Lactococcus lactis carrier oral vaccine for enterotoxigenic escherichia coli F18 fimbriae and application of lactococcus lactis carrier oral vaccine

Abstract

The invention belongs to the technical field of biological genetic engineering, and discloses a lactococcus lactis carrier oral vaccine for enterotoxigenic escherichia coli F18 fimbriae and application. Four lactococcus lactis antigen surface display strains are prepared and are mixed for oral immunization. The oral immunization mode is convenient to operate, the stress reaction of injection immunization to animals is avoided, meanwhile, the immunization effect is greatly improved, and diarrhea of enterotoxigenic escherichia coli to piglets can be effectively prevented. The escherichia coli vaccine is an oral escherichia coli vaccine, a mouse immune challenge experiment shows that the vaccine can be completely survived under the challenge dosage of LD50, a piglet immune challenge experiment shows that the diarrhea condition of piglets can be completely protected, and it is indicated that an immune group generates effective mucosal immune protection capacity.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological genetic engineering, and particularly relates to an oral vaccine of Lactococcus lactis vector for enterotoxigenic Escherichia coli F18 fimbrial type and its application. Background Art

[0002] Enterotoxigenic Escherichia coli (ETEC) is a pathogenic Escherichia coli that can cause diarrhea in humans and various animals. This disease mostly occurs in young animals. In pig herds, it mainly causes severe diarrhea and dehydration in piglets within 7 days of age, with rapid transmission, high incidence and mortality, known as yellow scour in piglets; white scour mostly occurs in piglets aged 10 - 30 days, with a relatively low fatality rate, but it causes poor growth and gradual emaciation of piglets, and even results in the situation of stunted pigs; in addition, this bacterium is also the main bacterial pathogen causing diarrhea in weaned piglets, and some strains are even related to edema disease in piglets (Zhang Fanqing 2022). The main reasons for such differences are the different fimbrial adhesins and enterotoxins. Yellow and white scour in piglets are mostly related to K88, K99 fimbriae and heat-labile enterotoxin lt, heat-stable enterotoxin st, while diarrhea in weaned piglets and edema disease in piglets are mostly related to F18 fimbriae and Shiga-like toxin stx2e (Duan et al. 2020). Generally speaking, ETEC mainly causes severe diarrhea and even death in the piglet stage, causing huge losses to farms. Therefore, it is of great significance to study and develop vaccines against this disease.

[0003] Live vector vaccines are to introduce the target antigen-encoding gene into a live vector (avirulent or attenuated bacteria or viruses) by molecular biological means to construct recombinant strains, so that the target gene is highly expressed as the recombinant strains proliferate in the host body, thereby inducing corresponding immune protective responses. Lactococcus lactic is one of the typical strains of lactic acid bacteria, with the advantages of rapid growth, easy operation, safety and non-toxicity. At present, the complete genome sequence has been obtained, and it has gradually become an ideal choice for expressing foreign proteins and serving as a live vector vaccine carrier (Wang Chen 2019). However, lactic acid bacteria have high biological and genetic genotype diversity. The expression levels of different foreign genes vary greatly or even do not express, and the expression levels of the same gene also differ in different host bacteria. The levels of cellular immunity and humoral immunity stimulated in the body are also different, and there are also large differences in the amount of antigen displayed on the surface of recombinant strains. And the protein expression level is the key factor for the live vector vaccine to exert its effect. Therefore, in the actual use process, the effects obtained by immunized animals are uneven, which is also one of the difficulties in the development of lactic acid bacteria vector vaccines (Liu Qiong et al. 2019).

