A kit for genotyping of bordetella pertussis and a detection method thereof

Abstract

The present application relates to a kind of Bordetella pertussis genotyping detection kit and its detection method, the kit includes: the primer pair and probe for prn gene typing, for prn150 / prn1 / 2 typing detection;The primer pair and probe for ptxC gene typing, for ptxC4 / ptxC1 typing detection;The primer pair and probe for fhaB gene typing, for fhaB1 / fhaB3 typing detection.The kit of the present application has the advantages of good sensitivity, high specificity, accurate and reliable, fast and convenient, etc., suitable for Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, ptxC4 / ptxC1 type genotype typing detection The popularization and application has wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a genotyping kit for Bordetella pertussis and its detection method. Background Technology

[0002] Bordetella pertussis (Bp) is the pathogen that causes pertussis, a disease characterized by paroxysmal spasmodic cough, inspiratory wheezing, and a prolonged course. In infants and young children, it can lead to serious complications (such as pneumonia and encephalopathy) and even death. Although vaccination has significantly reduced the global incidence of pertussis, the number of reported cases in many countries has been rising in recent years, partly due to the decline in vaccine efficacy caused by pathogen antigenic variation and the prolonged insidious transmission chain caused by asymptomatic infection in adults and adolescents. Therefore, accurate detection and molecular epidemiological studies of Bordetella pertussis are of great significance for clinical diagnosis and public health control.

[0003] Currently, laboratory detection of Bordetella pertussis mainly relies on methods such as bacterial culture, serological testing, real-time fluorescence PCR, and whole-genome sequencing. However, most methods focus on qualitative pathogen detection and cannot reveal the genetic diversity of strains; the balance between high-throughput typing and cost-effectiveness is difficult to achieve, thus limiting large-scale epidemiological studies.

[0004] Therefore, establishing a Bordetella pertussis genotyping detection system applicable to clinical and public health scenarios is a key technological requirement for addressing the current challenges of pertussis prevention and control, and will provide core tool support for curbing disease resurgence and ensuring the long-term effectiveness of vaccines. Summary of the Invention

[0005] To address the above technical problems, this invention provides a Bordetella pertussis genotyping detection kit and its detection method, which has advantages such as high sensitivity, high specificity, accuracy, reliability, speed, and convenience. It is suitable for the widespread application of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotyping detection and has broad application prospects.

[0006] In a first aspect, the present invention provides a *Bordetella pertussis* genotyping kit, the kit comprising: primer pairs and probes for *prn* genotyping, used for genotyping of *prn150* / *prn1 / 2*; primer pairs and probes for *ptxC* genotyping, used for genotyping of *ptxC4* / *ptxC1*; and primer pairs and probes for *fhaB* genotyping, used for genotyping of *fhaB1* / *fhaB3*. The genotyping of *prn150* / *prn1 / 2* refers to distinguishing between *prn150* and *prn1 / 2*.

[0007] In this invention, the pertussis adhesin encoded by the prn gene is an important virulence factor of Bordetella pertussis; the ptxC gene is closely related to the production and regulation of pertussis toxin; and the filamentous hemagglutinin encoded by the fhaB gene is one of the main adhesion factors of Bordetella pertussis. The genotypes of these three genes are closely related to the pathogenicity of the bacteria and their ability to evade vaccines. Therefore, genotyping of the prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genes of Bordetella pertussis is of great significance in epidemiological studies of pertussis, vaccine efficacy evaluation, and the formulation of disease control strategies.

[0008] In some embodiments of the present invention, the primer pairs and probes for prn gene typing include: an upstream primer prn150-F with the nucleotide sequence shown in SEQ ID NO.1, a downstream primer prn150-R with the nucleotide sequence shown in SEQ ID NO.2, and a probe prn150-P with the nucleotide sequence shown in SEQ ID NO.3; the primer pairs and probes for ptxC gene typing include: an upstream primer ptxC4-F with the nucleotide sequence shown in SEQ ID NO.4, a downstream primer ptxC4-R with the nucleotide sequence shown in SEQ ID NO.5, and a probe ptxC4-P with the nucleotide sequence shown in SEQ ID NO.6; the primer pairs and probes for fhaB gene typing include: an upstream primer fhaB1-F with the nucleotide sequence shown in SEQ ID NO.7, a downstream primer fhaB1-R with the nucleotide sequence shown in SEQ ID NO.8, and a probe fhaB1-P with the nucleotide sequence shown in SEQ ID NO.9.

