deionized water.

[0022] As a preferred technical solution of the present invention, the acidification in step B5 is as follows: add acetic acid to a concentration of 0.1 mol / L, adjust the pH of the antimicrobial peptide solution to 1.8 - 2.2 with 0.1 mol / L hydrochloric acid, then raise the temperature to 58 - 62 °C, stir and keep warm for 22 - 26 h, then adjust the pH of the antimicrobial peptide solution to 6.5 - 7.5 with ammonia water, cool down to 26 - 30 °C, and stir and keep warm for 14 - 18 h.

[0023] The purification device for a fusion antimicrobial peptide includes a stirring tank, a thermometer, a conductivity meter, a hollow fiber ultrafiltration column, a hollow fiber microfiltration column, a cation exchange resin chromatography column, a jacket, and an ultraviolet detector; the functions of the device include bacterial cell lysis and inclusion body washing, inclusion body dissolution and filtration, cation exchange chromatography purification of inclusion body proteins, and removal of urea and acidification of inclusion body proteins.

[0024] As a preferred technical solution of the present invention, each component of the device is detachable, facilitating maintenance, replacement, cleaning, and disinfection.

[0025] As a preferred technical solution of the present invention, the device has a conductivity meter, and the purification quality can be judged by monitoring the conductivity.

[0026] As a preferred technical solution of the present invention, the device has a cleaning pipeline, which can flush the pipeline, the hollow fiber microfiltration column, the hollow fiber ultrafiltration column, and each component.

[0027] The beneficial effects of the present invention:

[0028] (1) In the design and expression of the present invention, by fusing an antimicrobial peptide to the carrier protein in the denatured form of Onconase (ONC) derived from Rana temporaria, high-efficiency expression is achieved. ONC is highly expressed in inclusion bodies, avoiding the toxicity of the antimicrobial peptide to host bacteria and its intracellular degradation. This design not only increases the yield of the antimicrobial peptide (>300 mg / L), but also provides a convenient acid hydrolysis site through the GTGDP linker, facilitating subsequent cleavage and separation.

[0029] (2) During the purification process of the present invention, based on the characteristics of inclusion bodies, an improved Asp-Pro acid hydrolysis cleavage method effectively releases the antimicrobial peptide and reduces the incidence of side reactions. By adopting optimized steps such as washing, dissolution, cation exchange chromatography, acidification cleavage, and ultrafiltration concentration, high-efficiency separation and purification of the antimicrobial peptide are achieved. Through means such as conductivity and ultraviolet detection for real-time monitoring, an antimicrobial peptide with a purity exceeding 95% is finally obtained.

[0030] (3) The device of the present invention is designed modularly and has a detachable function, which is convenient for cleaning and maintenance, reducing the operating cost. The conductivity meter and ultraviolet detector integrated in the device help to monitor the purification process in real time. In addition, the device is equipped with a cleaning pipeline to flush each component. Description of the Drawings

[0031] For the convenience of those skilled in the art to understand, the present invention will be further described below in conjunction with the drawings.

[0032] Figure 1 is the front view of the device;

[0033] Figure 2 is the schematic diagram of cell lysis and inclusion body washing;

[0034] Figure 3 is the schematic diagram of inclusion body dissolution and filtration;

[0035] Figure 4 is the schematic diagram of cation exchange chromatography purification of inclusion body protein;

[0036] Figure 5 is the schematic diagram of urea removal and acidification of inclusion body protein;

[0037] Figure 6 is the schematic diagram of pipeline cleaning. Detailed Embodiments

[0038] To further elaborate on the technical means and effects adopted by the present invention to achieve the predetermined invention purpose, the following, in conjunction with the drawings and preferred embodiments, details the specific embodiments, structures, features, and effects according to the present invention.

[0039] Example 1

[0040] Construction of a fusion antibacterial peptide expression vector, comprising the following steps:

[0041] A1. Design a fusion expression cassette containing ONC, 6×His tag, GTGDP linker, and GKY20 sequence according to the characteristics of ONC, optimize the sequence using E. coli-preferred codons, and add NdeI and HindIII restriction enzyme sites and protective bases at both ends to obtain Sequence No. 1;

[0042] A2. Synthesize and clone Sequence No. 1 into the pET-21b+ expression vector;

[0043] A3. Transform the expression vector into BL21(DE3) competent cells.