[0004] At present, the prevention and control of ETEC in the pig industry mainly rely on antibiotic treatment. However, Escherichia coli isolated clinically is generally drug-resistant. Sometimes, the application of antibiotics not only fails to achieve the treatment effect, but instead increases the multi-drug resistant strains. Coupled with the continuous implementation of antibiotic restriction and prohibition policies in various countries around the world, the antibiotic treatment plan no longer meets the current prevention and control of this disease. Therefore, vaccination is the best way to prevent this disease (Yang Dehong et al., 2019). The research on ETEC vaccines has been going on for more than 30 years, and a series of progress has been made from simple physical and chemical methods to genetic engineering methods. However, so far, no vaccine can be effectively applied to all regions, and most vaccine research has stagnated due to poor immunogenicity or lack of broad protection (Zhang Henghui et al., 2015). Whole-bacterium inactivated vaccine is the main preparation method of current experimental and commercial ETEC vaccines. However, due to the large number of ETEC serotypes and their regional distribution differences, there are great regional limitations and poor broad-spectrum protection effects in actual use. At the same time, there are also problems such as low proportion of active ingredients, large immunization dose, lack of high efficiency of the vaccine, high content of endotoxin and irrelevant components, and serious side reactions, resulting in unsatisfactory clinical use effects of the vaccine. Similarly, there are already related products of genetic engineering vaccines approved for clinical use. However, due to the mutual influence of protein expression, the full effect of the antigen cannot be fully exerted, some non-fimbrial adhesin strains cannot be protected in clinical applications, and the experimental effects are good but the actual application effects are not good, resulting in a low clinical utilization rate.

[0005] The subunit vaccine against this disease has always been a vaccine type that has received much attention. It has the advantages of strong broad-spectrum, high immunogenicity, and small animal stress response. However, due to the difficulty in preparing the antigen protein of the bacteria itself, there are problems such as low strain expression level, difficulty in obtaining a large amount of soluble protein, high purification cost, and failure to achieve the expected immune effect. So far, no product has been used clinically. The attenuated live vaccine has the risk of reversion to virulence, and it is often only effective against homologous strains. Coupled with the relatively little research on bacterial attenuated vaccines around the world, there is currently no vaccine available (Xia Pengpeng et al., 2016; Yang Dehong et al., 2019; Bourgeois et al., 2016). Therefore, there is still an urgent need for an effective vaccine plan for the prevention and control of ETEC.

[0006] In view of the above problems, the present invention provides an oral vaccine of Lactococcus lactis vector for enterotoxigenic Escherichia coli F18 fimbrial type. This vaccine is immunized by oral immunization, avoiding the stress reaction caused by vaccine injection, and at the same time greatly exerting the effect of mucosal immunity to resist the infection of Escherichia coli disease. Summary of the Invention

[0007] The object of the present invention is to provide a lactic acid bacteria mixture, and the lactic acid bacteria mixture is Lactococcus lactis NZ3900 that respectively expresses SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8.

[0008] Another object of the present invention is to provide the application of the above lactic acid bacteria mixture in the preparation of an enterotoxigenic Escherichia coli oral vaccine.

[0009] In order to achieve the above object, the present invention takes the following technical measures:

[0010] A lactic acid bacteria mixture, the lactic acid bacteria mixture includes recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM that expresses SEQ ID NO.2, recombinant Lactococcus lactis r-L.La ctis--NZ3900-pNZ8149-Usp45-stx2eB-ACM that expresses SEQ ID NO., 4 recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM that expresses SEQ ID NO.6, and recombinant Lactococcus lactis r-L.Lactis--NZ 3900-pNZ8149-Usp45-stA-ACM that expresses SEQ ID NO.8.

[0011] For the above-mentioned scheme, preferably, the recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM is obtained by introducing the gene shown in SEQ ID NO.1 into Lactococcus lactis NZ3900.

[0012] The recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM is obtained by introducing the gene shown in SEQ ID NO.3 into Lactococcus lactis NZ3900.

[0013] The recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM is obtained by introducing the gene shown in SEQID NO.5 into Lactococcus lactis NZ3900.

[0014] The recombinant Lactococcus lactis r-L.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM is obtained by introducing the gene shown in SEQID NO.7 into Lactococcus lactis NZ3900.

[0015] For the above-described solution, preferably, the ratio of the effective bacteria content of the three recombinant Lactococcus lactis is 1-2:1-2:1-2:1-2.

[0016] The protection scope of the present invention also includes: the application of the above lactic acid bacteria mixture in the preparation of an oral vaccine against enterotoxigenic Escherichia coli. Preferably, the fimbrial type of the enterotoxigenic Escherichia coli is F18.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] 1. The present invention provides for the first time an orally administrable enterotoxigenic Escherichia coli (ETEC). Using the vaccine in a mouse immunization and challenge experiment, the protection rate of the vaccine can reach 100% as observed daily for 7 days, and it is found that all piglets are protected from diarrhea after immunization and challenge.

