MiRNA-a for inhibiting zika virus and application thereof

Abstract

The application discloses a Zika virus inhibiting miRNA-A and application thereof, and belongs to the technical field of biology. The sequence of the miRNA-A is as follows: a positive strand: 5'-UUAGUGUUGUCAGGCCUGCUA-3'; and a negative strand: 5'-UAGCAGGCCUGACAACACUAA-3'. Compared with the known vsiRNA-1 sequence in the prior art, the vsiRNA-A provided by the application has a better Zika virus inhibiting effect, and more choices are provided for the treatment of Zika virus related diseases.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a miRNA-A that inhibits Zika virus and its application. Background Technology

[0002] Zika virus can cross the placental barrier and enter the fetus, causing abnormal proliferation and differentiation of neural stem cells in the embryonic brain, resulting in the death of a large number of neurons and causing a serious complication - microcephaly in newborns.

[0003] Zika virus (ZIKV) is a single-stranded, positive-sense RNA virus belonging to the genus Flaviviridae in the family Flaviviridae. It was first discovered in rhesus monkeys in the Zika Forest of Uganda in 1947, hence its name. ZIKV is an icosahedral virus enclosed in an envelope, approximately 40-60 nm in diameter. A mature ZIKV virus contains an inner nucleocapsid composed of linear positive-sense genomic RNA and multiple copies of viral capsid protein C, and an outer envelope composed of two viral proteins: the M protein (Viral Membrane) and the E protein (Viral Envelope), and a lipid bilayer derived from the cell membrane. The M protein is formed by the cleavage of the viral prM protein precursor by a protease. During viral particle assembly, the ZIKV prM and E proteins interact and form a dimer in the host's endoplasmic reticulum. At this point, the viral RNA genome is recognized and encapsulated by viral capsid protein C, and subsequently recognized and further encapsulated by the dimer formed by the prM and E proteins and the cell membrane lipid bilayer, forming an immature ZIKV virus. Subsequently, the prM protein is recognized and cleaved by the phrine protease on the Golgi apparatus into mature M protein, which in turn triggers the release of ZIKV viral particles, forming mature ZIKV viral particles that are released outside the cell.

[0004] The genome of ZIKV virus is a single-stranded positive-sense RNA containing a single open reading frame, approximately 11,000 bp in length, consisting of a coding region and two untranslated regions (UTRs) at the 5' and 3' ends; it encodes approximately 3,500 amino acids. From the N-terminus to the C-terminus, the ZIKV RNA genome encodes three structural proteins: capsid protein C, envelope protein E, and membrane precursor protein prM, and seven non-structural proteins: NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5.

[0005] The Zika virus replicates within the epithelial cells of Aedes aegypti and Aedes albopictus mosquitoes and circulates in their blood and saliva. It is primarily transmitted through mosquito bites and can infect adults and newborns via mosquito-borne transmission and sexual contact. It can cause various neurological disorders, such as encephalopathy, meningoencephalitis, myelitis, and Guillain-Barré syndrome. More seriously, the Zika virus has a strong affinity for human neural stem cells, capable of crossing the blood-brain barrier and causing abnormal proliferation and differentiation of neural stem cells in the embryonic brain, resulting in massive neuronal death and serious complications—microcephaly in newborns, and even miscarriage or fetal death.

[0006] Zika virus has become a potential threat to global human health and has been designated a Public Health Emergency of International Concern by the World Health Organization (WHO). Zika virus infection remains a significant and persistent health challenge. However, current research on the replication and pathogenesis mechanisms of Zika virus is insufficient, and there is still a lack of approved vaccines or specific treatments to prevent or treat Zika virus infection. Therefore, developing specific anti-ZIKV drugs to treat related diseases is the most effective strategy to address the serious challenges posed by Zika virus infection to human society. Summary of the Invention

[0007] One objective of this invention is to provide a miRNA for inhibiting Zika virus, the sequence of which is as follows:

[0008] Positive strand: 5'-UUAGUGUUGUCAGGCCUGCUA-3';

[0009] Negative strand: 5'-UAGCAGGCCUGACAACACUAA-3'.

[0010] A second objective of this invention is to provide a vector containing the above-mentioned miRNA.

[0011] Preferably, the vector is a viral vector or a liposome vector.

[0012] More preferably, the viral vector is an adenovirus vector.