[0044] The said Sequence No. 1 is:

[0045] CATATGCAGGAATGGCTGACCTTCCAGAAAAAACACATCACCAACACCCGTGAAGTTGAATACGAAAACATCATGTCTACCAACCTGTTCCACTACAAAGAAAAAAACACCTTCATCTACTCTCGTCCGGAACCGGTTAAAGCTATCCTGAAAGGTATCATCGCTTCTAAAAACGTTCTGACCACCTCTGAATTCTACCTGTCTGAATACAACGTTACCTCTCGTCCGTACAAATACAAACTGAAAAAATCTACCAACAAATTCATCGTTACCATCGAAAACCAGGCTCCGGTTCACTTCGTTGGTGTTGGTTCTCACCACCACCACCACCACGGTACCGGTGACCCGGGTAAATACGGTTTCTACACCCACGTTTTCCGTCTGAAAAAATGGATCCAGAAAGTTATCTAAGCTT。

[0046] The said method for expression and purification of a fusion antibacterial peptide, comprising the following steps:

[0047] B1. Transform the expression vector into BL21(DE3), coat it on a plate for culture, pick a single colony for culture, and after successful plasmid extraction and sequencing, it is a fusion antibacterial peptide recombinant strain;

[0048] B2. Expand the culture of the fusion antibacterial peptide recombinant strain to an OD600 of 0.8, add IPTG with a final concentration of 0.6 mM for induction expression for 16 h;

[0049] B3. Place the Escherichia coli broth expressing the antimicrobial peptide in a stirring tank, add lysozyme for cell lysis, filter through a hollow fiber microfiltration column to remove cell debris and part of the water, retain the inclusion bodies, wash the soluble proteins on the surface of the inclusion bodies with a washing solution until the conductivity reaches 450 μs / cm, and leave the inclusion body solution;

[0050] B4. Dissolve the inclusion body solution in a mixed solution of the same volume of 16 mol / L urea and 100 mM PB with a pH of 7.6, then filter through a hollow fiber microfiltration column and use a cation exchange resin chromatography column equilibrated with the urea and PB mixed solution. Load the inclusion body solution onto the chromatography column, and then elute the bound antimicrobial peptide protein with an eluent and collect the target protein;

[0051] B5. Remove inorganic salts such as urea, sodium chloride, and phosphate from the target protein by hollow fiber ultrafiltration, wash the antimicrobial peptide protein with deionized water until the conductivity reaches 90 μs / cm, and acidify the antimicrobial peptide solution;

[0052] B6. Use a hollow fiber ultrafiltration column to remove impurities from the acidified antimicrobial peptide solution until the conductivity reaches 8 μs / cm, then concentrate the antimicrobial peptide solution to 10 g / L and collect and store it.

[0053] The washing solution described in step B3 is 100 mM NaCl, 2 mol / L urea, and 2% Triton X-100, with the balance being deionized water; the mass ratio of the Escherichia coli broth, lysozyme, and washing solution is 1:0.0004:0.4.

[0054] The eluent described in step B4 is 0.5 mol / L NaCl, 8 mol / L urea, 50 mM PB with a pH of 7.6, with the balance being deionized water.

[0055] The acidification described in step B5 is as follows: Add acetic acid to a concentration of 0.1 mol / L, adjust the pH of the antimicrobial peptide solution to 2.0 with 0.1 mol / L hydrochloric acid, then raise the temperature to 60 °C, stir and keep warm for 24 h, then adjust the pH of the antimicrobial peptide solution to 7.0 with ammonia water, cool down to 28 °C, and stir and keep warm for 16 h.

[0056] The purification device for a fusion antimicrobial peptide includes a stirring tank, a thermometer, a conductivity meter, a hollow fiber ultrafiltration column, a hollow fiber microfiltration column, a cation exchange resin chromatography column, a jacket, and an ultraviolet detector; the functions of the device include cell lysis and inclusion body washing, inclusion body dissolution and filtration, cation exchange chromatography purification of inclusion body proteins, and removal of urea and acidification of inclusion body proteins.

