Preparation method and application of functional escherichia coli coated ascorbic acid for expressing laccase
By genetically engineered E. coli expressing laccase and coating ascorbic acid nanocoated, the problem of slow redox reaction rate on the cathode side of microbial fuel cell is solved, and efficient pollutant treatment and biopower generation effects are achieved.
Patent Information
- Application Number
- CN202510275069.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-07-29
AI Technical Summary
The cathode side oxidation and reduction reaction rate in existing microbial fuel cells is slow, limiting the pollutant degradation efficiency and biopower generation capacity.
E. coli is genetically engineered to express laccase, and an ascorbic acid nanocoated layer is synthesized in situ on its surface to form functionalized E. coli, which is used as an oxygen reduction electrocatalyst on the cathode of microbial fuel cell.
It significantly improves the oxygen reduction catalytic capacity and electron transfer efficiency of microbial fuel cells, enhances pollutant treatment and biopower generation performance, and complies with the principle of green environmental protection.
Smart Images
Figure CN120384088A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomaterial chemistry, and particularly relates to a preparation method and application of functionalized Escherichia coli expressing laccase coated with ascorbic acid. Background Art
[0002] With the acceleration of the urbanization process and the continuous growth of the population, the discharge of domestic sewage shows a significant upward trend. This domestic sewage containing a large amount of pollutants such as organic matters, pathogens, and heavy metals, if directly discharged without proper treatment, will pose a serious threat to the water body ecosystem and public health. Traditional sewage treatment methods, such as sewage fertilizer utilization and sanitary landfill, although play a certain role in alleviating environmental pressure, have limitations such as low resource utilization rate and high risk of secondary pollution. In this context, exploring innovative treatment strategies to convert pollutants in sewage into high-value-added products or clean energy not only conforms to the development concept of circular economy but also provides new ideas for achieving the dual goals of environmental governance and resource recovery. This sustainable sewage treatment model based on resource recovery is expected to become an important development direction for future water pollution control.
[0003] To address this threat, microbial fuel cells (MFCs) are obviously a promising technical option because the biodegradation of glucose in them not only does not require external energy input but also can convert other environmentally unfriendly organic substances into low-carbon forms of biomass fuel for clean energy generation. So far, the main bottleneck faced by MFCs is on the cathode side, where its slow redox reaction rate limits the pollutant degradation efficiency and bioelectricity generation ability.
[0004] To overcome the above problems, we believe that directly using electroactive microbial cells that can self-reproduce and repair to design redox electrocatalysts is a more promising strategy because it can not only continuously produce redox proteins with electrocatalytic activity but also eliminate pollutants in water. Therefore, adopting modern genetic engineering and cell surface nanoengineering technologies is an effective strategy to modify cell characteristics and regulate cell electrocatalytic functions. Summary of the Invention
[0005] In view of the deficiencies of the prior art, the present invention provides a preparation method of a microbial catalyst with high catalytic efficiency and uses it in a microbial fuel cell. The constructed biohybrid material can effectively enhance the catalytic ability of oxygen reduction and then regulate its electrocatalytic activity and metabolic ability. It can significantly enhance the active sites of microorganisms in the microbial fuel cell, increase the electron transfer efficiency, and endow it with the dual functions of efficient bioelectricity generation and pollutant treatment.
[0006] To verify the effect of the strategy based on gene and nano co - engineering modification on the electrocatalytic performance of Escherichia coli cells, we first used genetic engineering methods to adjust the number of active proteins in the cells, and then used nano - engineering techniques to further modify the surface of Escherichia coli cells to improve their interfacial conductivity.
[0007] The present invention provides a microbial catalyst with high catalytic efficiency. This catalyst selects Escherichia coli BL21(DE3) and enables it to express laccase through genetic engineering methods. Then, it studies the chemical modification of recombinant Escherichia coli under mild conditions, and uses the in - situ synthesis method to coat the surface of recombinant Escherichia coli cells with an ascorbic acid nano - coating. Laccase is a multi - copper oxidase, and the copper ions it contains bind to polyphenols. The synthesized functionalized Escherichia coli grows on carbon cloth and is used as an oxygen reduction electrocatalytic material in microbial fuel cells.
[0008] The first object of the present invention is to provide a preparation method of a recombinant Escherichia coli expressing laccase coated with ascorbic acid electrocatalyst.
[0009] The second object of the present invention is to provide the application of the above - mentioned electrocatalyst in the preparation of the cathode of a microbial fuel cell.
