A cbe editing system and applications
By incorporating the deubiquitinated protein UCHL1 into the CBE editing system, the problem of low editing efficiency of the CBE editing system in mammalian cells was solved, and protein stability and editing efficiency were significantly improved.
Patent Information
- Application Number
- CN202510532042.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2045-04-25
AI Technical Summary
Existing CBE single-base editing systems have low editing efficiency in mammalian cells and the proteins are unstable, which affects their application effectiveness.
By fusing the deubiquitinated protein UCHL1, the stability of the CBE editing protein is improved, enhancing its persistence within cells and thus increasing editing efficiency.
It significantly improves the editing efficiency of the CBE single-base editor, achieving more efficient gene editing results.
Smart Images

Figure CN120399091B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene editing technology, specifically to a CBE editing system and its application. Background Technology
[0002] Gene editing technology is a genetic engineering technique that modifies specific DNA fragments by editing target genes at specific sites.
[0003] In existing technologies, gene editing was initially achieved by utilizing zinc finger proteins (ZFPs) to specifically recognize specific base sequences. Following ZFNs, TALEN technology, derived from the AvrBs3 protein, emerged. However, ZFN and TALEN editing technologies suffer from limitations such as complex design / screening processes, high off-target rates, and difficulties in packaging and delivery. Subsequently, CRISPR technology, a gene editing technique that utilizes RNA-guided endonucleases to cut nucleic acids at specific locations, was developed. The CRISPR-Cas system, short for Regularly Clustered Spaced Short Palindromic Repeats and CRISPR-Associated Proteins (Cas), consists of a Cas nuclease and two separate RNA components: a programmable crRNA (CRISPR RNA) and a fixed tracrRNA (trans-activating crRNA). The Cas1-Cas2 proteins can cleave invading bacteriophage DNA into small fragments, which are then integrated into the CRISPR array as spacers. Subsequently, the CRISPR array is transcribed to produce crRNA and complementary tracrRNA, which form a double-stranded RNA structure that recruits the Cas protein for cleavage. Near the crRNA target sequence on invading DNA, the protospacer adjacent motif (PAM) plays a crucial role in both the adaptation and interference phases. The CRISPR-Cas complex recognizes these sequences during target DNA binding. Due to its simplicity and efficiency, CRISPR-Cas9 technology has rapidly become the preferred technique for genetic manipulations such as gene knockout, gene knock-in, and large fragment deletion in plants, animals, and microorganisms.
[0004] CRISPR-Cas systems are mainly divided into two categories: one is a multi-protein effector complex including types I, III, and IV; the other is a single Cas protein complex including types II, V, and VI. Compared to the former, the second category (type II Cas9, type V Cas12a, type VI Cas13a, and Cas13b systems) has greater potential in genome editing applications. Among these, the type II system uses only one Cas protein, Cas9, unlike other systems that require multiple Cas proteins. The Cas9 protein relies on the fusion and cleavage of crRNA and tracrRNA to form sgRNA (one-way guide RNA), which plays a role in RNA-guided DNA recognition, enabling its use in genome engineering. Cas9 contains domains homologous to HNH and RuvC endonucleases, where the HNH domain cleaves the complementary DNA strand, while the RuvC-like domain cleaves the non-complementary DNA strand. In 2012, Jinek et al. first reported that the CRISPR-Cas9 system could be modified into a programmable RNA-guided DNA endonuclease. Subsequently, Cong et al. achieved targeted gene editing in mammalian cells for the first time using a modified CRISPR-Cas9 system. Since then, CRISPR-Cas9 technology has rapidly become the preferred technique for genetic operations such as gene knockout, gene knock-in, and large-fragment deletion in plants, animals, and microorganisms due to its simplicity and efficiency. With further research, researchers have explored other types of CRISPR systems and developed a large number of new editing tools, making the CRISPR-Cas system the dominant gene editing tool.
