Tyrosinase mutant with improved enzyme activity and thermal stability and application thereof

By mutation of the amino acid sequence of tyrosinase, especially the modification of positions 73, 106, 152 and 231, the problems of low catalytic efficiency and poor stability of tyrosinase are solved, and the enzyme activity and thermal stability are improved, and its application in industry and scientific research is promoted.

CN120384058APending Publication Date: 2025-07-29JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510416909.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The existing tyrosinase has low catalytic efficiency, poor stability to extreme environmental conditions, and insufficient substrate specificity, which limits its application in industrial production, environmental governance and medical treatment.

Method used

By mutating the amino acid sequence of tyrosinase, especially at positions 73, 106, 152 and 231, a series of mutants with improved enzyme activity and thermal stability were obtained, and they were highly expressed in E. coli.

Benefits of technology

It improves the catalytic efficiency and thermal stability of tyrosinase, enhances its catalytic effect in complex environments, and promotes its application in a wider range of fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384058A_ABST
    Figure CN120384058A_ABST
Patent Text Reader

Abstract

The invention discloses a tyrosinase mutant with improved enzyme activity and thermal stability and application thereof, and belongs to the technical field of biological enzymes. Tyrosinase capable of being efficiently expressed in escherichia coli is excavated, at least one amino acid in the 73rd site, the 106th site, the 152nd site and the 231st site is mutated, a series of mutants with improved enzyme activity are obtained, and the enzyme activity is remarkably improved compared with that of a wild type. The melanin prepared by applying the constructed tyrosinase mutant has a remarkable effect in the aspect of antioxidant application after being separated and purified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a tyrosinase mutant with improved enzyme activity and thermal stability and its application, belonging to the field of bioenzyme technology. Background Art

[0002] Tyrosinase (EC 1.14.18.1) is an enzyme with important biological functions and is widely present in animals, plants, and microorganisms. It participates in the oxidation reaction of tyrosine and catalyzes the conversion of tyrosine into L-DOPA and other important products. The synthesis of melanin by tyrosinase is a green synthesis method that uses an enzyme-catalyzed reaction to convert tyrosine or L-DOPA and other substrates into melanin. Compared with traditional chemical synthesis, the enzymatic method has the advantages of high efficiency, strong selectivity, mild reaction conditions, and environmental friendliness, and can complete the synthesis of melanin under the conditions of less chemical reagents and low by-products. This method not only improves the purity and quality of the product but also can regulate the properties of melanin according to needs. At present, the only commercial tyrosinase is mushroom tyrosinase extracted from Agaricus bisporus, which is expensive and has low selectivity. Therefore, finding a tyrosinase with higher catalytic efficiency, safety, and stability has become the key to the efficient preparation of melanin.

[0003] Currently, the defects of tyrosinase include low catalytic efficiency, poor stability under extreme environmental conditions (such as high temperature, low pH), insufficient substrate specificity, and limited reaction rate in some applications. These problems limit the wide application of tyrosinase in industrial production, environmental governance, and medical treatment. To address these defects, mutating and modifying tyrosinase to improve its activity and stability and optimize its reaction specificity is an effective way to enhance its application performance. This can not only enhance the catalytic effect of tyrosinase in various complex environments but also promote its application in a wider range of fields to meet the needs of industry and scientific research. The modification of tyrosinase mutants has important application potential and provides new possibilities for the development of related industries and technological innovation. Summary of the Invention

[0004] The present invention provides a tyrosinase mutant, based on the amino acid sequence shown in SEQ ID NO.3, one or more amino acids at positions 73, 106, 152, and 231 are mutated.

[0005] In one embodiment, the mutant is obtained by mutating glycine at position 73 to alanine based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named G73A.

[0006] In one embodiment, the mutant is obtained by mutating methionine at position 106 to aspartic acid based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named M106D.

[0007] In one embodiment, the mutant is obtained by mutating glutamine at position 152 to valine based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named Q152V.

[0008] In one embodiment, the mutant is obtained by mutating methionine at position 231 to proline based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named M231P.

[0009] In one embodiment, the mutant is obtained by mutating glycine at position 73 to alanine and mutating methionine at position 106 to aspartic acid based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named G73A / M106A.