[0010] In order to achieve the above - mentioned invention objects, the present invention provides the following technical solutions:
[0011] A preparation method of a recombinant Escherichia coli expressing laccase coated with ascorbic acid electrocatalyst, comprising the following steps:
[0012] S1. According to the full - length cDNA sequence of the laccase gene, integrate the cotA target gene into a vector and construct a recombinant expression plasmid, wherein the primer sequences of the cotA target gene are shown as SEQ ID NO: 1 and SEQ ID NO: 2 respectively;
[0013] SEQ ID NO: 1
[0014] CCGAATTCGAGCTCC GTCGAC ATGACACTTGAAAAATTTGTGGATG
[0015] SEQ ID NO: 2
[0016] GTGGTGGTGGTGGTGCTCGAGTTATTTATGGGGATCAGTTATATCCATC
[0017] The underlined part in the primer sequence SEQ ID NO: 1 represents the Sall restriction enzyme site, and the wavy - line part in the primer sequence SEQ ID NO: 2 represents the XhoI restriction enzyme site.
[0018] S2. introducing the recombinant expression plasmid into Escherichia coli to prepare functionalized recombinant Escherichia coli;
[0019] S3. The functionalized recombinant Escherichia coli is coated with ascorbic acid to obtain the product.
[0020] Preferably, the vector is pet-22b+.
[0021] Preferably, the Escherichia coli in step S2 is a biosafe Escherichia coli BL21 (DE3) starting strain.
[0022] Preferably, the introduction is performed using a transformation method in step S2, comprising the following steps:
[0023] S21. Add the recombinant expression plasmid to the competent cells, place them in an ice bath, take out the competent cells after ice bath, immediately place them in a 42°C constant temperature water bath for 90 seconds, and then place them in an ice bath again for 2-5 minutes;
[0024] S22. Resuscitate the LB liquid culture medium at 37°C and 200 rpm for 1 hour; then centrifuge at 6000 rpm for 4 minutes, remove part of the supernatant, and resuspend the remaining bacterial liquid;
[0025] S23. Spread the bacterial liquid containing E. coli onto a liquid containing 100 μg mL -1 The cells were grown on LB agar plates containing antibiotics at 37°C for 14 h to obtain functionalized Escherichia coli.
[0026] The present invention also claims protection for the ascorbic acid electrocatalyst coated with recombinant Escherichia coli expressing laccase prepared by the method.
[0027] Furthermore, the invention relates to the use of the electrocatalyst in preparing the cathode of a microbial fuel cell.
[0028] Furthermore, the recombinant Escherichia coli electrocatalyst expressing laccase was suspended in LB liquid culture medium, and then ascorbic acid was added, and the carbon cloth electrode was placed in the LB liquid culture medium and incubated with the recombinant Escherichia coli, finally obtaining a carbon cloth electrode, i.e., the cathode, to which a recombinant Escherichia coli electrocatalyst biofilm expressing laccase was attached.
[0029] As a specific treatment, the incubation process includes the following steps:
[0030] S1. Inoculate the functionalized E. coli into LB liquid medium containing ampicillin and culture in a shaking incubator at 37°C and 180 rpm for 12 to 16 hours.
[0031] S2. Inoculate it into the LB medium containing 50 μg / ml ampicillin at an inoculation amount of 2% - 3%, place it in a shaking incubator at 37°C, 180 rpm for 2 - 2.5 h. When OD = 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25°C, 180 rpm for 12 h. After balancing the cultured bacterial liquid, centrifuge it at 5000 rpn for 4 min, and then pour out the supernatant. Then add ascorbic acid and centrifuge again.
[0032] S3. Mix 50 ml of the LB solution containing antibiotics and the above - centrifuged bacterial liquid, add the treated carbon cloth, and shake for 24 - 27 h.
[0033] Preferably, the composition of the LB liquid medium is: 1 L of ultrapure water plus 10 g of peptone, 5 g of yeast and 10 g of sodium chloride are mixed.