[0005] However, the CRISPR-Cas system has some significant drawbacks, such as low efficiency, non-targeted cleavage, and low safety. Komor et al. reported a single-base editing technology that fuses spCas9 with cytosine deaminase. Utilizing spCas9's precise DNA localization capability, the cytosine deaminase is guided to the target sequence. Then, catalyzed by the cytosine deaminase, cytosine C within the mutation window is converted to thymine T. This technology was later also known as the cytosine base editor (CBE). The CBE system mainly consists of nCas9 or dCas9 and cytidine deaminase 1 (APOBEC1), where spontaneous deamination of cytosine is the primary source of the CG to TA conversion. Komor et al. reported BE1 (rAPOBEC1-XTENdCas9), which works by forming a fusion protein between the N-terminus of dCas9 and APOBEC1. Subsequently, gRNA guides the fusion protein to the target site. APOBEC1 deaminates the C in the single-stranded DNA of the R loop to form U, and subsequent DNA replication completes the C to T conversion. However, further research revealed that while the average epigenetic editing efficiency of the BE1 system was 44% in vitro, its editing efficiency in mammalian cells was only 0.8% to 7.7%. To improve editing efficiency, a uracil DNA glycosylase inhibitor (UGI) was fused to the C-terminus of BE1, constructing the second-generation base editor BE2 (APOBEC-XTEN-dCas9-UGI). Compared to BE1, adding UGI increased editing efficiency by approximately 3 times. Subsequently, dCas9 in the BE2 system was replaced with nCas9, creating a gap in the non-edited strand and stimulating base mismatch repair (MMR) in cells, thus constructing the third-generation base editor BE3 (APOBEC-XTEN-dCas9(A840H)-UGI). Compared to BE2, BE3 showed a 2-6 fold increase in editing efficiency. To further improve editing efficiency, Koblan et al. constructed BE4max by adding nuclear localization signals (NLS) and optimizing codons, increasing editing efficiency by 3 times compared to BE4.
[0006] Although researchers have optimized and improved various components of the CBE single-base editing system (including Cas protein, deaminase, and small elements), the system's editing efficiency still needs further refinement and optimization. Therefore, researching new strategies to improve CBE editing efficiency is of great significance for the application of CBE. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a CBE editing system and application.
[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0009] In a first aspect, the present invention provides a CBE editing protein, wherein the CBE editing protein is fused with a protein expressing a deubiquitinated gene.
[0010] This invention reveals that, compared to other single-base editors such as ABE, the CBE single-base editor protein is unstable and rapidly degrades within cells. By fusing a deubiquitinated protein, the stability of the CBE single-base editor protein is improved, thereby enhancing the editing efficiency of CBE.
[0011] As a preferred embodiment of the CBE editing protein of the present invention, the CBE editing protein is selected from any one of xCas9(3.7)BE4, CP1028 CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID.
[0012] As a preferred embodiment of the CBE editing protein of the present invention, the deubiquitinated gene is at least one of UCHL1, TIGAR, SNCB, SCGN, GSTM3, OTUB1, YWHAQ, TBCB, PHYHD1, and FBXO2.
[0013] Secondly, the present invention provides an expression vector for expressing the CBE editing protein.
[0014] As a preferred embodiment of the expression vector of the present invention, it includes a nucleotide sequence encoding any one of the CBE editing proteins selected from xCas9(3.7)BE4, CP1028CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID.
[0015] As a preferred embodiment of the expression vector of the present invention, it includes a nucleotide sequence as shown in SEQ ID NO: 1.
[0016] Thirdly, the present invention provides a nucleic acid encoding the CBE editing protein.
[0017] Fourthly, the present invention provides a CBE editing system, including the aforementioned CBE editing protein.
[0018] Fifthly, the present invention applies the CBE editing protein, the expression vector, the nucleic acid, and the CBE editing system to gene editing.
[0019] As a preferred embodiment of the application described in this invention, the editing is a C-to-T gene editing at a specific site.
[0020] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0021] This invention improves the stability of the CBE single-base editor protein by fusing it with the deubiquitinated protein UCHL1, thereby enhancing the editing efficiency of CBE. This invention provides a novel method for improving the efficiency of the CBE single-base editor, achieving a significant increase in the efficiency of CBE single-base editing. Attached Figure Description
[0022] Figure 1 Figure 1 shows the experimental results of CBE protein instability. In the figure, A: CDS region element diagram of each expression plasmid and schematic diagram of protein stability detection; B: Western blot analysis of target protein expression levels after 48 h of transfection with each plasmid, followed by CHX treatment for 2, 4, 6, and 8 hours, with 0 hours as a control. Each expression plasmid carries a V5 tag, and detection was performed using V5 antibody; C: Quantitative graph of protein levels after normalization using GAPDH as an internal control.