[0010] In one embodiment, the mutant is obtained by mutating methionine at position 106 to aspartic acid, mutating glutamine at position 152 to valine, and mutating methionine at position 231 to proline based on the amino acid sequence shown in SEQ ID NO.3, and the obtained mutant is named M106D / Q152V / M231P.

[0011] The present invention also provides an enzyme preparation containing the tyrosinase mutant.

[0012] The present invention also provides a gene encoding the mutant.

[0013] The present invention also provides a recombinant plasmid, and the recombinant plasmid carries the gene.

[0014] The present invention also provides a recombinant microbial cell expressing the mutant or the gene.

[0015] In the present invention, the microbial cell includes Escherichia coli and Bacillus subtilis.

[0016] In the present invention, the Escherichia coli uses Escherichia coli BL21(DE3) as the host and uses pET-28a or pETDuet-1 or pACYCDuet-1 as the vector to express the tyrosinase mutant.

[0017] The present invention also provides a cell catalyst containing the recombinant microbial cell.

[0018] The present invention also provides a method for preparing the tyrosinase mutant.

[0019] In one embodiment, the method is to culture the recombinant microbial cells in LB medium and induce them with IPTG.

[0020] In one embodiment, the induction is to culture the recombinant microbial cells until the OD 600 is in the range of 0.6 to 0.8, and induce with IPTG at a final concentration of 0.1 - 1 mmol / L under the conditions of 16 - 25 °C and 100 - 300 r / min for 7 - 24 h.

[0021] In one embodiment, the method further includes cell disruption of the recombinant microbial cells.

[0022] The present invention also provides the application of the tyrosinase in the conversion of L - tyrosine into melanin as a substrate.

[0023] In one embodiment, the application is to use L - tyrosine as a substrate and the tyrosinase mutant as a catalyst to catalytically prepare melanin.

[0024] In one embodiment, the application is to use the tyrosinase mutant as a catalyst and L - tyrosine (0.5 - 3 mmol / L, pH = 6 - 8) dissolved in PB buffer as a substrate, and carry out the catalytic reaction at 25 - 37 °C. After the reaction is completed, the reaction solution is separated and purified to obtain melanin.

[0025] The present invention also provides the application of the tyrosinase mutant or the recombinant cell in the preparation of products containing melanin or hydroxytyramine.

[0026] Beneficial effects:

[0027] (1) The present invention has discovered a tyrosinase Nitrosospira sp. NSp2 (accession number WP_107692201.1) that can be highly expressed in Escherichia coli. This enzyme belongs to an intracellular enzyme and exhibits high activity after ultrasonic disruption, avoiding enzyme loss during the fermentation process, which is different from other reported tyrosinases.

[0028] (2) The present invention performs molecular modification on the tyrosinase derived from Nitrosospira sp. NSp2, mutates at least one amino acid at positions 73, 106, 152, and 231, and obtains a series of mutants with improved enzyme activity. The enzyme activities of single-point mutants G73A, M106D, Q152V, and M231P are increased by 37%, 42%, 31%, and 35% respectively compared with the wild-type enzyme activity of 2840 U / mg. The enzyme activities of double-point mutants G73A / M106D, G73A / Q152V, G73A / M231P, M106D / Q152V, M106D / M231P, and Q152V / M231P are increased by 19.5%, 10.5%, 3.6%, 13%, 8.2%, and 10% respectively compared with the enzyme activity of M106D. The enzyme activities of triple-point mutants G73A / M106D / Q152V, G73A / M106D / M231P, and M106D / Q152V / M231P are increased by 9%, 20.5%, and 37.9% respectively compared with the enzyme activity of M106D.

[0029] (3) The present invention performs molecular modification on the tyrosinase derived from Nitrosospira sp. NSp2, mutates at least one amino acid at positions 73, 106, 152, and 231, and obtains a series of mutants with improved thermal stability. The thermal stability test results show that after the mutant enzymes are incubated at 40 °C for 120 min in a phosphate buffer solution with a pH of 7.5, the specific enzyme activities of mutant enzymes M106D, G73A / M106D, and M106D / Q152V / M231P are increased by 17%, 35%, and 38% respectively compared with the wild-type.

[0030] (4) The melanin prepared by the enzymatic method of the present invention has a significant effect in antioxidant applications after separation and purification. Description of the Drawings

[0031] Figure 1 It is the construction map of the recombinant plasmid.