[0009] In some preferred embodiments of the present invention, the specific sequences and serial numbers of the primers and probes are as follows: prn150-F: GGTCCAACGCAGCGCT (SEQ ID NO.1);

[0010] prn150-R: GTCTTCCGGCTGCAATGAC (SEQ ID NO.2);

[0011] prn150-P: 5'-Fluorescent reporter group-GCTTGCATATCGGCGCCCTG-Fluorescent quencher group-3' (SEQ ID NO. 3);

[0012] ptxC4-F: CCGGCAGCGTCGATATGT (SEQ ID NO.4);

[0013] ptxC4-R:CATTCGCGGTATCCGTCAAG (SEQ ID NO.5);

[0014] ptxC4-P: 5'-Fluorescent reporter group-GCTCGGATCTGTTCGCCTGTCCA-Fluorescent quencher group-3' (SEQ ID NO. 6);

[0015] fhaB1-F: CAGCTTGTTGAGCAAGGCAAAGG (SEQ ID NO.7);

[0016] fhaB1-R:AAGCAGGCCATCGTCGTC (SEQ ID NO. 8);

[0017] fhaB1-P: 5'-Fluorescent reporter group-CGAAGCGAACGCGCTGCT-Fluorescent quencher group-3' (SEQ ID NO. 9).

[0018] In some preferred embodiments of the present invention, each of the probes comprises a fluorescent reporter group and a fluorescent quencher group, wherein the fluorescent reporter group is selected from: FAM, Cy3, Cy5, VIC, HEX, JOE, TAMRA, ROX, TET, NED, or combinations thereof; and / or the fluorescent quencher group is selected from: MGB, BHQ1, BHQ2, BHQ3, TAMRA, or combinations thereof.

[0019] In some preferred embodiments of the present invention, the fluorescent reporter group of the probe prn150-P is FAM and the fluorescent quencher group is BHQ; the fluorescent reporter group of the probe ptxC4-P is VIC and the fluorescent quencher group is BHQ; and the fluorescent reporter group of the probe haB1-P is ROX and the fluorescent quencher group is BHQ.

[0020] In some preferred embodiments of the present invention, the concentration of each primer is 0.2-0.3 mM, and the concentration of each probe is 0.1-0.2 mM.

[0021] In some embodiments of the present invention, the kit further includes internal control primers and probes: an upstream primer IC-F with a nucleotide sequence as shown in SEQ ID NO. 10, a downstream primer IC-R with a nucleotide sequence as shown in SEQ ID NO. 11, and a probe IC-P with a nucleotide sequence as shown in SEQ ID NO. 12.

[0022] In some preferred embodiments of the present invention, the specific sequences and serial numbers of the primers and probes are as follows: IC-F: TGCGGAAAATGCTTTACCTGA (SEQ ID NO.10);

[0023] IC-R: CGTAAGTCTCGAACGTTGCGT (SEQ ID NO. 11);

[0024] IC-P: 5'-Fluorescent reporter group-CGTCCATGTCAGCAAGGAAGAAC-Fluorescent quencher group-3' (SEQ ID NO. 12).

[0025] In some preferred embodiments of the present invention, the fluorescent reporter group of the probe IC-P is CY5, and the fluorescent quencher group is BHQ.

[0026] In some preferred embodiments of the present invention, the concentration ratio of each primer and probe in the reaction solution is: SEQ ID NO.1: SEQ ID NO.2: SEQ ID NO.3: SEQ ID NO.4: SEQ ID NO.5: SEQ ID NO.6: SEQ ID NO.7: SEQ ID NO.8: SEQ ID NO.9: SEQ ID NO.10: SEQ ID NO.11: SEQ ID NO.12 = 200nM: 200nM: 100nM: 200nM: 200nM: 100nM: 200nM: 200nM: 100nM.

[0027] In some embodiments of the present invention, the prn150 target gene fragment sequence is SEQ ID NO. 13; the ptxC4 target gene fragment sequence is SEQ ID NO. 14; and the fhaB1 target gene fragment sequence is SEQ ID NO. 15.

[0028] In this invention, the target gene fragment sequence of prn150 is as follows:

[0029] CAATGTCACGGTCCAACGCAGCGCTATCGTCGACGGGGGCTTGCATATCGGCGCCCTGCAGTCATTGCAGCCGGAAGAC (SEQ ID NO. 13);

[0030] The target gene fragment sequence for ptxC4 is as follows:

[0031] CCCGGCAGCGTCGATATGTTGAGCCGCCGGCTCGGATCTGTTCGCCTGTCCATGTTTTTCCTTGACGGATAACCGCGAATG (SEQ ID NO. 14);

[0032] The target gene fragment sequence for fhaB1 type is:

[0033] CAGCTTGTTGAGCAAGGCAACGGCCGCCGTCAGCCGGGCGTTGCCGCCCGCCTCGATCAGCGCGGCCCGTTTATTGGTGATGTTCTGCGCCTTGACGGTCAGCTCCCCGGCGGCCCACAGCAGCGCGTTCGCTTCGTTGGCCACGTTGCCGTGCGCCGAACTCAGCGTCAGGTCCTTGCCGACGACGATGGCCTGCTT (SEQ ID NO. 15);

[0034] The target gene fragment sequence for the internal reference type is as follows:

[0035] TGCGGAAAATGCTTTACCTGATCTACGTGGCCGGCATCTCCGTACGCGTCCATGTCAGCAAGGAAGAACAGTATTACGACTATGAGGACGCAACGTTCGAGACTTACG (SEQ ID NO. 16).