[0013] A third objective of this invention is to provide the application of the above-mentioned miRNA or vector in the preparation of products for inhibiting Zika virus.

[0014] Preferably, the product is a reagent or a kit.

[0015] More preferably, the product is a drug.

[0016] A fourth objective of this invention is to provide a product for inhibiting Zika virus, wherein the product contains the aforementioned miRNA or vector.

[0017] Preferably, the product is a reagent or a kit.

[0018] Preferably, the product is a drug.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The vsiRNA-A provided by this invention has a better inhibitory effect on Zika virus, providing more options for the treatment of Zika virus-related diseases. Attached Figure Description

[0021] Figure 1 The image shows the results of transfecting vsiRNA-A into SK-N-BE(2) cells in Example 1 to inhibit the expression of protein E encoded by Zika virus strains MR766 and PRVABC.59.

[0022] Figure 2 The image shows the results of transfection with vsiRNA-A in SK-N-BE(2) cells in Example 1, which inhibited the mRNA expression of the gene E encoding Zika virus strains MR766 and PRVABC.59.

[0023] Figure 3 The image shows the results of comparing the inhibition of mRNA expression of the encoding genes NS5 and E of Zika virus strains MR766 and PRVABC.59 by transfecting vsiRNA-A and vsiRNA-1 in SK-N-BE(2) cells in Example 1.

[0024] Figure 4 The image shows the results of a confocal assay comparing the expression of genes E and dsRNA that inhibit Zika virus strains MR766 and PRVABC.59 in SK-N-BE(2) cells transfected with vsiRNA-A and vsiRNA-1 in Example 1. dsRNA refers to the double-stranded RNA complex of the virus during replication and is generally used to indicate viral replication.

[0025] Figure 5 The image shows the results of viral plaque assay comparing the inhibition of Zika virus strains MR766 and PRVABC.59 after transfection with vsiRNA-A and vsiRNA-1 in SK-N-BE(2) cells in Example 1.

[0026] Figure 6 The figure shows the morbidity and mortality results of mice after being infected with Zika virus following injection of vsiRNA-A and vsiRNA-1 into the brain region of C57 newborn mice in Example 1.

[0027] Figure 7 This is a graph showing the results of the viral load in the brains of C57 newborn mice after injecting vsiRNA-A and vsiRNA-1 into the brain region, respectively, and infecting them with Zika virus, as determined by a viral plaque assay on Day 9 in Example 1. Detailed Implementation

[0028] The vsiRNA-A sequence used in the following examples is:

[0029] Positive strand (SEQ ID NO.1): 5'-UUAGUGUUGUCAGGCCUGCUA-3';

[0030] Negative strand (SEQ ID NO. 2): 5'-UAGCAGGCCUGACAACACUAA-3'.

[0031] Positive control group vsiRNA-1 sequence (patent pending, application number 202210331697.5):

[0032] Positive strand (SEQ ID NO.3): 5'-AACGAGAGUUUCUGGUCAUGA-3';

[0033] Negative strand (SEQ ID NO. 4): 5'-UCAUGACCAGAAACUCUCGUU-3'.

[0034] The sequence of the Scramble mimic is as follows:

[0035] Positive strand (SEQ ID NO.5): UGCCUUCAAUUGUGUUAACCUC;

[0036] Negative strand (SEQ ID NO. 6): GAGGUUAACACAAUUGAAGGCA.

[0037] Example 1

[0038] 1. Cell RNA transfection:

[0039] When transfecting RNA into cells, RNase contamination must be strictly controlled, and all pipette tips and Opti-MEM reagents must be RNase-free.

[0040] (1) SK-N-BE(2) cells were infected with Zika virus strains MR766 and PRVABC.59, respectively. Then, SK-N-BE(2) cells were seeded in 6-well plates 24 hours in advance and transfected when the cells reached a confluence of 50-60%.

[0041] (2) Take two RNase-free EP tubes and add 100 μL of RNase-free opti-MEM medium to each tube;

[0042] (3) Add an appropriate amount of RNA to be transfected into one tube and add 5 μL of lipo-2000 transfection reagent (vsiRNA-Amimic, vsiRNA-1mimic and Scramble mimic transfect separately, each transfected at a rate of 60 pmol) into the other tube. Mix them separately and then mix the culture medium in the two tubes. Gently pipette to mix and let stand at room temperature for 15 min.