[0032] Figure 2 It is the SDS-PAGE diagram of the pure enzyme of the recombinant strain Sp2.

[0033] Figure 3 It is the diagram of the fermentation broth after the recombinant strain is induced for 24 h.

[0034] Figure 4 It is the diagram of the comparison of the enzyme activities of tyrosinases from different sources under different pH conditions.

[0035] Figure 5 It is the diagram of the comparison of the relative enzyme activities of the wild enzyme TYRSp2 and the mutant enzymes.

[0036] Figure 6Comparison of the scavenging abilities of melanin, anthocyanin, and carotenoid against DPPH free radicals. Specific implementation manners

[0037] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products or can be prepared by known methods.

[0038] Materials and reagents: The restriction endonucleases and the like used were all purchased from TaKaRa Biotechnology Company; the primers were purchased from Shanghai Sangon Biotech Co., Ltd.; the plasmid extraction kit, genomic extraction kit, agarose purification kit, E. coli DH5α, and E. coli BL21(DE3) strains were all purchased from Sangon Biotech (Shanghai) Co., Ltd.; other reagents were all analytical pure reagents purchased domestically or abroad.

[0039] The media involved in the following examples are as follows:

[0040] All media were prepared using ddH2O and sterilized at 121°C for 15 - 20 min after preparation.

[0041] LB liquid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L.

[0042] LB solid medium: Yeast extract 5.0 g / L, Tryptone 10.0 g / L, NaCl 10.0 g / L, Agar powder 15 g / L.

[0043] The buffers involved in the following examples are as follows:

[0044] Phosphate buffer (PB): 50 mmol / L, pH 7.5;

[0045] Binding Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.5;

[0046] Washing Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.5, 20 mmol / L imidazole;

[0047] Elution Buffer: 50 mmol / L PB, 500 mmol / L NaCl, pH 7.5, 500 mmol / L imidazole;

[0048] Dialysis buffer: 50 mmol / L PB, pH 7.5, 10 mmol / L EDTA.

[0049] Enzyme activity assay conditions: Prepare several reaction solutions of 2 mmol / L L-tyrosine (containing 0.2 mmol / L CuSO4 at the final concentration) using PB buffer at the pH value required for the experiment. Take a 96-well plate, add 140 μL of the reaction solution and 10 μL of the enzyme solution to be tested into each well, react at the corresponding temperature, and use a microplate reader to measure the change in absorbance at 475 nm after 10 min of reaction. Using L-tyrosine as the substrate, the enzyme activity required to generate 100 μmol / L dopachrome per minute on average, that is, an average increase of 0.1 in A 475 in absorbance per minute is defined as 1 U.

[0050] Thermal stability: Incubate the enzyme solution to be tested at 40 °C for 120 min respectively. Using their respective optimal reaction conditions as the reaction conditions for activity determination, continuously shake the reaction, measure the enzyme activity and plot the remaining enzyme activity curve, and define the relative enzyme activity at the zero time point as 100%.

[0051] Example 1: Screening of tyrosinase

[0052] Select the reported protein sequence with high tyrosinase activity from Priestia megaterium (sequence number: ACC86108.1) as the template, and search for possible sequences based on the Basic Local Alignment Search Tool (BLAST). Obtain possible sequences from the UniProt (https: / / www.uniprot.org) database. Select amino acid lengths between 200 and 500 for further analysis. Then use MEGAX software for sequence alignment and phylogenetic tree construction. Use the Muscle algorithm and the maximum likelihood tree for sequence alignment and phylogenetic analysis respectively. Finally, screen out the tyrosinase TyrSp2 from Nitrosospira sp. NSp2 (gene accession number: WP_107692201.1).

[0053] Example 2: Construction, expression and purification of tyrosinase recombinant plasmid

[0054] Synthesize the coding gene sequences of tyrosinase TyrSp2 from Nitrosospira sp. NSp2 and tyrosinase TyrBm from Priestia megaterium through GenScript (as shown in SEQ ID NO.1 and SEQ ID NO.2 respectively).