[0023] Figure 2 To inhibit ubiquitination degradation pathway, CBE protein degradation can be inhibited; In the figure, A: Western blotting detection of the expression level of each protein; 48 h after transfection of the corresponding plasmid, CHX was treated alone for 8 hours, or CHX+MG132 was treated together for 8 hours, and samples were collected for detection; B: Scatter plot of the ratio of protein level in the CHX+MG132 treatment group to the protein level in the CHX-only treatment group.
[0024] Figure 3 The fusion of UCHL1 significantly improves the stability of CBE, increases its protein expression level, and thus enhances its editing efficiency. In the figure, A: Schematic diagram of two ORF strategies for selecting stable protein expression; B: ORF scatter plot showing significant improvement in protein stability in both strategies (FC>=2, P<=0.01), where FBXO2, UCHL1, and OTUB1 are ubiquitination-related proteins; C: Fusion of ubiquitination-related proteins and other randomly selected proteins with CBE4max-SpRY protein; D: Western blot detection of the expression levels of these fusion proteins. GAPDH is used as an internal control; E: Co-transformation of the CBE editor and sgRNA; the CBE editor fused with UCHL1 protein exhibits higher editing efficiency. Detailed Implementation
[0025] To better illustrate the objectives, technical solutions, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0026] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.
[0027] Example 1: Construction of expression vectors for CBE and control proteins
[0028] (1) The pCDHblast MCSNard OST-LMNA (Addgene#22661) vector was double-digested at 37℃ for 1 h using the NEB restriction enzyme kit (R3136S and R3101S). After separation and purification by agarose gel electrophoresis, the digested vector was recovered by gel excision using the Omega gel recovery kit (D2500). The enzyme digestion system is shown in Table 1.
[0029] Table 1 Enzyme digestion system
[0030]
[0031] (2) High-fidelity PCR was performed from the corresponding plasmids using the following primers. The PCR products were cloned into the backbone using the Novizan ClonExpress II One Step Cloning Kit (C112-01) to obtain the corresponding CBE expression vector with V5 tag or control protein expression vector.
[0032] Table 2 Primer and plasmid information
[0033] forward primer reverse primer Amplification length Template plasmid (Addgene#) Obtain plasmid GAM-F GAM-R 6.1kb 100806 pCDH-V5-BE4-Gam CABE-F CABE-R 5.7kb 119802 pCDH-V5-CP1028-CBEmax YE1-F GAM-R 5.2kb 85174 pCDH-V5-YE1-BE3 CABE-F CABE-R 5.6kb 139998 pCDH-V5-CBE4max-SpG CABE-F CABE-R 5.6kb 139999 pCDH-V5-CBE4max-SpRY CABE-F CABE-R 5.6kb 112094 pCDH-V5-AncBE4max YE1-F GAM-R 5.5kb 108381 pCDH-V5-xCas9(3.7)-BE4 AID-F AID-R 4.9kb 83260 pCDH-V5-AID ABE8.8-F ABE8.8-R 4.9kb 136294 pCDH-V5-ABE8.8m CABE-F CABE-R 5.7kb 140252 pCDH-V5-CGBE D10A-F D10A-R 4.2kb 85174 pCDH-V5-nCas9(D10A) SpRy-F SpRy-R 4.2kb 139999 pCDH-V5-nCas9(SpRY)
[0034] The primer sequences are as follows:
[0035] GAM-F:
[0036] agagctagcgaattggggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccATGGCTAAACCAGCAAAACGTAT;
[0037] GAM-R: agcggccgcctcgaggaattcTTAGACTTTCCTCTTCTTCTTGGGA;
[0038] CABE-F:
[0039] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccAAACGGACAGCCGACGGA;
[0040] CABE-R:agcggccgcctcgaggaattcCTAGACTTTCCTCTTCTTCTTGGGC;
[0041] YE1-F:
[0042] agagctagcgaattgggatccatgggcaagcccatccccaacccctgctgggcctggacagcaccATGAG CTCAGAGACTGGCCCA;
[0043] AID-F:
[0044] agagctagcgaattgggatccatgggcaagcccatccccaacccctgctgggcctggacagcaccGCCCC AAAGAAGAAGCGG;
[0045] AID-R:agcggccgcctcgaggaattcttaGGGCAAAAGGATGCGCCG;
[0046] ABE8.8-F:
[0047] agagctagcgaattgggatccatgggcaagcccatccccaacccctgctgggcctggacagcaccATGTC CGAAGTCGAGTTTTCCC;
[0048] ABE8.8-R:agcggccgcctcgaggaattcTTAGACTTTCCTCTTCTTCTTGGGG:
[0049] D10A-F:
[0050] agagctagcgaattgggatccatgggcaagcccatccccaacccctgctgggcctggacagcaccGATAA AAAGTATTCTATTGGTTTAGCCAT;
[0051] D10A-R:gcggccgcctcgaggaattcttaGTCACCCCCAAGCTGTGACA;
[0052] SpRy-F:
[0053] agagctagcgaattgggatccatgggcaagcccatccccaaccccctgctgggcctggacagcaccGACAA GAAGTACAGCATCGGCC;
[0054] SpRy-R: gcggccgcctcgaggaattcttaGTCACCTCCCAGCTGAGACAGG.