[0019] 2. The present invention specifically designs an enterotoxigenic Escherichia coli antigen display sequence for Lactococcus lactis NZ3900. This sequence can be expressed in large quantities and stably on the display vector Lactococcus lactis NZ3900, and at the same time, good immune effects are achieved after animals take it.

[0020] 3. Since the present invention is an oral vaccine, the immunization method is simple, and oral mixing with feed is easy to implement on a large scale, avoiding the stress reaction caused by injection, and effectively preventing the occurrence of yellow and white scour in piglets. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is a schematic diagram of antigen display on the surface of lactic acid bacteria.

[0022] Figure 2 It is a WB diagram of protein expression of four recombinant strains.

[0023] Figure 3 It is a schematic diagram of the survival curve of mice after challenge.

[0024] Figure 4 It is a schematic diagram of the weight change of piglets during the immunization period.

[0025] Figure 5 It is a histological lesion diagram of the piglet immunization and challenge experiment.

[0026] Figure 6 It is a schematic diagram of HE staining of piglet tissue sections. DETAILED DESCRIPTION OF THE INVENTION

[0027] For the technical solution described in the present invention, unless otherwise specified, it is a conventional solution in the art. For the reagents or materials, unless otherwise specified, they are all from commercial channels.

[0028] Example 1:

[0029] Analysis and synthesis of surface-displayed proteins of enterotoxigenic Escherichia coli K88 genotype:

[0030] According to the gene sequences and protein sequences of two subtypes of Shiga-like toxin of Escherichia coli, stx2eA and stx2eB, the F18 fimbrial protein subunit fedF, and the subtype stA gene sequence and protein sequence of heat-labile enterotoxin published on GenBank, the codons were optimized and the proteins were effectively truncated to obtain the target gene fragments. At the same time, the secretion transmembrane peptide gene Usp45 of Lactococcus lactis protein No. 45 was used as the secretion signal peptide of the foreign protein and inserted at the 5' end of the target gene; the polypeptide fragment ACM encoded by three repeated Lysm gene sequences also derived from Lactococcus lactis was inserted at the 3' end of the target gene, and the antigen was anchored on the cell wall surface of Lactococcus lactis by non-covalent linkage, thereby realizing the surface display of the foreign protein.

[0031] Among them, the finally designed Usp45-stx2eA-ACM is shown in SEQ ID NO.1, and the encoded protein is shown in SEQ ID NO.2; Usp45-stx2eB-ACM is shown in SEQ ID NO.3, and the encoded protein is shown in SEQ ID NO.4; Usp45-fedF-ACM is shown in SEQ ID NO.5, and the encoded protein is shown in SEQ ID NO.6; Usp45-stA-ACM is shown in SEQ ID NO.7, and the encoded protein is shown in SEQ ID NO.8.

[0032] The synthesis of the four genes was carried out by Nanjing Genscript Corporation.

[0033] Example 2:

[0034] Preparation of three recombinant Lactococcus lactis:

[0035] The primers used in this example are shown in the following table:

[0036] Table 1: Primers for amplifying target genes and universal identification primers for vectors

[0037] Serial number Primer name Primer sequence 5’-3’ ① pNZ8149-F ACGGCTCTGATTAAATTCTGAAGTT ② pNZ8149-R GCTTTCATAATCTAACAGACAACATCT ③ KpnI-Usp45-F CCGGGTACCATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCT ④ SacI-ACM-R CGCGAGCTCTTTTATTCGTAGATACTGACC

[0038] 1) Construction of four recombinant Lactococcus lactis strains expressing stx2eA, stx2eB, fedF, and stA respectively:

[0039] (1) Using the sequences shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, and SEQ ID NO.7 as templates respectively, four fragments were amplified using primers ③ and ④ in Table 1.