[0055] The specific steps are as follows:

[0056] (1) Construct the gene fragment with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2 between any suitable restriction enzyme sites of the plasmid vector pETDuet-1 to obtain a recombinant plasmid, named pETDuet-1-Sp2 (as Figure 1 ), pETDuet-1-Bm. Transfer the constructed plasmids into BL21(DE3) by chemical transformation.

[0057] (2) Pick the colonies of BL21(DE3) / pETDuet-1-Sp2 and BL21(DE3) / pETDuet-1-Bm prepared in the previous step into LB liquid medium containing 50 μg / mL ampicillin resistance. After culturing at 37 °C and 200 r / min for 12 h, transfer them to LB medium containing 50 μg / mL kanamycin and culture at 37 °C and 200 r / min until the OD 600 is in the range of 0.6 - 0.8. Add 1 mmol / L IPTG and induce for 24 h at 20 °C and 200 r / min, then collect the fermentation broth.

[0058] (3) Centrifuge the collected fermentation broth at 6000 r / min and 4 °C for 10 min, discard the supernatant, wash it twice with phosphate buffer, add 15 mL phosphate buffer to suspend the cells, and ultrasonically disrupt for 15 min (power 30%, disrupt for 1 s, intermittent for 2 s). Centrifuge at 4 °C and 8000 r / min for 10 min, collect the supernatant, which is the crude enzyme solution, and filter it through a 0.22 μm aqueous membrane. Pre-equilibrate the Ni 2+ -chelating sepharose resin column with Binding Buffer; add the crude enzyme solution and equilibrate it with Binding Buffer and Washing Buffer respectively; elute the enzyme with Elution Buffer and recover it; dialyze the recovered enzyme solution in dialysis buffer and store it in a 4 °C refrigerator. Use SDS to verify the purification effect and the enzyme molecular weight (SDS electrophoresis as Figure 2 ).

[0059] Since there is an L-tyrosine synthesis pathway in Escherichia coli itself, the strain expressing TyrBm will produce melanin during the induction expression process, resulting in the darkening of the color of the fermentation broth (as Figure 3 ), causing enzyme loss. While the fermentation broth of TyrSp2 always maintains its original color. This phenomenon indicates that TyrSp2 is an intracellular enzyme and will only be released into the fermentation broth after cell rupture. This characteristic can reduce the enzyme loss during fermentation.

[0060] Example 3: Construction and expression of mutant plasmids

[0061] Primers were designed based on the gene shown in SEQ ID NO.1, and site-directed mutagenesis was performed using the plasmid constructed in Example 2 as a template to construct a mutant plasmid (underlined bases are mutated bases):

[0062] G73A-F: TCTCCAG gca ATTGACCCGTCGGTATCGTTAC;

[0063] G73A-R: GGTCAAT tgc CTGGAGAGCGCGTTCGAACCGA;

[0064] M106D-F: TAACGGC gat GGTGGTAATCAACAGGTGACCAC;

[0065] M106D-R: TACCACC atc GCCGTTACCACCCATAAAGTCT;

[0066] Q152A-F: ACCCAA gcc GCAGTGAACGCGGCCAAATCGGT;

[0067] Q152A-R: TTCACTGC ggc TTGGGTCGGTAGCGAGCCCAT;

[0068] M231P-F: T cca TACCTCCCACCATCGGGCACCCCAGGCG;

[0069] M231P-R: ATGGTGGGAGGTA tgg ACGGCCCGGATTTTCAGT.

[0070] Site-directed mutagenesis was introduced using the above primers. The recombinant plasmid containing the mutation was transformed into BL21(DE3) according to the method of Example 2, and cultured and the fermentation broth was collected. BL21(DE3) / pETDuet-1-Sp2 constructed in Example 2 was used as a control. A reaction solution of 2 mmol / L L-tyrosine (containing 0.2 mmol / L CuSO4 at the final concentration) was prepared with phosphate buffer at pH 7.5. A 96-well plate was taken, 140 μL of the reaction solution and 10 μL of the enzyme solution to be tested were added to each well, and the reaction was carried out at 25 °C. The change in absorbance at 475 nm after 10 min of reaction was measured using a microplate reader. The results showed (as Figure 4) For the single-point mutants G73A, M106D, Q152V, and M231P, the enzyme activity increased from 2840 U / mg of the wild type to 3980 U / mg, 4033 U / mg, 3720 U / mg, and 3834 U / mg. For the double-point mutants G73A / M106D, G73A / Q152V, G73A / M231P, M106D / Q152V, M106D / M231P, and Q152V / M231P, the enzyme activity increased from 4033 U / mg of M106D to 4819 U / mg, 4456 U / mg, 4178 U / mg, 4557 U / mg, 4364 U / mg, and 4436 U / mg. For the triple-point mutants G73A / M106D / Q152V, G73A / M106D / M231P, and M106D / Q152V / M231P, the enzyme activity increased from that of M106D to 4396 U / mg, 4860 U / mg, and 5562 U / mg.