[0057] The steps of cell lysis and inclusion body washing are as Figure 2 shown: As Figure 2As shown by the red arrow, the Escherichia coli solution expressing the antibacterial peptide is placed in the stirring tank 1, and lysozyme is added to the solution to make the concentration of lysozyme reach 0.4 mg / mL. Start stirring 3 with a set rotation speed of 200 rpm and keep stirring. At the same time, pass a constant temperature water at 35 °C into the jacket 82 through the valve 80, and the constant temperature water is discharged from 83 to fully dissolve the lysozyme. At the same time, control the temperature of the bacterial solution in the stirring tank 1 at 35 °C and perform lysis treatment for 30 min to dissolve Escherichia coli. After the Escherichia coli is dissolved, a lysate is obtained. Start the liquid pump 18 to make the lysate pass through the valve 19 and valve 22 and filter out cell debris and part of the water in the lysate through the hollow fiber microfiltration column 17. Since the inclusion bodies are relatively large in volume, they will be intercepted by the hollow fiber column. Therefore, the inclusion body solution will flow back to the stirring tank 1 along the pipeline 11 through the valve 12. Such a cycle is carried out until the volume is reduced to 1 / 8 of the original Escherichia coli solution, and then stop the liquid pump 18. Add a washing solution 1 with a concentration of 100 mmol / L NaCl, 2.0 mol urea, and 2.0% Triton X-100, which is half of the volume of the original Escherichia coli solution, to the stirring tank 1 and mix it well with the inclusion body solution for 8 min to dissolve the soluble proteins on the surface of the inclusion bodies. Start the liquid pump 18 to make the mixed solution pass through the valve 19 and valve 22 and filter out cell debris, soluble other proteins, and part of the water in the mixed solution through the hollow fiber microfiltration column 17. Since the inclusion bodies are relatively large in volume, they will be intercepted by the hollow fiber column. Therefore, the inclusion body solution will flow back to the stirring tank 1 along the pipeline 11 through the valve 12. Such a cycle is carried out until the volume is reduced to 1 / 8 of the original Escherichia coli solution, and then add pure water to the stirring tank 1 through the valve 11 to mix and wash the inclusion body solution flowing back to the stirring tank 1. At the same time, continuously filter through the hollow fiber column. By continuously adding pure water, other soluble impurities in the inclusion body solution are washed away, and at the same time, the volume of the inclusion bodies is restored to 1 / 2 of the original volume of the Escherichia coli solution until the measured conductivity at the conductivity meter 8 is <500 μs / cm, and then stop the liquid pump 18 to enter the next step.

[0058] The steps of dissolving and filtering the inclusion bodies are as Figure 3 shown: As Figure 3 shown by the green arrow, add a solution 2 (16 mol / L urea, 100 mmol / L (pH 7.6) PB) with the same volume as the volume of the inclusion body solution to the inclusion body solution. After mixing with the inclusion body solution, the inclusion body solution contains a solution of 8 mol / L urea and 50 mM / L (pH 7.6) PB. Control the temperature at 35 °C and stir and mix for 30 min to dissolve the inclusion bodies. Start the liquid pump 18 to make the dissolved inclusion body solution pass through the hollow fiber microfiltration column and filter it into the stirring tank 31. Slightly open the stirring 33 (50 rpm) and add cooling water through the jacket 78 to keep the temperature of the dissolved inclusion body solution at 15 °C to prevent the growth of suitable microorganisms at a higher temperature and cause contamination during the purification process.

[0059] The purification step of the inclusion body protein by cation exchange chromatography is as follows Figure 4 shown: Since the packing material inside the cation exchange resin chromatography column is stored in a 20% (V / V) ethanol solution, it is necessary to introduce pure water from valve 39 and control the flushing flow rate through liquid pump 38 at a flow rate of 100 cm / hour to flush the ethanol from the packing material in the cation exchange resin chromatography column. The ethanol is discharged through valve 85 into waste liquid pipeline 61. Flushing 5 column volumes is sufficient. After flushing the cation exchange resin chromatography column, introduce a solution containing 8 mol / L urea and 50 mM (pH 7.6) PB from valve 40 for equilibration. The equilibration is controlled by liquid pump 38 at a flow rate of 100 cm / hour for 4 column volumes. The waste liquid from equilibration is discharged through waste liquid pipeline 61. After the packing material in the cation exchange resin chromatography column is equilibrated, as shown by the red arrow in Figure 4 , under the control of liquid pump 38, the sample loading flow rate is 100 cm / hour. Open valve 34 and valve 37 to load the inclusion body solution (hereinafter referred to as antibacterial peptide protein) in stirring tank 31. The sample loading through-flow liquid is discharged through waste liquid pipeline 61. After sample loading is completed, introduce a solution containing 8 mol / L urea and 50 mM / L (pH 7.6) PB from valve 40 to wash the impurities from chromatography column 43 (wash until the baseline shown in ultraviolet detector 84 becomes flat, generally 3 column volumes of washing is sufficient). The impurity washing is controlled by liquid pump 38 at a flow rate of 100 cm / hour. After impurity washing is completed, introduce a solution containing 0.5 mol / L NaCl, 8 mol / L urea, and 50 mM / L (pH 7.6) PB from valve 41 to elute the antibacterial peptide protein bound by ion exchange in chromatography column 43. The elution situation can be observed from detector 84. When it is observed that the target protein peak is eluted, quickly switch the valve, close valve 85, and open valve 45 to make the target protein peak solution enter stirring tank 49. After the target protein is eluted, open valve 85 and close valve 45 at the same time. Introduce 0.5 mol / L sodium hydroxide solution from valve 42 to clean the chromatography column. After cleaning 2 column volumes, introduce pure water from valve 39 to clean the chromatography column for 5 column volumes. After cleaning the sodium hydroxide in the chromatography column, introduce 20% (V / V) ethanol solution from valve 39.