[0040] (2) Double digest the vector pNZ8149 and the above four amplification products with KpnI / SacI, and use the GelEx traction Kit of OMEGA company to recover the digested products from the gel; prepare a 10 μL ligation reaction system and incubate at 37 °C for 1 hour:

[0041]

[0042] (3) Electrotransform the ligation products into competent cells of Lactococcus lactis

[0043] A. Add 10 μL of the ligation products to 100 μL of NZ3900 competent cells, gently flick the tube wall to mix, and incubate on ice for 20 min.

[0044] B. Transfer the mixed bacterial solution to a pre-cooled electroporation cuvette. Electroporation parameters: voltage 2000 V, resistance 200 Ω, electroporation time 5 ms.

[0045] C. Immediately after electroporation, add 900 μL of pre-cooled electroporation recovery medium, transfer to a 1.5 ml EP tube, incubate on ice for 5 min, and then transfer to a 30 °C incubator and incubate statically for 1 h.

[0046] D. Centrifuge at 3000 rpm for 5 min at room temperature, discard 900 μL of the supernatant, resuspend the bacterial cell pellet with the remaining 100 μL, spread on the screening solid medium, and culture at 30 °C for 24 h to observe the colony morphology.

[0047] (4) Identification of positive recombinant plasmids

[0048] Pick positive colonies from the solid culture plate, inoculate them into 10 ml of GM17 liquid medium, and incubate statically at 30 °C overnight to extract plasmids. Using the positive recombinant plasmid extracted above as a template and the sequences ① and ② in the table as upstream and downstream primers, perform PCR identification. After the PCR amplification is completed, perform a 1% agarose gel electrophoresis and observe the results. Send the plasmids with correct PCR identification to Tsingke Biotechnology Co., Ltd. for sequencing, and name the positive plasmids with correct alignment sequences as pNZ8149-Usp45-stx2eA-ACM, pNZ8149-Usp45-stx2eB-ACM, pNZ8149-Usp45-fedF-ACM, and pNZ8149-Usp45-stA-ACM respectively, to obtain four strains of surface-display recombinant Lactococcus lactis strains r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, and r-L. Lactis--NZ3900-pNZ8149-Usp45-stA-ACM.

[0049] In addition, the applicant used the secretion peptides of the above four antigens themselves and the LPxTG motif derived from Lactobacillus plantarum as surface display peptides. After the same optimization, the above four antigens were expressed in Lactococcus lactis NZ3900. The results showed that the protein expression level was lower than the combination of the secretion peptide Usp45 and the surface display peptide ACM, indicating that the surface display scheme of the present invention can display the four antigens more efficiently.

[0050] Example 3:

[0051] Preparation of a composite Lactococcus lactis vector oral vaccine:

[0052] The screened recombinant Lactobacillus r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-stA-ACM and the control strain r-L. Lactis--NZ3900-pNZ8149 (obtained by transferring the empty vector pNZ8149 into NZ3900) were respectively inoculated into GM17 solid medium; then a single colony was picked from each and cultured statically in the medium for 24 h; then they were passaged in liquid medium at a ratio of 1:25. When the OD value was detected to be 0.4, the inducer Nisin was added to a final concentration of 10 ng / mL, and induced for 6 h. Centrifuge at 12000×g for 2 min, wash the precipitate with pre-cooled PBS repeatedly 3 times, and resuspend the cells with PBS at a ratio of 1:10. Ultrasonically disrupt the cells, and after centrifuging the disrupted cell suspension at 4°C and 12000g for 10 min, discard the supernatant and resuspend the precipitate with PBS. Mix the 5× protein Loading with the resuspended precipitate samples of the recombinant strains r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, r-L. Lactis--NZ3900-pNZ8149-Usp45-stA-ACM and the control strain r-L. Lactis--NZ3900-pNZ8149, and heat in a metal bath at 100°C for 10 min. Using the protein Marker as a control to detect the protein molecular weight, lane 1 is the control strain L. Lactis--NZ3900, lane 2 is the control blank vector strain r-L. Lactis--NZ3900-pNZ8149, and lanes 3 from top to bottom are the four recombinant strains after induction, and Western blot detection was performed. The detection results are as Figure 2 shown, and correct protein expression was detected in all recombinant strains after induction.