[0036] In this invention, primer pairs and probes for prn gene typing, primer pairs and probes for ptxC gene typing, and primers and internal reference primers and probes for fhaB gene typing are designed and prepared based on the above-mentioned prn150 type target gene fragment, ptxC4 type target gene fragment, fhaB1 type target gene fragment, and internal reference type target gene fragment, respectively.

[0037] In some embodiments of the present invention, the kit further includes a reaction solution, an enzyme mixture, a positive control, and a blank control.

[0038] In some embodiments of the present invention, the kit includes: a reaction solution, a detection solution, an enzyme mixture, a positive control, and a blank control;

[0039] The detection solution contains: amplification primers prn150-F, prn150-R and probe prn150-P for Bordetella pertussis prn150; amplification primers ptxC4-F, ptxC4-R and probe ptxC4-P for Bordetella pertussis ptxC4; amplification primers fhaB1-F, fhaB1-R and probe fhaB1-P for Bordetella pertussis fhaB1; and internal control primers IC-F, IC-R and probe IC-P for Bordetella pertussis.

[0040] In some preferred embodiments of the present invention, the reaction solution comprises 5×PCR buffer, 40-60 mM MgCl2, and 0.4-0.6 mM dNTP.

[0041] In some preferred embodiments of the present invention, the positive control is: a specific amplified fragment of Bordetella pertussis prn150, fhaB1, ptxC4 morphology ligated to a pUC57 plasmid vector, and an amplified fragment of Bordetella pertussis internal reference gene ligated to another pUC57 plasmid vector, the two plasmids being diluted to 10 with sterile purified water. 6 The two diluted plasmids were then mixed in equal volumes at a ratio of copies / mL.

[0042] In some preferred embodiments of the present invention, the enzyme mixture comprises hot-start Taq enzyme and DNA UDG enzyme. Preferably, the hot-start Taq enzyme and DNA UDG enzyme are each 5 U / μl.

[0043] In some preferred embodiments of the present invention, the blank control is sterile purified water.

[0044] A second aspect of the present invention provides a method for detecting the prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotyping of Bordetella pertussis DNA samples using the above-mentioned kit, comprising the following steps:

[0045] S1. Sample preparation: Amplification of Bordetella pertussis DNA samples;

[0046] S2. Preparation and addition of PCR reaction system: Add 15 μl of reaction solution, 4 μl of detection solution, 1 μl of enzyme mixture and 5 μl of DNA sample to be tested to a total volume of 25 μl of fluorescent PCR amplification system.

[0047] S3. Place the PCR reaction tube into a fluorescence PCR amplification instrument for amplification and detection.

[0048] In some embodiments of the present invention, in step S3, the cycling parameters for the amplification detection are set as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 61°C annealing and extension for 30 s, for 45 cycles.

[0049] In some embodiments of the present invention, using Bordetella pertussis DNA solution as a template, and simultaneously using positive control and blank control, the Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, ptxC4 / ptxC1 genotyping detection kit of the present invention is used for fluorescence quantitative PCR detection; after the reaction, the baseline and threshold line are adjusted, and the result is determined by the Ct value of the sample.

[0050] In this invention, the detection principle of the kit is based on ARMS-qPCR. ARMS-qPCR, or Quantitative Real-time PCR (qPCR) based on the Amplification Refractory Mutation System (ARMS), is a highly specific method for detecting gene mutations. The following is a detailed description of its working principle and implementation process:

[0051] (1) The basic principle of ARMS-qPCR is to achieve specific amplification by utilizing the complementarity between the 3' end bases of the primer and the template DNA. When the 3' end bases of the primer are completely complementary to the template DNA, the primer can extend normally and form DNA amplification products. However, if the 3' end bases of the primer are not complementary to the template DNA, i.e., there is a mismatch, then the primer extension will be inhibited or even terminated completely.