[0060] The step of removing urea and acidifying the inclusion body protein is as follows Figure 5As shown: As indicated by the purple arrow in the figure, start the stirrer 51 with a set speed of 150 rpm, start the liquid pump 57, and make the antibacterial peptide protein solution after ion exchange enter the hollow fiber ultrafiltrate through valves 58 and 60 to ultrafilter and remove inorganic salts such as urea, sodium chloride, and phosphate in the protein solution. At the same time, through valve 47, pure water is introduced into the stirring tank 49 to wash the antibacterial peptide protein solution. Cycle like this until the conductivity in the conductivity meter 56 is less than 100 μs / cm, indicating that the desalting of the antibacterial peptide protein is basically complete. At the same time, control the volume of the antibacterial peptide protein in the stirring tank 49 to be the same as the volume after the original antibacterial peptide is eluted from the ion exchange chromatography column. Add acetic acid to the antibacterial peptide solution and adjust its concentration to 0.1 mol / L. At the same time, add 0.1 mol / L hydrochloric acid at valve 48 to adjust the pH of the antibacterial peptide solution to 2.0. By introducing hot water into the jacket 73, adjust the antibacterial peptide solution to 60 °C, stir and keep warm for 24 h, then introduce ammonia water through valve 48 to adjust the pH of the antibacterial peptide solution to 7.0. By introducing cooling water into the jacket 73, lower the antibacterial peptide solution to 28 °C and stir and keep warm for 16 h to complete the desalting and acidification of the antibacterial peptide solution. The acidified antibacterial peptide fusion region has been opened and becomes small molecules. The acidified antibacterial peptide is then ultrafiltered to remove impurities to obtain an antibacterial peptide with a purity meeting the production requirements. The ultrafiltration method is as follows: On the premise that the stirrer 51 in the stirring tank 49 is turned on, the antibacterial peptide solution is pumped through valves 58 and 60 into the hollow fiber ultrafiltration column 65 by the liquid pump 57. The concentrated solution flows back to the stirring tank 49 through valve 68. At the same time, pure water is introduced into the stirring tank 49 at valve 47 to supplement the volume reduced by ultrafiltration. Cycle like this until the conductivity reading at the conductivity meter 56 is less than 10 μs / cm, indicating that the ion content in the antibacterial peptide solution is very low. Then close valve 47, ultrafilter and concentrate the antibacterial peptide to a corresponding concentration such as 1 g / L or 10 g / L, and the antibacterial peptide solution can be discharged from valve 54 to complete the purification of the antibacterial peptide. Glycerol can be added to the antibacterial peptide solution and the concentration of glycerol is made to reach about 50% to be stored frozen for a long time, or the antibacterial peptide can be freeze-dried into a dry powder and can also be stored for a long time. The purified antibacterial peptide can be used as a raw material for various skin care products.

[0061] All components of the described device are detachable, facilitating maintenance, replacement, cleaning, and disinfection.

[0062] The described device has a conductivity meter, and the purification quality can be judged by monitoring the conductivity.