[0053] Four recombinant Lactococcus lactis strains were cultured and induced to express in 1 L. The viable bacterial count was determined by plate culture. The mixture was mixed at a ratio of 1:1:1:1 in terms of effective bacterial concentration. After mixing, the cells were centrifuged at 3000 rpm for 10 minutes, washed once with PBS, resuspended in PBS, and concentrated 10-fold to obtain a Lactococcus lactis oral vaccine composition. The total concentration of Lactococcus lactis in the composition was 4×10 10 cfu / mL, where the final concentration of each recombinant bacterium in the system was 1×10 10 cfu / mL.

[0054] Example 4:

[0055] Mouse experiment on compound Lactococcus lactis carrier oral vaccine:

[0056] Mouse immune challenge evaluation:

[0057] The experimental groups are as follows: 3-4 week old C57BL / 6J mice were selected for immunization experiments. Each mouse in the immunization group was given 0.4 ml of the oral vaccine prepared in Example 3 each time. The blank control group and the challenge control group were given 0.4 ml of PBS. The vector control group was given 0.4 ml of blank vector bacterial solution (i.e., rL. Lactis--NZ3900-pNZ814, the same amount as the oral vaccine). Oral gavage was performed on the 1st, 2nd, and 3rd days of each week for 4 weeks. On the 29th day, ETEC (F18+) strain ETW037 was used for gavage challenge. The challenge dose was 1 LD50. 50 After the infection, the death of mice in each group was recorded.

[0058] The results are as follows Figure 3 As shown, 60% of the mice in the challenge control group died within 4 days after the challenge, while 50% of the mice in the vector control group died within 4 days after the challenge, confirming that the effect of the vector itself cannot prevent the death of mice caused by the challenge. The mice in the immunized group survived completely without death, indicating that oral vaccination can protect mice from the death caused by the challenge.

[0059] Example 5:

[0060] Evaluation of immune challenge of piglets with a composite Lactococcus lactis carrier oral vaccine:

[0061] The experimental groups were as follows: 8-day-old Sanyuan piglets were selected for immunization experiments. Each pig in the immunization group was given 4 ml of the oral vaccine prepared in Example 3 each time, and the blank control group and the challenge control group were given 4 ml of PBS. From the age of 8 days, gavage was performed for 3 consecutive days, with 3 days of immunization and 3 days of rest as one round, and 3 rounds of immunization were completed. The piglets were 28 days old when the immunization was completed. When the piglets were 29 days old, they were gavage-challenged with ETEC (F18+) strain ETW037, and the challenge dose was 8×10 per piglet. 10CFU (For weaned piglets, ETEC mainly causes severe diarrhea during the weaning stage, but the general fatality rate is not high. Therefore, the dose of 8×10 10 CFU selected here is the dose that caused diarrhea in all piglets in the previous verification). After challenge, record the health status and diarrhea situation of piglets in each group. On the 7th day after challenge, sacrifice the piglets in each group and conduct pathological dissection, observe the pathological changes and collect intestinal samples and send them to Wuhan Baiqiandu Biotechnology Co., Ltd. for the preparation of HE-stained pathological sections.

[0062] The results are as Figure 4 shown. During the immunization period, the weight gain rate of piglets in the immunized group was significantly higher than that in the control group. It was significantly higher than the control group from 1 week after immunization. By the end of immunization at 28 days of age, the immunized group was extremely significantly higher than the control group. At this time, the weight of piglets in the immunized group increased by 23.2% compared with that of non-immunized piglets, proving that the oral vaccine itself has a certain effect on promoting the growth of piglets.

[0063] Figure 5 Figure shows the clinical diarrhea symptoms, intestinal and mesenteric lymph node pathological anatomy diagrams of piglets in each group after challenge. As shown in the figure, obvious watery yellow diarrhea occurred in both the challenged group and the vector control group of piglets. The immunized group was the same as the blank control group, and no diarrhea symptoms occurred in the two groups of piglets. The results of intestinal lesions showed that obvious thinning, transparency, and tympanites of the intestinal wall occurred in both the challenged group and the vector control group of piglets, especially in the small intestine segment, which was filled with yellow liquid content. No intestinal lesions occurred in the immunized group and the blank control group. The results of mesenteric lymph node dissection showed that severe congestion and bleeding of mesenteric lymph nodes occurred in both the challenged group and the vector control group, while the immunized group and the blank control group were normal.