[0052] (2) In ARMS-qPCR, primers and probes are designed for mutant (MT) template DNA, with the last 3' base of the upstream primer set to the corresponding mutant base. Therefore, during PCR amplification, only primers that perfectly match the template DNA can perform effective amplification, thereby enabling the detection of specific gene mutations. To facilitate the differentiation between mutant and wild-type amplification curves, an additional set of universal primers and probes is usually designed as an internal control primer set. The difference between the detection Ct and the internal control Ct is used to determine the specific genotype of the sample.

[0053] (3) In addition, real-time quantitative PCR technology adds fluorescent dyes or fluorescently labeled probes to the PCR reaction system to monitor the changes in fluorescence signals during PCR amplification in real time, thereby achieving quantitative analysis of DNA amplification products.

[0054] In this invention, the implementation process of ARMS-qPCR typically includes the following steps:

[0055] (1) Sample preparation: Extract DNA from the sample to be tested as a template for PCR amplification. This usually involves steps such as cell lysis, DNA extraction and purification.

[0056] (2) Primer design: Based on the known mutation sites of the target gene, specific primers are designed for the mutant template DNA. Primer design needs to follow certain principles, such as primer length, GC content, annealing temperature, etc., to ensure primer specificity and amplification efficiency.

[0057] (3) Preparation of PCR reaction system: Mix the extracted DNA template, designed primers, dNTPs, DNA polymerase, reaction buffer and fluorescent dye or fluorescently labeled probe to prepare the PCR reaction system.

[0058] (4) PCR amplification: The PCR reaction system is placed on a PCR instrument for amplification. During the amplification process, DNA amplification is achieved by controlling temperature cycling (denaturation, annealing, extension). At the same time, changes in fluorescence signal are monitored in real time to obtain the kinetic curve of PCR amplification.

[0059] (5) Results analysis: The specific genotype of the test sample was determined based on the kinetic curve of PCR amplification.

[0060] The technical solution of the present invention has the following advantages compared with the prior art:

[0061] (1) This invention designs specific amplification primers and probes targeting the sequences containing the differential bases of three genotypes of Bordetella pertussis: prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1. The primer and probe sequences are original and uniquely designed, with good specificity and high sensitivity, enabling efficient and accurate detection of Bordetella pertussis DNA of prn150, fhaB1, and ptxC4 types. However, the detection efficiency for Bordetella pertussis of prn1, fhaB3, and ptxC1 types is extremely low. By comparing with the internal reference Ct value, the genotyping detection of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 can be achieved.

[0062] (2) This invention is a single-tube quadruple PCR detection reagent, which realizes the typing detection of three sites of Bordetella pertussis in a single tube. The results are accurate and easy to use.

[0063] In summary, this invention introduces an internal control for *Bordetella pertussis* and specific primers and probes for the prn150 / fhaB1 / ptxC4 genotype. The quadruple primer-probe set exhibits high amplification efficiency and exhibits no interference between them, enabling single-tube genotyping of *Bordetella pertussis* DNA of the prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotypes. This invention is not only the first publicly disclosed real-time quantitative PCR method for genotyping *Bordetella pertussis* prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotypes, but also possesses advantages such as high sensitivity, high specificity, accuracy, reliability, speed, and convenience, thereby achieving rapid genotyping of *Bordetella pertussis* DNA for the prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotypes. Attached Figure Description

[0064] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein...

[0065] Figure 1 The concentration of 10 in Example 2 of this invention 8 Results of DNA detection for Bordetella pertussis prnn1 (copies / mL);

[0066] Figure 2 The concentration of 10 in Example 2 of this invention 6 Results of DNA detection for Bordetella pertussis prnn1 (copies / mL);

[0067] Figure 3 The concentration of 10 in Example 2 of this invention 4 Results of DNA detection for Bordetella pertussis prnn1 (copies / mL);

[0068] Figure 4 The concentration of 10 in Example 2 of this invention 8 Results of DNA detection for Bordetella pertussis prn150 (copies / mL);

[0069] Figure 5 The concentration of 10 in Example 2 of this invention 6 Results of DNA detection for Bordetella pertussis prn150 (copies / mL);

[0070] Figure 6 The concentration of 10 in Example 2 of this invention 4 Results of DNA detection for Bordetella pertussis prn150 (copies / mL);

[0071] Figure 7 The concentration of 10 in Example 2 of this invention 8 Results of PtxC1 Bordetella pertussis DNA detection (copies / mL);

[0072] Figure 8 The concentration of 10 in Example 2 of this invention 6 Results of PtxC1 Bordetella pertussis DNA detection (copies / mL);

[0073] Figure 9 The concentration of 10 in Example 2 of this invention 4 Results of PtxC1 Bordetella pertussis DNA detection (copies / mL);

[0074] Figure 10 The concentration of 10 in Example 2 of this invention 8Results of PtxC4 Bordetella pertussis DNA detection (copies / mL);