[0034] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0035] The first is the advantage of the active site. The active center of laccase contains copper ions [Cu(II)]. Its binding domain is mainly composed of histidine (His), cysteine (Cys), methionine (Met), etc., and contains a trinuclear Cu center for reducing O2 and an isolated Cu(II) (type 1) adjacent to the substrate site. Among them, type 1 Cu(II) extracts electrons from the substrate and transfers them to the trinuclear Cu position, and laccase can use molecular oxygen as an electron acceptor to oxidize a variety of phenolic and non - phenolic compounds and increase the active sites in Escherichia coli other than cytochrome c. The second is the advantage of being green and environmentally friendly. When oxidizing the substrate, it has the advantages of substrate specificity, mild reaction conditions and being harmless to the environment. And it uses molecular oxygen in the air as an electron acceptor, only producing water as a by - product, which conforms to the principle of green environmental protection and speeds up the oxygen reduction ability of the microbial fuel cell. The third is the structural advantage. Through the synergistic effect of the copper ions contained in the laccase overexpressed in Escherichia coli and polyphenols, its electron transfer efficiency is increased, the oxygen reduction ability is enhanced, and thus the performance of the microbial fuel cell is enhanced. Description of the Drawings
[0036] Figure 1 It is the cyclic voltammetry test chart of the functionalized Escherichia coli expressing laccase coated with ascorbic acid as a microbial catalyst prepared in Example 1 of the present invention.
[0037] Figure 2 It is the linear sweep voltammogram of the functionalized Escherichia coli expressing laccase coated with ascorbic acid as a microbial catalyst prepared in Example 1 of the present invention. Detailed Embodiments
[0038] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments and comparative examples of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative work belong to the scope of protection of the present invention.
[0039] Unless otherwise specified, the test methods used in the following examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.
[0040] Example 1: A preparation method of a functionalized Escherichia coli expressing laccase as an efficient microbial catalyst, comprising the following steps:
[0041] The first step is to prepare a functionalized Escherichia coli catalyst by plasmid construction:
[0042] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0043] According to the full-length cDNA sequence information of the laccase (cotA) gene, specific primers were synthesized using Snapgene software. According to the pet-22b+ vector used, restriction enzyme sites were selected, and Sac I and Xho I restriction enzyme sites were added to the 5' end and 3' end respectively. PCR amplification was carried out using Takara LA Taq reagent. After the PCR amplification was completed, the product bands were detected by agarose gel electrophoresis, and then the target fragment was purified according to the instructions of the gel recovery kit from Sangon Biotech. The purified DNA solution was ligated with the vector.
[0044] The primer sequence information is as follows:
[0045]
[0046] Note: The underscore represents the Sall restriction enzyme site, and the wavy line represents the XhoI restriction enzyme site.
[0047] The second step is to use the transformation method to introduce the plasmid into Escherichia coli to prepare a functionalized Escherichia coli catalyst:
[0048] The prepared plasmid adheres to the bottom of the centrifuge tube in the form of a film or powder. Centrifuge and dissolve it with sterilized double-distilled water;
[0049] Take 100 μL of competent cells and melt them on ice;
[0050] Take 2 μL of the plasmid and immediately add it to the prepared 100 μL of competent cells, and flick it gently with your finger;
[0051] Perform an ice bath for 30 min. Next, take out the competent cells after the ice bath and immediately place them in a 42°C constant temperature water bath for 90 s, then perform an ice bath again for 5 min;
[0052] In a laminar flow hood, use a pipette to add 800 μL of pre-warmed LB liquid medium (the composition of LB is 1 L of ultrapure water, containing 10 g of peptone, 5 g of yeast, and 10 g of sodium chloride mixed) to an EP tube. Resuscitate and culture at 37°C and 200 rpm for 1 h; centrifuge at 6000 rpm for 4 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid; then spread the Escherichia coli bacterial liquid onto an LB agar plate containing 100 μg / mL -1 antibiotic, and grow at 37°C for 14 h to obtain functionalized Escherichia coli (ET).
[0053] An application of functionalized Escherichia coli expressing laccase coated with ascorbic acid as a highly efficient microbial catalyst, comprising the following steps:
[0054] Inoculate the engineering strain into 5 mL of LB liquid medium containing 50 μg / ml ampicillin, and place it in an oscillating incubator to culture at 37°C and 180 rpm for 12 h;
[0055] Inoculate at an inoculation amount of 2% into 100 mL of LB containing 50 μg / ml ampicillin, place it in an oscillating incubator at 37°C and 180 rpm for 2.5 h. When OD = 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25°C and 180 rpm for 12 h;
[0056] After leveling the cultured bacterial liquid, centrifuge at 5000 rpn for 4 min, and then pour out the supernatant;
[0057] Weigh 0.02 g of ascorbic acid, add 10 ml of water and shake well for later use;
[0058] Pour the ascorbic acid solution into the centrifuged bacterial liquid (discard the supernatant), and shake for 30 s to obtain ET-VC;
[0059] Level with ultrapure water and disperse and centrifuge twice;
[0060] Take 50 ml of LB solution containing antibiotics (ampicillin, to prevent the growth of miscellaneous bacteria and used to determine the growth of target colonies. Other antibiotics that meet the above requirements are acceptable, and this application does not make strict restrictions) (i.e., LB liquid medium)) and mix it well with the centrifuged bacterial liquid, add the treated carbon cloth, and shake for 24 h;
[0061] Construct an electrolytic cell and place it in a constant temperature water bath (37°C). Pour M9 buffer into it to act as the electrolyte, and saturate it with oxygen or nitrogen for testing.