[0064] Figure 6 Figure shows the HE-stained section diagrams of mesenteric lymph nodes and intestinal tissues of piglets in each group after challenge. The mesenteric lymph node section diagrams showed that bleeding occurred in both the challenged group and the vector control group. The yellow spots in the sections were hemosiderin deposits after the rupture of blood cells. At the same time, due to the occurrence of intestinal inflammation, the number of mature lymphocytes in mesenteric lymph nodes decreased, while the immunized group and the blank control group were normal. The HE-stained section diagrams of duodenum, jejunum, and ileum all showed obvious thinning of the intestinal wall muscle layer, atrophy, fragmentation, bleeding, lymphocyte infiltration, and absence of plasma cells in the lamina propria in the challenged group and the vector control group, while the intestinal sections of the immunized group and the blank group showed normal performance.

[0065] In summary, oral vaccination can protect piglets from the invasion of enterotoxigenic Escherichia coli serotype F18, indicating that the oral vaccine has good protective effects.

[0066] The applicant also attempted to construct recombinant strains using another strain of Lactococcus lactis MG1363 and the matching plasmid pMG36e according to the antigen surface display methods of Examples 1 and 2, and successfully obtained four recombinant surface display strains, named r-L. Lactis--MG1363-pMG36e-Usp45-stx2eA-ACM, r-L. Lactis--MG1363-pMG36e-Usp45-stx2eB-ACM, r-L. Lactis--MG1363-pMG36e-Usp45-fedF-ACM, and r-L. Lactis--MG1363-pMG36e-Usp45-stA-ACM. Similarly, the four recombinant strains were mixed in a ratio of 1:1:1:1 to prepare an oral vaccine preparation, and the concentration of this oral vaccine complex was kept consistent with that of the present invention. The preparation of the present invention was named oral vaccine A, and this preparation was named oral vaccine B. At the same time, mouse experiments and piglet immunoprotection experiments were carried out. The results showed that in the mouse immunization and challenge experiment, oral vaccine B could not resist the LD 50 dose challenge, and half of the mice died, showing no difference from the challenge control group; in the piglet immunization and challenge experiment, there was no difference between the piglets immunized with oral vaccine B and the challenge control group, and the typical symptoms of yellow and white scour in piglets also occurred, indicating that Lactococcus lactis MG1363 as the carrier of the three antigens in the present invention could not exert a good immune effect; at the same time, the Lactococcus lactis MG1363 system has an erythromycin resistance gene, while the Lactococcus lactis NZ3900 system in the present invention does not have a resistance gene and is a food-grade expression system, which is safer in application.

Claims

1. A lactic acid bacteria mixture, which includes recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM expressing SEQ ID NO.2, recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM expressing SEQ ID NO. 4, recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM expressing SEQ ID NO.6 and recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stA-ACM expressing SEQ ID NO.

8.

2. The mixture according to claim 1, characterized in that: The recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM is obtained by introducing the gene shown in SEQ ID NO.1 into Lactococcus lactis NZ3900; The recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM is obtained by introducing the gene shown in SEQ ID NO.3 into Lactococcus lactis NZ3900; The recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM is obtained by introducing the gene shown in SEQ ID NO.5 into Lactococcus lactis NZ3900; The recombinant Lactococcus lactis r-L. Lactis--NZ3900-pNZ8149-Usp45-stA-ACM is obtained by introducing the gene shown in SEQ ID NO.7 into Lactococcus lactis NZ3900.

3. The mixture according to claim 1, wherein the proportion of the effective bacteria content of the four recombinant Lactococcus lactis is 1~2:1~2:1~2:1~2.

4. Use of the lactic acid bacteria mixture according to claim 1 in the preparation of an oral vaccine against enterotoxigenic Escherichia coli.

5. The use according to claim 4, wherein the fimbrial type of the enterotoxigenic Escherichia coli is F18.

Images