[0075] Figure 11 The concentration of 10 in Example 2 of this invention 6 Results of PtxC4 Bordetella pertussis DNA detection (copies / mL);

[0076] Figure 12 The concentration of 10 in Example 2 of this invention 4 Results of PtxC4 Bordetella pertussis DNA detection (copies / mL);

[0077] Figure 13 The concentration of 10 in Example 2 of this invention 8 Results of DNA detection for Bordetella pertussis fhaB3 type 3;

[0078] Figure 14 The concentration of 10 in Example 2 of this invention 6 Results of DNA detection for Bordetella pertussis fhaB3 type 3;

[0079] Figure 15 The concentration of 10 in Example 2 of this invention 4 Results of DNA detection for Bordetella pertussis fhaB3 type 3;

[0080] Figure 16 The concentration of 10 in Example 2 of this invention 8 Results of DNA detection for Bordetella pertussis type fhaB1 (copies / mL);

[0081] Figure 17 The concentration of 10 in Example 2 of this invention 6 Results of DNA detection for Bordetella pertussis type fhaB1 (copies / mL);

[0082] Figure 18 The concentration of 10 in Example 2 of this invention 4 Results of DNA detection for Bordetella pertussis type fhaB1 (copies / mL). Detailed Implementation

[0083] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0084] Example 1: A kit for detecting Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 genotyping.

[0085] This embodiment describes the preparation of a genotyping kit for Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1. The kit includes: reaction solution, detection solution, enzyme mixture, positive control, and blank control. Wherein:

[0086] (1) The reaction solution contains: 5×PCR buffer, 50mM MgCl2, and 0.5mM dNTP.

[0087] (2) The positive control consisted of: specific amplified fragments of Bordetella pertussis prn150, fhaB1, and ptxC4 morphologies ligated into a pUC57 plasmid vector; and an amplified fragment of the Bordetella pertussis internal reference gene ligated into a pUC57 plasmid vector. Both plasmids were purified with sterile water for 10... 6 The plasmids were diluted 1-2 times, and then equal volumes of the two diluted plasmids were mixed as the final positive control.

[0088] (3) The PCR enzyme mixture includes 5 U / μl hot-start Taq enzyme and 5 U / μl DNA UDG enzyme.

[0089] (4) The detection solution contains: amplification primers prn150-F, prn150-R and probe prn150-P for Bordetella pertussis prn150; amplification primers ptxC4-F, ptxC4-R and probe ptxC4-P for Bordetella pertussis ptxC4; amplification primers fhaB1-F, fhaB1-R and probe fhaB1-P for Bordetella pertussis fhaB1; and internal control primers IC-F, IC-R and probe IC-P for Bordetella pertussis. Furthermore, the concentration of each primer is 0.2 mM, and the concentration of each probe is 0.1 mM. The 5' end of probe prn150-P is labeled with the reporter fluorescent dye FAM, and the 3' end with the quencher fluorescent dye BHQ; the 5' end of probe ptxC4-P is labeled with the reporter fluorescent dye VIC, and the 3' end with the quencher fluorescent dye BHQ; the 5' end of probe fhaB1-P is labeled with the reporter fluorescent dye ROX, and the 3' end with the quencher fluorescent dye BHQ; the 5' end of probe IC-P is labeled with the reporter fluorescent dye CY5, and the 3' end with the quencher fluorescent dye BHQ. The primer and probe sequences are shown in Table 1.

[0090] Table 1. Primer and Probe List

[0091]

[0092] (5) The blank control standard is sterile purified water.

[0093] Bordetella pertussis is the pathogen of pertussis, and its genome contains several genes related to virulence, immune response, and epidemiological characteristics. Among these, the genotyping of prn (encoding pertussis adhesin), ptxC (encoding a regulatory gene for pertussis toxin), and fhaB (encoding a key gene for pertussis filamentous hemagglutinin) is of great significance in the research, diagnosis, treatment, and prevention of pertussis. The following is a detailed explanation of the significance of these three genotyping methods:

[0094] Significance of PRN genotyping: The PRN gene encodes pertussis adhesin, a crucial virulence factor of *Bordetella pertussis*, involved in the bacterial adhesion process to host cells. PRN genotyping allows for monitoring genetic variation and epidemiological trends in *Bordetella pertussis*, enabling the timely detection of new genotypes or variants. Current pertussis vaccines are largely designed based on certain antigens of *Bordetella pertussis*, including pertussis adhesin. PRN genotyping allows for assessing the sensitivity of different *Bordetella pertussis* genotypes to vaccines, thus understanding vaccine efficacy. Different *Bordetella pertussis* genotypes may exhibit varying susceptibility to antibiotics; PRN genotyping provides clinicians with a basis for selecting appropriate antibiotics, thereby improving treatment outcomes.