[0062] The electrolytic cell was assembled as follows: Weigh 11.3 g of the purchased M9 medium powder and dissolve it in 979 ml of pure water. After autoclaving at high temperature and high pressure, add 20 ml of 20% D - glucose solution (sterile), 2 ml of 1.0 M MgSO4 solution (sterile), and 0.1 ml of 1.0 M CaCl2 solution (sterile) to prepare the M9 complete medium as the electrolyte. The counter electrode is a platinum electrode, the reference electrode is a silver chloride electrode, and the working electrode is a carbon cloth loaded with Escherichia coli.
[0063] Example 2: A preparation method of a functionalized Escherichia coli expressing laccase coated with ascorbic acid as an efficient microbial catalyst, comprising the following steps:
[0064] The first step is to prepare a functionalized Escherichia coli catalyst by plasmid construction:
[0065] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0066] According to the full - length cDNA sequence information of the laccase (cotA) gene, specific primers were synthesized using Primerprimer 5 software. According to the restriction enzyme sites of the pet - 22b+ vector used, Sac I and Xho I restriction enzyme sites were added to the 5' end and 3' end respectively. PCR amplification was carried out using Takara LA Taq reagent. After the PCR amplification was completed, the product bands were detected by agarose gel electrophoresis, and then the target fragment was purified according to the instructions of the Sangon gel extraction kit. The purified DNA solution was ligated with the vector.
[0067] The second step is to prepare a functionalized Escherichia coli catalyst by introducing the plasmid into Escherichia coli (WT) using the transformation method:
[0068] The prepared plasmid adhered to the bottom of the centrifuge tube in the form of a film or powder. Centrifuge and dissolve it with sterilized double - distilled water;
[0069] Take 100 μL of competent cells and thaw them on ice;
[0070] Take 4 μL of the plasmid and immediately add it to the prepared 100 μL of competent cells, and gently flick it with your finger;
[0071] Ice - bath for 30 min. Secondly, take out the ice - bathed competent cells and immediately place them in a 42 °C constant - temperature water bath for 60 s, and then ice - bath again for 5 min;
[0072] In the ultra - clean workbench, add 500 μL of pre - warmed LB liquid medium to the EP tube, and resuscitate and culture at 37 °C and 200 rpm for 1 h;
[0073] Centrifuge at 5000 rpm for 3 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid;
[0074] Then spread the Escherichia coli bacterial liquid onto an LB agar plate containing 100 μg / mL -1 antibiotics and grow at 37 °C for 14 h to obtain functionalized Escherichia coli (ET).
[0075] An application of functionalized Escherichia coli expressing laccase coated with ascorbic acid as an efficient microbial catalyst, comprising the following steps:
[0076] Inoculate the engineering strain into 3 mL of LB liquid medium containing 50 μg / ml ampicillin, and place it in an oscillating incubator to culture at 37 °C and 180 rpm for 16 h;
[0077] Inoculate at an inoculation amount of 3% into 150 mL of LB containing 50 μg / ml ampicillin, place it in an oscillating incubator at 37 °C and 180 rpm for 2 h. When OD = 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25 °C and 180 rpm for 12 h;
[0078] After leveling the cultured bacterial liquid, centrifuge at 5000 rpn for 3 min, and then pour out the supernatant;
[0079] Weigh 0.02 g of ascorbic acid, add 10 ml of water, shake well and set aside;
[0080] Pour the ascorbic acid solution into the centrifuged bacterial liquid and shake for 30 s to obtain ET-VC;
[0081] Level with ultrapure water and centrifuge and disperse twice;
[0082] Take 50 ml of LB solution containing antibiotics and mix well with the centrifuged bacterial liquid, add the treated carbon cloth, and shake for 24 h;
[0083] Construct an electrolytic cell and place it in a constant temperature water bath (37 °C), pour M9 buffer into it, and saturate it with oxygen or nitrogen for testing.