[0055] The PCR reaction system is shown in Table 3:
[0056] Table 3 PCR reaction system
[0057]
[0058]
[0059] The PCR reaction procedure is shown in Table 4:
[0060] Table 4 PCR reaction procedures
[0061]
[0062] (3) The amplified PCR products were subjected to agarose gel electrophoresis and the gel was excised and recovered. The PCR products were ligated to the vector backbone using Gibson Assembly. The reaction conditions were 37℃ for 40 min. The reaction system is shown in Table 5.
[0063] Table 5 Reaction System
[0064]
[0065] (4) Add all the ligation product to 50 μL of stbl3 competent cells, mix well, and incubate on ice for 20 min. After heat activation at 42℃ for 1 min, incubate on ice for 2 min. Add 300 μL of SOC medium and incubate in a shaker at 37℃ for 1 h.
[0066] (5) Take 100 μL of the bacterial culture after 1 h of culture and inoculate it evenly onto an LB plate containing ampicillin. Place the plate in a 37°C incubator and incubate overnight.
[0067] (6) Select a single colony on the plate and perform colony PCR. After 1% agarose gel electrophoresis, select the bacterial solution corresponding to a single bright band for sequencing confirmation. Extract plasmids from the bacterial solution with the correct sequencing sequence using a plasmid extraction kit, measure the concentration, and store at -40℃ for later use.
[0068] Example 2: Construction of a stable protein fusion vector
[0069] Using primers CBE-SPRY-F / R and pCDH-V5-CBE4max-SpRY as a template, PCR amplification was performed to obtain PCR fragment 1 (5628 bp in length).
[0070] The primer CBE-SPRY-F / R sequence is as follows:
[0071] CBE-SPRY-F: AGAGCTAGCGAATTGGGATCCATGGGCAAGCCCATCCCC;
[0072] CBE-SPRY-R:TCCACCGACTTTCCTCTTCTTCTTGGGCT.
[0073] Using primers 13xLinker-F / R and plasmid MCS-13X Linker-BioID2-HA (Addgene#80899) as a template, PCR amplification was performed to obtain PCR fragment 2 (233bp).
[0074] The primer 13xLinker-F / R sequence is as follows:
[0075] 13XLINKER-F: AGAAGAGGAAAGTCGGTGGAGGCGGGTCTGGA;
[0076] 13XLINKER-R:AGCGGCCGCCTCGAGGAATTCCGATCCACCGCCTCCGCT.
[0077] The three fragments—PCR fragment 1, PCR fragment 2, and the backbone digested by double enzyme digestion of pCDHblast MCSNard OST-LMNA BamH I / EcoR I—were ligated using Gibson Assembly to obtain the pCDH-V5-CBE4max-SPRY-13xlinker plasmid.
[0078] The nucleotide sequence of V5-CBE4max-SPRY-13xlinker is shown in SEQ ID NO: 1.
[0079] The gene coding sequences of UCHL1 (Ubiquitin C-Terminal Hydrolase L1), TIGAR (TP53 Induced Glycolysis Regulatory Phosphatase), SNCB (Synuclein Beta), SCGN (Secretagogin, EF-Hand Calcium Binding Protein), GSTM3 (Glutathione S-Transferase Mu 3), OTUB1 (OTUDeubiquitinase, Ubiquitin Aldehyde Binding 1), YWHAQ (Tyrosine 3-Monooxygenase / Tryptophan 5-Monooxygenase Activation Protein Theta), TBCB (Tubulin Folding Cofactor B), PHYHD1 (Phytanoyl-CoA Dioxygenase Domain Containing 1), and FBXO2 (F-Box Protein 2) were synthesized. PCR amplification was performed using corresponding primers, and the resulting sequences were ligated into the pCDH-V5-CBE4max-SPRY-13xlinker plasmid using Gibon Assembly. The corresponding fusion protein expression vector was obtained by digesting the backbone with a single enzyme. The amplification, ligation, and transformation steps were as described in Example 1.