[0095] Significance of ptxC genotyping: The ptxC gene is part of the pertussis toxin regulatory gene and is closely related to the production and regulation of pertussis toxin. PtxC genotyping can provide insights into the regulatory mechanism of pertussis toxin, offering important clues for research into the pathogenesis of pertussis. Pertussis toxin is one of the important diagnostic markers for pertussis; ptxC genotyping can assist in the diagnosis of pertussis and monitor disease progression and severity.

[0096] Significance of fhaB genotyping: The fhaB gene encodes filamentous hemagglutinin, one of the main adhesion factors of *Bordetella pertussis*, which participates in the bacterial adhesion process to host cells. FhaB genotyping provides insights into the virulence and adhesion mechanism of *Bordetella pertussis*, offering crucial evidence for research into the pathogenesis of pertussis. Filamentous hemagglutinin is also an important antigen in pertussis vaccines. FhaB genotyping allows for the screening of antigens with better immunogenicity, guiding vaccine development and optimization, and improving vaccine protection. Different genotypes of *Bordetella pertussis* may differ in transmissibility and pathogenicity. FhaB genotyping can assess the transmission risk of pertussis and the effectiveness of control strategies, providing a basis for developing scientific prevention and control measures.

[0097] Research on Bordetella pertussis antigen genes is of great significance for vaccine development, virulence mechanism analysis, epidemiological surveillance, and assessment of vaccine escape. A deeper understanding of the variations and functions of these genes can provide a scientific basis for controlling pertussis. Currently, mainstream antigen gene research on Bordetella pertussis focuses on the following gene classes: PT-related genes (ptxA, ptxB, ptxC, ptxD, ptxE, ptxP), PRN genes (prn), fimbrial protein genes (fim2, fim3), and FHA genes (fhaB).

[0098] In the genotyping study of Bordetella pertussis samples from China, it was found that ptxA, ptxB, ptxD, ptxE, fim2, and fim3 were single genotypes without mutations. However, prn, ptxC, ptxP, and fhaB showed mutations in China. The prn genotypes in China are prn1, prn2, and prn150; ptxC is ptxC1 and ptxC4; and fhaB is fhaB1 and fhaB3. Based on this research, it can be concluded that the mutated pertussis antigen genes in China are ptxP, ptxC, fhaB, and prn. Since ptxP and ptxC are linked genes, only ptxC, fhaB, and prn need to be selected to develop a targeted genotyping kit for epidemiological studies of Bordetella pertussis in China.

[0099] In conclusion, genotyping of Bordetella pertussis' prn, ptxC, and fhaB genes is of great significance in the research, diagnosis, treatment, and prevention of pertussis. Genotyping of these genes not only helps to deepen our understanding of the pathogenesis of pertussis, assess vaccine efficacy, and guide treatment, but also provides important evidence for developing scientific prevention and control strategies.

[0100] Example 2: A method for genotyping detection of Bordetella pertussis prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1.

[0101] A method for genotyping detection of Bordetella pertussis prn150 / prn1, fhaB1 / fhaB3, and ptxC4 / ptxC1 using the kit from Example 1, includes the following experimental steps:

[0102] (1) Main reagents and instruments: The reagents in the kit in Example 1 were used; the real-time PCR instrument was the Shanghai Hongshi SLAN-96 real-time PCR instrument.

[0103] (2) Sample requirements: Use Bordetella pertussis DNA solution as template.

[0104] (3) PCR amplification and result interpretation:

[0105] A. Primer and probe design: Internal control primers and probes were designed based on the universal DNA sequence of Bordetella pertussis. Specific amplification primers and probes were designed based on the sequences containing the differentially expressed bases of the three genotypes prn150 / prn1 / 2, fhaB1 / fhaB3, and ptxC4 / ptxC1 to specifically detect Bordetella pertussis DNA of prn150, fhaB1, and ptxC4 types. The primers and probes are shown in Table 1.

[0106] B. Positive Controls: Specific amplified fragments of *Bordetella pertussis* prn150, fhaB1, and ptxC4 types were ligated into a pUC57 plasmid vector, and an amplified fragment of the *Bordetella pertussis* internal reference gene was ligated into a pUC57 plasmid vector. Both plasmids were purified with sterile water for 10... 6 The plasmids were diluted 1-2 times, and then equal volumes of the two diluted plasmids were mixed as the final positive control.

[0107] C. Blank control: The blank control is sterile purified water that does not contain any DNA fragments.