[0084] Example 3:
[0085] A preparation method of functionalized Escherichia coli expressing laccase coated with ascorbic acid as an efficient microbial catalyst, comprising the following steps:
[0086] First step, prepare a functionalized Escherichia coli catalyst by plasmid construction:
[0087] Through literature research, we identified that the cotA gene in Bacillus subtilis has the potential to catalyze the oxygen reduction reaction, and recorded this gene fragment;
[0088] According to the full-length cDNA sequence information of the laccase (cotA) gene, specific primers were synthesized using Primerprimer 5 software. According to the pet-22b+ vector used, restriction enzyme sites were selected, and Sac I and Xho I restriction enzyme sites were added to the 5' end and 3' end respectively. PCR amplification was performed using Takara LA Taq reagent. After PCR amplification, the product bands were detected by agarose gel electrophoresis, and then the target fragment was purified according to the instructions of the Sangon gel extraction kit. The purified DNA solution was ligated with the vector.
[0089] In the second step, the plasmid was introduced into Escherichia coli by transformation to prepare a functionalized Escherichia coli catalyst:
[0090] The prepared plasmid was attached to the bottom of the centrifuge tube in the form of a thin film or powder, centrifuged, and dissolved in sterilized double-distilled water;
[0091] Take 100 μL of competent cells and place them on ice to melt;
[0092] Take 4 μL of the plasmid and immediately add it to the prepared 100 μL of competent cells, and flick it gently with your finger;
[0093] Incubate on ice for 30 min. Secondly, take out the competent cells after ice bath, immediately place them in a 42 °C constant temperature water bath for 60 s, and then incubate on ice for 2 min again;
[0094] In a laminar flow hood, add 500 μL of pre-warmed LB liquid medium to the EP tube, and resuscitate and culture at 37 °C and 200 rpm for 1 h;
[0095] Centrifuge at 5000 rpm for 3 min, remove part of the supernatant, and resuspend and mix the remaining bacterial liquid;
[0096] Then spread the bacterial liquid of Escherichia coli on an LB agar plate containing 80 μg / mL -1 antibiotics and grow at 37 °C for 14 h to obtain functionalized Escherichia coli (ET).
[0097] An application of a functionalized Escherichia coli expressing laccase coated with ascorbic acid as an efficient microbial catalyst, including the following steps:
[0098] Inoculate the engineered strain into 5 mL of LB liquid medium containing 50 μg / ml ampicillin, and place it in an oscillating incubator to culture at 37 °C and 180 rpm for 16 h;
[0099] Inoculate into 150 mL of LB containing 50 μg / mL ampicillin at an inoculation amount of 3%, place it in a shaking incubator at 37°C, 180 rpm for 2 h. When OD at 600 nm reaches 1.0, add IPTG with a final concentration of 1.0 mmol / L, and induce at 25°C, 180 rpm for 12 h;
[0100] After balancing the cultured bacterial liquid, centrifuge at 5000 rpn for 3 min, and then pour out the supernatant;
[0101] Weigh 0.02 g of ascorbic acid, add 10 ml of water and shake well for standby;
[0102] Pour the ascorbic acid solution into the centrifuged bacterial liquid and shake for 30 s to obtain ET-VC;
[0103] Balance with ultrapure water and disperse and centrifuge twice;
[0104] Take 50 ml of LB solution containing antibiotics and mix it well with the centrifuged bacterial liquid, add the treated carbon cloth, and shake for 27 h;
[0105] Constitute an electrolytic cell and place it in a constant temperature water bath (37°C), pour M9 buffer solution into it, and saturate it with oxygen or nitrogen for testing.
[0106] Figure 1 It is a CV diagram. WT in the diagram is wild Escherichia coli (without any modification); ET is a genetically engineered bacterium; ET-VC is a chemical-biological engineered bacterium formed by coating on the basis of the engineered bacterium, and this bacterium is our final sample. Since laccase can be expressed in the engineered bacterium, and the copper ions contained in laccase are the active center structure, which can accelerate the oxidation-reduction reaction itself. The addition of ascorbic acid can directly transfer electrons, protect the active center of laccase and scavenge harmful free radicals, forming a synergistic effect with the copper ion active center of laccase, significantly improving the electron transfer efficiency and oxygen reduction reaction rate of the microbial fuel cell. Through Figure 1 It can be seen from the CV diagram in that among the three test cells, the CV curve of the modified strain with ascorbic acid shows the largest enclosed area and the largest peak current response. This observation indicates that the reaction kinetics is the fastest and the capacity is the highest. The Tafel slope provides valuable insights into the catalytic performance of the catalyst. The lower the Tafel slope, the higher the exchange current density and catalytic activity. The larger the peak current, the faster the oxidation-reduction reaction rate occurring on the electrode surface. This indicates higher catalyst activity, higher reactant concentration or higher electron transfer efficiency. Therefore, it can be seen from Figure 2 that ET-VC has good performance.