[0080] The nucleotide sequence of the expressed fusion protein V5-CBE4max-SpRY-13xLinker-UCHL1 is shown in SEQ ID NO: 2.
[0081] The corresponding primer sequences are as follows:
[0082] UCHL1-F:GGTGGATCGGAATTCCTCGAGATGCAGCTCAAGCCGATGG;
[0083] UCHL1-R: CTATTTAGCGGCCGCCTCGAGTTAGGCTGCCTTGCAGAGAGC;
[0084] TIGAR-F: GGTGGATCGGAATTCCTCGAGATGGCTCGCTTCGCTCTGA;
[0085] TIGAR-R: CTATTTAGCGGCCGCCTCGAGTTAGCGAGTTTCAGTCAGTCCATT;
[0086] SNCB-F:GGTGGATCGGAATTCCTCGAGATGGACGTGTTCATGAAGGGC;
[0087] SNCB-R:CTATTTAGCGGCCGCCTCGAGCTACGCCTCTGGCTCATACTCC;
[0088] SCGN-F:GGTGGATCGGAATTCCTCGAGATGGACAGCTCCCGGGAA;
[0089] SCGN-R:TATTTAGCGGCCGCCTCGAGTTATGGGTTGATTTTCAGCCCA;
[0090] GSTM3-F:GGTGGATCGGAATTCCTCGAGATGTCGTGCGAGTCGTCTATGG;
[0091] GSTM3-R:CTATTTAGCGGCCGCCTCGAGTCAGCATACAGGCTTGTTGCC;
[0092] OTUB1-F:GGTGGATCGGAATTCCTCGAGATGGCGGCGGAGGAACCT;
[0093] OTUB1-R:CTATTTAGCGGCCGCCTCGAGCTATTTGTAGAGGATATCGTAGTGTCCA;YWHAQ-F:GGTGGATCGGAATTCCTCGAGATGGAGAAGACTGAGCTGATCCA;
[0094] YWHAQ-R:CTATTTAGCGGCCGCCTCGAGTTAGTTTTCAGCCCCTTCTGCC;
[0095] TBCB-F:GGTGGATCGGAATTCCTCGAGATGGAGGTGACGGGGGTG;
[0096] TBCB-R:CTATTTAGCGGCCGCCTCGAGTCATATCTCGTCCAACCCGTAGT;
[0097] PHYHD1-F:GGTGGATCGGAATTCCTCGAGATGGCCTGCCTGAGCCCC;
[0098] PHYHD1-R: CTATTTAGCGGCCGCCTCGAGTTAGGTGTACAGTTGGGGAAAGG;
[0099] FBXO2-F:GGTGGATCGGAATTCCTCGAGATGGACGGAGACGGTGACCC;
[0100] FBXO2-R: CTATTTAGCGGCCGCCTCGAGTCAGGGTTCTACCCACACGC.
[0101] Example 3: sgRNA Cloning
[0102] After digestion with BsmB I, the Lentiguide plasmid was annealed with primers gRNA-F and gRNA-R, and then ligated into the Lentiguide vector using Solution I (Takara's DNA Ligation Kit Ver. 2.1, catalog number 6022). The reaction conditions were 16°C for 30 min. The ligation system is shown in the table below. Transformation and other steps were performed as described in Example 1.
[0103] Table 5 Connection System
[0104]
[0105]
[0106] The primer sequences are as follows:
[0107] gRNA-F:CACCGGTGCTCTCCACTGACACAG;
[0108] gRNA-R: AAACCTGTGTCAGTGGAGAGCACC.
[0109] Example 4: 293T cell transfection
[0110] HEK-293T cells were seeded in 6cm cell culture dishes. On the second day, when the cell density reached 90%, the complete culture medium (DMEM containing 10% FBS) was discarded, and 1mL of 1640 medium containing 5% FBS at 37℃ was added. The mixture was then incubated at 37℃ for 30min. Plasmid was added to a 1.5mL EP tube, followed by Opti-MEM to a total volume of 100μL. After thorough mixing, the mixture was incubated at room temperature for 5min.