[0063] As a preferred technical solution of the present invention, the described device has a cleaning pipeline, which can flush the pipeline, hollow fiber microfiltration column, hollow fiber ultrafiltration column, and each component. The pipeline is clear as Figure 6As shown in the figure, as indicated by the red arrow in the figure, washing water is introduced from valve 71 to rinse each component, and the rinsing wastewater is collected and discharged at valve 61. For the cleaning of the hollow fiber microfiltration column 17, washing water is introduced from valve 15 to clean the inner surface of the membrane, and the wastewater is discharged from valve 22. At the same time, pure water is introduced from valve 16 to clean the outer surface of the hollow fiber membrane, and the wastewater is discharged from valve 23 to 21. The cleaning method of the hollow fiber ultrafiltration column is the same as that of the hollow fiber microfiltration column.

[0064] Example 2

[0065] On the basis of Example 1, step B2 is changed to expand the culture of the recombinant strain of the fusion antibacterial peptide to an OD600 of 0.8, add IPTG with a final concentration of 0.1 mM for induction expression for 12 h, and the rest is the same as in Example 1.

[0066] Example 3

[0067] On the basis of Example 1, step B2 is changed to expand the culture of the recombinant strain of the fusion antibacterial peptide to an OD600 of 1.0, add IPTG with a final concentration of 1 mM for induction expression for 18 h, and the rest is the same as in Example 1.

[0068] Example 4

[0069] On the basis of Example 1, the washing solution in step B3 is changed to 90 mM NaCl, 1.9 mol / L urea and 1.9% Triton X-100, and the balance is deionized water; the mass ratio of the Escherichia coli bacterial solution, lysozyme and washing solution is changed to 1:0.0002:0.33, and the rest is the same as in Example 1.

[0070] Example 5

[0071] On the basis of Example 1, the washing solution in step B3 is changed to 110 mM NaCl, 2.1 mol / L urea and 2.1% Triton X-100, and the balance is deionized water; the mass ratio of the Escherichia coli bacterial solution, lysozyme and washing solution is changed to 1:0.0005:0.5, and the rest is the same as in Example 1.

[0072] Performance test:

[0073] Expression level test: Extract inclusion body proteins, use the Bradford kit to measure the total protein concentration, combine with the relative proportion of the target protein in SDS-PAGE, and calculate the content of the target fusion protein.

[0074] Antibacterial peptide purity test: Through reverse-phase high-performance liquid chromatography (RP-HPLC), the retention time of the antibacterial peptide under specific solvent conditions is used to separate and quantitatively detect the purity of the purified antibacterial peptide, and the percentage of the main peak area in the total peak area is analyzed to determine the purity of the antibacterial peptide.

[0075]

[0076] From the above test results, it can be seen that in the present invention, an antimicrobial peptide is fused to the C-terminus of the denatured form Onconase (ONC) protein from Rana pipiens, an expression plasmid is constructed and transformed into Escherichia coli, and a fusion peptide in the form of inclusion bodies with a high yield of >300 mg / L is obtained. Through operations such as inclusion body washing, reconstitution, acid hydrolysis, and neutralization, large-scale low-cost production of an antimicrobial peptide with a high purity of >95% is achieved.

[0077] As described above, it is only a preferred embodiment of the present invention, and there is no limitation to the present invention in any form. Although the present invention has been disclosed as above with a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments with equivalent changes within the scope of the technical solution of the present invention. However, as long as it does not depart from the content of the technical solution of the present invention, any brief modifications, equivalent changes, and modifications made to the above embodiments according to the technical essence of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A method for constructing a fusion antibacterial peptide expression vector, characterized in that: It includes the following steps: A1. Design a fusion expression cassette containing ONC, 6×His tag, GTGDP linker, and GKY20 sequence according to the characteristics of ONC, optimize the sequence using E. coli-preferred codons, and add NdeI and HindIII restriction sites and protection bases at both ends to obtain Sequence No. 1; A2. Synthesize and clone Sequence No. 1 into the pET-21b+ expression vector; A3. Transform the expression vector into BL21(DE3) competent cells.