[0107] Obviously, the above-mentioned embodiments of the present invention are merely examples for clearly illustrating the technical solutions of the present invention, rather than limitations on the specific implementation manners of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the claims of the present invention shall be included within the protection scope of the claims of the present invention.
Claims
1. A preparation method of a recombinant Escherichia coli expressing laccase-coated ascorbic acid electrocatalyst, characterized in that, It includes the following steps: S1. According to the full-length cDNA sequence of the laccase gene, the cotA target gene is integrated into a vector to construct a recombinant expression plasmid, wherein the primer sequences of the cotA target gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively; S2. The recombinant expression plasmid is introduced into Escherichia coli to prepare functionalized recombinant Escherichia coli; S3. The functionalized recombinant Escherichia coli is coated with ascorbic acid to obtain the product.
2. The preparation method according to claim 1, characterized in that, The vector is pet-22b+.
3. The preparation method according to claim 1, characterized in that, In step S2, the Escherichia coli uses the biosafe Escherichia coli BL21(DE3) as the starting strain.
4. The preparation method according to claim 1, characterized in that, In step S2, the transformation method is used for introduction, including the following steps: S21. The recombinant expression plasmid is added to the competent cells and incubated on ice. The competent cells after ice incubation are taken and placed in a 42°C constant temperature water bath for 60 - 90 s, and then incubated on ice again for 2 - 5 min; S22. The LB liquid medium is resuscitated and cultured at 37°C and 200 rpm for 1 h; then centrifuged at 6000 rpm for 4 min, part of the supernatant is removed, and the remaining bacterial liquid is resuspended and mixed evenly; S23. Spread the bacterial liquid containing Escherichia coli in the previous step onto an LB agar plate containing 100 μg / mL -1 antibiotic and grow it at 37 °C for 14 h to obtain functionalized recombinant Escherichia coli.
5. The recombinant Escherichia coli expressing laccase prepared by the method according to any one of claims 1 to 4 is coated with ascorbic acid electrocatalyst.
6. The application of the recombinant Escherichia coli expressing laccase coated with ascorbic acid electrocatalyst according to claim 5 in the preparation of the cathode of a microbial fuel cell.
7. The application according to claim 6, characterized in that, The recombinant Escherichia coli electrocatalyst expressing laccase is suspended in the LB liquid medium, then ascorbic acid is added, and the carbon cloth electrode is placed in the LB liquid medium and co-incubated with the recombinant Escherichia coli. Finally, the carbon cloth electrode with the recombinant Escherichia coli electrocatalyst biofilm expressing laccase attached is obtained, which is the cathode.
8. The application according to claim 7, wherein The treatment during the incubation process specifically includes the following steps: S1. The functionalized recombinant Escherichia coli is inoculated into the LB liquid medium containing ampicillin and placed in a shaking incubator at 37°C and 180 rpm for 12 - 16 h; S2. Inoculate at an inoculation amount of 2% - 3% into the LB medium containing 50 μg / ml ampicillin, place it in a shaking incubator at 37°C and 180 rpm for 2 - 2.5 h. When OD = 600 nm reaches 1.0, add isopropyl-β-D-thiogalactoside with a final concentration of 1.0 mmol / L, at 25°C and 180 rpm, and induce for 12 h; the cultured bacterial liquid is balanced and then centrifuged at 5000 rpn for 4 min, and then the supernatant is poured out; then ascorbic acid is added and centrifuged; S3. Take 50 ml of the LB liquid medium solution containing antibiotics and the above centrifuged bacterial liquid and mix them evenly, add the treated carbon cloth, and shake for 24 - 27 h.
9. The application according to claim 8, wherein The LB liquid medium is a mixture of 1 L of ultrapure water, 10 g of peptone, 5 g of yeast, and 10 g of sodium chloride.