[0111] Take the required amount of PEI solution (4 μL PEI per 1 μg plasmid) and add it to a 1.5 mL EP tube. Add Opti-MEM to bring the total volume to 100 μL, mix thoroughly, and let stand at room temperature for 5 min. Mix the plasmid solution and PEI dilution thoroughly and let stand at room temperature for 15 min. Add the mixture dropwise to HEK-293T cells evenly and incubate at 37°C for 5 h. Discard the liquid in the culture dish and add 4 mL of preheated (37°C) complete culture medium.
[0112] The results are as follows:
[0113] (1) Common CBE editor proteins are unstable.
[0114] Common CBE editors (xCas9(3.7)BE4, CP1028CBEmax, BE4 GAM, CBE4max SpG, CBE4max SpRY, YE1 BE3, ancBE4max, and AID) were expressed using the pCDH vector, with nCas9 (nCas9(D10A) and nCas9(SpRY)), CGBE, and ABE8.8m as controls expressed in the same vector. Forty-eight hours after transfection into 293T cells, cycloheximide (CHX) treatment was applied for different time periods to inhibit translation. Protein expression levels were detected by Western blot (e.g., ...). Figure 1 (As shown in Figure A). By comparing the protein expression levels at different time points after translation inhibition, the proteins of nCas9 (nCas9(D10A) and nCas9(SpRY)), CGBE, and ABE8.8m showed high stability, while the proteins of the CBE editor were all unstable and rapidly degraded in the cell (e.g., ...). Figure 1 (As shown in B and C).
[0115] (2) The ubiquitination degradation pathway is one of the main pathways of protein degradation in cells.
[0116] By inhibiting intracellular protein translation (CHX treatment for 8 hours), and simultaneously inhibiting the ubiquitination degradation pathway (addition of MG132, a proteasome inhibitor), the degradation of CBE protein (e.g.) can be significantly suppressed. Figure 2 (As shown). MG132 treatment had no significant effect on nCas9, CGBE, and ABE, indicating that MG132 treatment of cells is a method to increase the stability of CBE single-base editor proteins.
[0117] (3) The application of CBE single base editors may be limited because MG132 treatment of cells may be toxic.
[0118] The stability of CBE protein was enhanced by fusing deubiquitinated genes. First, an intersection analysis was performed on the genes involved in protein stabilization identified by the two strategies (P <= 0.001, FC >= 2 for both strategies), revealing three ubiquitination-related proteins (FBXO2, UCHL1, and OTUB1). Figure 3 (A and B). In addition, seven other types of genes with protein stabilizing functions were randomly selected. These genes were then fused to the C-terminus of CBE4max SpRY (…). Figure 3 (C). It was found that, except for FBXO2, these gene fusions all played a role in stabilizing the CBE4max SpRY protein to some extent. Among them, UCHL1 fusion showed the largest increase (…). Figure 3 (D).
[0119] To explore whether increasing the stability of CBE could improve editing efficiency, C-to-T gene editing at specific sites in the genome was performed in 293T cells via plasmid transfection. Compared with the CBE SpRY editor without UCHL1 fusion, the single-base editor fused with UCHL1 significantly improved the editing efficiency at the relevant sites. Figure 3 (E).
[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A CBE editing protein, characterized in that, The CBE-editing protein is fused with a protein expressed by a deubiquitinated gene, and the nucleotide sequence encoding the protein is shown in SEQ ID NO:
2.
2. An expression carrier, characterized in that, Expressing the CBE-editing protein of claim 1.
3. The expression vector according to claim 2, characterized in that, Includes the nucleotide sequence shown in SEQ ID NO:
1.
4. A nucleic acid encoding the CBE-editing protein of claim 1.
5. A CBE editing system, characterized in that, Includes the CBE editing protein as described in claim 1.
6. The application of the CBE editing protein of claim 1, the expression vector of claim 2 or 3, the nucleic acid of claim 4, and the CBE editing system of claim 5 in gene editing for purposes other than disease diagnosis and treatment.
7. The application according to claim 6, characterized in that, The editing refers to C-to-T gene editing at a specific site.