[0108] D. Detection and PCR: Add 15 μl of reaction solution, 4 μl of detection solution, 1 μl of enzyme mixture, and 5 μl of nucleic acid sample to a total volume of 25 μL of the real-time PCR amplification system. The PCR amplification conditions are: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 61℃ annealing and extension for 30 s, for 45 cycles. The real-time PCR amplification system is shown in Table 2 below, and the real-time PCR reaction conditions are shown in Table 3 below.

[0109] Table 2. PCR amplification system

[0110]

[0111] Table 3. PCR amplification program

[0112]

[0113] E. Data Processing: After the reaction is complete, adjust the Start, End and threshold values ​​of the FAM / VIC channel baselines according to the actual situation (the Start value is recommended to be set between 3-15, the End value is recommended to be set between 5-20, and the threshold values ​​of both channels are adjusted to 120). Click Analysis to obtain the analysis results and get the Ct values ​​of the FAM and VIC channels.

[0114] F. Validity judgment: Positive control and blank control must meet the standards in Table 4, otherwise the experimental results are considered invalid.

[0115] Table 4. Criteria for Judging Validity

[0116]

[0117] G. Result Interpretation: Interpret the results according to Table 5.

[0118] Table 5. Classification Interpretation Criteria

[0119]

[0120] (4) Experimental results:

[0121] A. Specific detection results of Bordetella pertussis prn1 nucleic acid samples: The prn1 Bordetella pertussis DNA sample was diluted to 10... 8 10 6 and 10 4 A diluted solution with a concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 1-3 The results show that the Ct difference between the FAM channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the FAM channel is not detected). According to the typing interpretation criteria in Table 5, for prn1 type Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing judgment through the Ct difference between the FAM channel and the CY5 channel.

[0122] B. Specificity detection results of Bordetella pertussis prn150 nucleic acid samples: The DNA samples of Bordetella pertussis prn150 were diluted to 10... 8 10 6 and 10 4 The concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 4-6 The results show that the Ct difference between the FAM channel and the VIC channel is always less than 8. According to the typing criteria in Table 5, for PRN150 Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing judgment through the Ct difference between the FAM channel and the CY5 channel.

[0123] C. Specific detection results of PtxC1 type Bordetella pertussis nucleic acid samples: PtxC1 type Bordetella pertussis DNA samples were diluted to 10... 8 106 and 10 4 A diluted solution with a concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 7-9 The results show that the Ct difference between the VIC channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the VIC channel is not detected). According to the typing interpretation criteria in Table 5, for PtxC1 type Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing judgment through the Ct difference between the VIC channel and the CY5 channel.

[0124] D. Specific detection results of PtxC4 type Bordetella pertussis nucleic acid samples: PtxC4 type Bordetella pertussis DNA samples were diluted to 10... 8 10 6 and 10 4 The concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 10-12 The results show that the Ct difference between the VIC channel and the CY5 channel is always less than 8. According to the typing criteria in Table 5, for PtxC4 Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing judgment through the Ct difference between the VIC channel and the CY5 channel.

[0125] E. Specificity of *Bordetella pertussis* fhaB3 nucleic acid samples for typing: *Bordetella pertussis* fhaB3 DNA samples were diluted to 10... 8 10 6 and 10 4 A diluted solution with a concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 13-15 The results show that the Ct difference between the ROX channel and the CY5 channel is always greater than 8 (or the Ct value of the CY5 channel is less than 35 while the Ct value of the VIC channel is not detected). According to the typing interpretation criteria in Table 5, for fhaB3 type Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing judgment through the Ct difference between the ROX channel and the CY5 channel.

[0126] F. Specific detection results of *Bordetella pertussis* fhaB1 genotype nucleic acid samples: *Bordetella pertussis* fhaB1 DNA samples were diluted to 10... 8 10 6 and 10 4 The concentration of copies / mL was used for genotyping detection using the fluorescent PCR method established in this invention. 10 8 10 6 and 10 4 The detection results for samples with a concentration of copies / mL are shown below. Figures 16-18 The results show that the Ct difference between the ROX channel and the VIC channel is consistently less than 8. According to the typing criteria in Table 5, for fhaB1 Bordetella pertussis DNA samples, the kit designed in this invention can make an accurate typing determination based on the Ct difference between the ROX channel and the CY5 channel.

[0127] G. Limit of detection and repeatability test results: The four plasmids prn150 / ptxC4 / fhaB1 / internal control were mixed to a final concentration of 10. 4 A plasmid mixture of copies / mL was prepared to simulate *Bortis pertussis* DNA of the prn150-ptxC4-fhaB1 genotype; the four plasmids prn1 / ptxC1 / fhaB3 / internal control were mixed to a final concentration of 10. 4 A plasmid mixture of copies / mL was used to simulate *Bordetella pertussis* DNA of the prn1-ptxC1-fhaB3 genus. The amplification system of this invention was used to repeatedly detect the above samples 20 times. The experimental results are shown in Table 6, indicating that the detection limit of this invention for the above two samples can reach 10. 4 copies / mL.