[0071] Example 4: Determination of Enzyme Activity at Different pH Values

[0072] After purifying and collecting the obtained wild-type TYR enzyme and mutant enzymes according to the method in Example 2, the protein concentration was measured using a BCA kit, and the protein was diluted to 0.1 mg / ml with phosphate buffer according to the measurement results. The substrate was a 2 mmol / L L-tyrosine solution with different pH values (containing 0.2 mmol / L CuSO4 at the final concentration), and the pH values were 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, and 9. The reactions were carried out at 37 °C for 10 min respectively. After the reaction, the reaction was terminated by boiling water bath for 10 min, and the absorbance value at 475 nm was measured.

[0073] As Figure 5 shown by the results, the wild type had the highest enzyme activity in the citrate buffer at pH 6.0 and the phosphate buffer at pH 7.5. Under the same pH conditions, the 50 mmol / L Tris-HCl buffer had an adverse effect on the catalysis of TyrSp2. Under extreme pH conditions (pH < 4.0 and pH > 9.0), the enzyme activities of TyrSp2 and TyrBm were both greatly affected. The specific enzyme activities of the wild type and the mutant enzymes M106D, G73A / M106D, and M106D / Q152V / M231P in the phosphate buffer at pH 7.5 were 2840 U / mg, 4033 U / mg, 4819 U / mg, and 5562 U / mg respectively, which were increased by 1.42 - 1.96 times.

[0074] Example 5: Determination of the Thermal Stability of Mutants

[0075] The enzyme solution to be measured was incubated at 40 °C for 120 min respectively. Using their respective optimal reaction conditions as the reaction conditions for activity measurement, the reaction was continuously oscillated, the enzyme activity was measured, and the remaining enzyme activity curve was plotted. The relative enzyme activity at the zero time point was defined as 100%.

[0076] After the tyrosinase mutants constructed in the present invention were incubated in a 40 °C water bath for 120 min, the single-point mutants G73A, M106D, Q152V, and M231P were increased by 5%, 17%, 12%, and 5% compared with the wild type. The double-point mutants G73A / M106D; G73A / Q152V; G73A / M231P; M106D / Q152V; M106D / M231P; Q152V / M231P were increased by 35%, 25%, 14%, 30%, 15%, and 32% respectively compared with the original enzyme activity. The triple-point mutants G73A / M106D / Q152V, G73A / M106D / M231P, and M106D / Q152V / M231P were increased by 20%, 35%, and 38% respectively compared with the original enzyme activity.

[0077] Example 6: Extraction of melanin prepared by enzymatic method

[0078] The supernatant after the reaction of the purified enzyme with the L-tyrosine substrate was collected. First, the pH value of the supernatant was adjusted from 7.5 to 4.5 with hydrochloric acid, and then it was pumped upward through the resin column. After the loading was completed, it was washed with distilled water until no dry matter was detected in the effluent, and the bound melanin was eluted with 3.5% ammonia water. The elution rate of melanin could reach 97%, and it was further concentrated by vacuum evaporation at 50–55 °C and 0.1 MPa pressure. Finally, it was freeze-dried by a freeze dryer.