2. The construction method of a fusion antibacterial peptide expression vector according to claim 1, wherein: The said Sequence No. 1 is: CATATGCAGGAATGGCTGACCTTCCAGAAAAAACACATCACCAACACCCGTGAAGTTGAATACGAAAACATCATGTCTACCAACCTGTTCCACTACAAAGAAAAAAACACCTTCATCTACTCTCGTCCGGAACCGGTTAAAGCTATCCTGAAAGGTATCATCGCTTCTAAAAACGTTCTGACCACCTCTGAATTCTACCTGTCTGAATACAACGTTACCTCTCGTCCGTACAAATACAAACTGAAAAAATCTACCAACAAATTCATCGTTACCATCGAAAACCAGGCTCCGGTTCACTTCGTTGGTGTTGGTTCTCACCACCACCACCACCACGGTACCGGTGACCCGGGTAAATACGGTTTCTACACCCACGTTTTCCGTCTGAAAAAATGGATCCAGAAAGTTATCTAAGCTT。 3. A method for expressing and purifying a fusion antibacterial peptide as described in any one of claims 1-2, characterized in that: It includes the following steps: B1. Transform the expression vector into BL21(DE3), coat it on a plate for culture, pick a single colony for culture, and after successful plasmid extraction and sequencing, it is a recombinant strain of the fusion antibacterial peptide; B2. Expand the culture of the recombinant strain of the fusion antibacterial peptide until OD600 reaches 0.8 - 1.0, add IPTG with a final concentration of 0.1 - 1 mM for induction expression for 12 - 18 h; B3. Place the E. coli bacterial solution expressing the antibacterial peptide in a stirred tank, add lysozyme for cell lysis, filter through a hollow fiber microfiltration column to remove cell debris and part of the water, retain the inclusion bodies, wash the soluble proteins on the surface of the inclusion bodies with a washing solution until the conductivity < 500 μs / cm, and leave the inclusion body solution; B4. Dissolve the inclusion body solution in a mixed solution of the same volume of 16 mol / L urea and 100 mM PB with a pH of 7.6, filter through a hollow fiber microfiltration column, and then use a cation exchange resin chromatography column equilibrated with a mixed solution of urea and PB. Load the inclusion body solution onto the chromatography column, and then elute the bound antibacterial peptide protein with an eluent and collect the target protein; B5. The target protein is used to remove inorganic salts such as urea, sodium chloride, and phosphate through hollow fiber ultrafiltration, and the antibacterial peptide protein is washed with deionized water until the conductivity ≤ 100 μs / cm, and the antibacterial peptide solution is acidified. B6. The acidified antibacterial peptide solution is used to remove impurities through a hollow fiber ultrafiltration column until the conductivity ≤ 10 μs / cm, and then the antibacterial peptide solution is concentrated to 1 - 10 g / L and collected for storage.

4. The expression and purification method of a fusion antibacterial peptide according to claim 3, characterized in that: The washing solution described in step B3 is 90 - 110 mM NaCl, 1.9 - 2.1 mol / L urea, and 1.9 - 2.1% Triton X - 100, with the balance being deionized water; the mass ratio of the Escherichia coli bacterial solution, lysozyme, and the washing solution is 1:0.0002 - 0.0005:0.33 - 0.

5.

5. A method for expressing and purifying a fusion antibacterial peptide according to claim 3, characterized in that: The eluent described in step B4 is 0.5 mol / L NaCl, 8 mol / L urea, 50 mM PB with a pH of 7.6, and the balance is deionized water.

6. The expression and purification method of a fusion antibacterial peptide according to claim 3, characterized in that: The acidification described in step B5 is as follows: acetic acid is added to a concentration of 0.1 M, the pH of the antibacterial peptide solution is adjusted to 1.8 - 2.2 with 0.1 M hydrochloric acid, then the temperature is raised to 58 - 62 °C, stirred and incubated for 22 - 26 h, and then the pH of the antibacterial peptide solution is adjusted to 6.5 - 7.5 with ammonia water, cooled to 26 - 30 °C, and stirred and incubated for 14 - 18 h.

7. A purification device for a fusion antibacterial peptide according to any one of claims 3-6, characterized in that: It includes a stirring tank, a thermometer, a conductivity meter, a hollow fiber ultrafiltration column, a hollow fiber microfiltration column, a cation exchange resin chromatography column, a jacket, and an ultraviolet detector; the functions of the device include bacterial cell lysis and inclusion body washing, inclusion body dissolution and filtration, inclusion body protein cation exchange chromatography purification, and inclusion body protein urea removal and acidification.

8. The purification device for a fusion antibacterial peptide according to claim 7, characterized in that: All components of the device are detachable, facilitating maintenance, replacement, cleaning, and disinfection.

9. The purification device of a fusion antibacterial peptide according to claim 7, characterized in that: The device has a conductivity meter, and the purification quality can be judged by monitoring the conductivity.

10. A purification device for a fusion antibacterial peptide according to claim 1, characterized in that: The device has a cleaning pipeline, which can flush the pipeline, the hollow fiber microfiltration column, the hollow fiber ultrafiltration column, and all components.

Images