[0128] The CV value is the coefficient of variation, which is a statistical measure of the degree of variation of each observation value in the index. Fluorescent PCR platforms usually use the CV value of the CT value to measure the repeatability of the detection. The data in Table 6 show that in 20 repeated experiments with low concentration samples, the CV of each index is <3% (CV = CT standard deviation ÷ CT mean), indicating that the fluorescence PCR method established in this embodiment based on the present invention has good repeatability.

[0129] Table 6. Test results for the lowest detection limit

[0130]

[0131]

[0132] In summary, the detection results in this embodiment show that the method of the present invention has good sensitivity, high specificity, good repeatability, and accurate and reliable typing results.

[0133] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A genotyping kit for Bordetella pertussis, characterized in that, The kit includes: The primer pairs and probes for detecting the prn150 genotype include: the upstream primer prn150-F with the nucleotide sequence shown in SEQ ID NO.1, the downstream primer prn150-R with the nucleotide sequence shown in SEQ ID NO.2, and the probe prn150-P with the nucleotide sequence shown in SEQ ID NO.3; The primer pairs and probes for detecting the ptxC4 genotype include: the upstream primer ptxC4-F with the nucleotide sequence shown in SEQ ID NO.4, the downstream primer ptxC4-R with the nucleotide sequence shown in SEQ ID NO.5, and the probe ptxC4-P with the nucleotide sequence shown in SEQ ID NO.6; The primer pairs and probes for detecting the fhaB1 genotype include: upstream primer fhaB1-F with nucleotide sequence as shown in SEQ ID NO.7, downstream primer fhaB1-R with nucleotide sequence as shown in SEQ ID NO.8, and probe fhaB1-P with nucleotide sequence as shown in SEQ ID NO.

9.

2. The reagent kit according to claim 1, characterized in that, Each of the probes comprises a fluorescent reporter group and a fluorescent quencher group, wherein: The fluorescent reporter group of the probe prn150-P is FAM, and the fluorescent quencher group is BHQ. The fluorescent reporter group of the probe ptxC4-P is VIC, and the fluorescent quencher group is BHQ. The fluorescent reporter group of the probe haB1-P is ROX, and the fluorescent quencher group is BHQ.

3. The reagent kit according to claim 1, characterized in that, The concentration of each primer is 0.2-0.3 mM, and the concentration of each probe is 0.1-0.2 mM.

4. The reagent kit according to claim 1, characterized in that, The kit also includes internal control primers and probes: upstream primer IC-F with nucleotide sequence as shown in SEQ ID NO.10, downstream primer IC-R with nucleotide sequence as shown in SEQ ID NO.11, and probe IC-P with nucleotide sequence as shown in SEQ ID NO.

12.

5. The reagent kit according to claim 1, characterized in that, The target gene fragment sequence of prn150 is SEQ ID NO.13; the target gene fragment sequence of ptxC4 is SEQ ID NO.14; and the target gene fragment sequence of fhaB1 is SEQ ID NO.

15.

6. The reagent kit according to claim 1, characterized in that, The kit also includes a reaction solution, an enzyme mixture, a positive control, and a blank control.

7. The reagent kit according to claim 6, characterized in that, The reaction solution contains 5×PCR buffer, 40-60 mM MgCl2, 0.4-0.6 mM dNTPs; and / or The positive control consisted of: specific amplified fragments of Bordetella pertussis prn150, fhaB1, and ptxC4 morphologies ligated into a pUC57 plasmid vector; and an amplified fragment of the Bordetella pertussis internal reference gene ligated into another pUC57 plasmid vector. Both plasmids were diluted to 10⁻¹⁰ with sterile purified water. 6 copies / mL, then the two diluted plasmids are mixed in equal volumes to obtain the product; and / or The enzyme mixture includes hot-start Taq enzyme, DNA UDG enzyme; and / or The blank control was sterile purified water.

8. A detection method for a reagent kit as described in any one of claims 1-7, wherein the detection method is for non-disease diagnostic purposes, characterized in that, Includes the following steps: S1. Sample preparation: Amplification of Bordetella pertussis DNA samples; S2. Preparation and addition of PCR reaction system: Add reaction solution, detection solution, enzyme mixture and DNA sample to be tested to the fluorescent PCR amplification system respectively; S3. Place the PCR reaction tube into a fluorescence PCR amplification instrument for amplification and detection.

9. The detection method according to claim 8, characterized in that, In step S3, the cycling parameters for the amplification detection are set as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 61℃ annealing and extension for 30 s, for 45 cycles.

Images