[0079] The DPPH free radical scavenging ability of the prepared melanin was evaluated. The specific steps included: First, the sample pigment was formulated into a corresponding pigment solution. Then, the solution was mixed with a 0.1 mM DPPH solution, reacted for 30 minutes, and the absorbance change after the reaction was measured at 517 nm using an ultraviolet-visible spectrophotometer. By calculating the absorbance change, the DPPH free radical scavenging rate was obtained, and the antioxidant activity of melanin was evaluated according to the scavenging rate at different concentrations. As Figure 6As shown, at concentrations of 0.25 mg / L, 0.5 mg / L, 1 mg / L, 2 mg / L, and 4 mg / L, the DPPH scavenging rates reached 41%, 45%, 50%, 59%, and 80% respectively within 30 minutes. Specifically, due to its unique molecular structure and phenolic hydroxyl groups, melanin can more effectively neutralize DPPH radical oxidants and exhibit stronger antioxidant capacity. In contrast, the antioxidant effects of anthocyanins and carotenoids at 4 mg / L can only reach 74% and 72%. Especially under conditions of high concentration and long-term exposure, the antioxidant property of melanin is maintained more stably, indicating its stronger persistence and effectiveness in antioxidant protection.

[0080] Comparative Example 1:

[0081] According to the same strategy as in Examples 1 to 3, conservative sites R15K, M106R, M145G, and K158L were screened and recombinant plasmids pETDuet-1-Sp2-TRY carrying mutants R15K, M106R, M145G, and K158L were constructed respectively. R15K , pETDuet-1-Sp2-TRY M106R , pETDuet-1-Sp2-TRY M145G , pETDuet-1-Sp2-TRY K158L , and recombinant strains BL21(DE3) / pETDuet-1-Sp2-TRY R15K , BL21(DE3) / pETDuet-1-Sp2-TRY M106R , BL21(DE3) / pETDuet-1-Sp2-TRY M145G , BL21(DE3)pETDuet-1-Sp2-TRY K158L ; The recombinant strains were cultured according to the same method as in Example 2, and the enzyme activity was measured. Compared with the wild enzyme TYR, the relative enzyme activities of mutants R15K, M106R, M145G, and K158L were 84%, 11%, 72%, and 12% of the original enzyme respectively, indicating that these four mutants affect the enzyme structure and have a negative impact on enzyme activity.

[0082] Comparative Example 2:

[0083] The recombinant strains were cultured according to the same method as in Example 2, and the thermal stability was measured according to the same method as in Example 4. The results showed that after incubation at 40 °C for 120 min, compared with the wild enzyme without incubation treatment, the enzyme activities of mutants R15K, M106R, M145G, and K158L decreased by 20%, 15%, 8%, and 70% respectively, indicating that these four mutants affect the thermal stability of the enzyme.

[0084] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Anyone skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. A tyrosinase mutant, characterized in that, Based on the amino acid sequence shown in SEQ ID NO.3, one or more amino acids at positions 73, 106, 152, and 231 were mutated.

2. The tyrosinase mutant according to claim 1, wherein Based on the amino acid sequence shown in SEQ ID NO.3, glycine at position 73 was mutated to alanine, or methionine at position 106 was mutated to aspartic acid, or glutamine at position 152 was mutated to valine, or methionine at position 231 was mutated to proline.

3. The tyrosinase mutant according to claim 1, wherein Based on the amino acid sequence shown in SEQ ID NO.3, glycine at position 73 was mutated to alanine and methionine at position 106 was mutated to aspartic acid; or Based on the amino acid sequence shown in SEQ ID NO.3, methionine at position 106 was mutated to aspartic acid and glutamine at position 152 was mutated to valine.

4. A gene encoding the mutant according to any one of claims 1 to 3.

5. Recombinant plasmid, characterized in that, Carrying the gene according to claim 4.

6. A recombinant microbial cell expressing the mutant according to any one of claims 1 to 3.

7. Recombinant Escherichia coli, characterized in that, Using Escherichia coli BL21(DE3) as the host and pET-28a, pETDuet-1, or pACYCDuet-1 as the vector to express the tyrosinase mutant according to any one of claims 1 to 3.

8. A method for preparing the tyrosinase mutant according to any one of claims 1 to 3, characterized in that, Culturing the recombinant Escherichia coli according to claim 7 in LB medium and inducing with IPTG.

9. An enzyme preparation containing the tyrosinase mutant according to any one of claims 1 to 3, or a cell catalyst containing the recombinant microbial cell according to claim 6.

10. Use of the tyrosinase mutant according to any one of claims 1 to 3, or the recombinant microbial cell according to claim 6, or the recombinant Escherichia coli according to claim 7 in the preparation of melanin or hydroxytyrosol.