[0043] (4) Take the cells to be transfected out of the cell culture incubator, gently add the culture medium from (3) into the cell supernatant, shake the culture plate to disperse it evenly, and put it into the incubator to continue culturing for 12 hours;

[0044] (5) Discard the cell supernatant, replace it with fresh complete culture medium, and continue culturing for 36 hours before proceeding with subsequent operations.

[0045] 2. Extraction and quantification of total cell protein

[0046] Remove the processed cells from the cell culture incubator and place them on a cell clean bench; use a 1ml pipette to remove the cell supernatant (if the cells are supernatant that has been infected with a virus, the supernatant needs to be placed in a waste liquid container containing 84 disinfectant for 24-48 hours to kill the pathogens).

[0047] (1) Gently rinse the cells with 1 ml of PBS and discard the supernatant;

[0048] (2) Resuspend the cells in 1 ml PBS. If the cells are attached tightly, you can scrape them off with a cell scraper and transfer them into a 1.5 ml EP tube; centrifuge at 500 g for 5 min.

[0049] (3) Discard the supernatant, add 50-100 μL of RIPA lysis buffer containing protease inhibitor to resuspend the cells according to the amount of cell pellet, and lyse on ice for 30-60 min; then centrifuge at 13000 rpm / min for 15 min.

[0050] (4) Transfer the supernatant of the lysis buffer into a new EP tube, take 5 μL of protein for protein quantification, and add the remaining protein to 5x loading buffer to prepare a 1x loading buffer sample; incubate at 100°C for 10 min, then at -80°C for later use.

[0051] (5) Quantify the protein samples according to the Beyotime BCA Protein Quantification Kit (Beyotime, #P0010S) protocol; the specific steps are as follows: ① Add BCA standards to a 96-well plate at concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml; ② Add 2 μl of sample to each well of the 96-well plate. If the sample is less than 20 μl, add standard diluent to make up to 20 μl. Please record the sample volume; ③ Add 200 μl of BCA working solution to each well and incubate at 37℃ for 30-45 min; ④ Measure the absorbance at A562 or a wavelength between 540-595 nm using a microplate reader; ⑤ Calculate the protein concentration of the sample based on the standard curve and the sample volume used.

[0052] 3. Western blot assay

[0053] (1) Preparation of protein electrophoresis gel: After the protein electrophoresis samples are prepared, prepare the protein gel according to the experimental steps of the Enzyme Biotech SDS-PAGE protein gel kit (taking a 10% 1.0 mm 10-well protein gel as an example):

[0054] ①Wash the glue-making glass plate with deionized water, dry it, and then install it in the glue-fitting fixing plate;

[0055] ② Prepare approximately 5 ml of 10% lower layer gel, mix well, and slowly add it to the gel plate using a pipette to avoid generating air bubbles. Add 1 ml of ethanol to press the line to isolate air and flatten the gel surface. Let it stand at room temperature for 30-60 minutes.

[0056] ③ After the lower layer of gel solidifies, remove the ethanol, rinse with deionized water, and then absorb the remaining moisture.

[0057] ④ Prepare approximately 2 ml of the upper layer gel and slowly add it to the middle of the gel plate, avoiding the formation of air bubbles. Gently add the sample comb to the well plate and let it stand at room temperature for 30 minutes to complete the preparation of the protein electrophoresis gel.

[0058] (2) Sample loading: Install the prepared protein electrophoresis gel into the Bio-Rad electrophoresis tank, add 1x SDS protein electrophoresis buffer to the inner and outer tanks respectively, and gently pull out the comb; according to the experimental requirements, slowly add the denatured protein sample to the corresponding well at a rate of 20-40ug per well, and reserve the sample loading well for adding pre-stained protein marker to determine the amount of protein;

[0059] (3) Electrophoresis: Connect the electrophoresis apparatus to the power supply. First, use a constant voltage of 70V for about 30 minutes. When the sample runs into the lower gel, adjust the voltage to 110V and continue electrophoresis for about 1.5-2 hours. Stop electrophoresis when the target band runs to the appropriate position.

[0060] (4) Transfer: Cut the PVDF membrane to a suitable size and immerse it completely in the methanol solution for about 30 seconds to activate the membrane surface; then transfer the protein gel into the transfer solution, gently remove the protein gel, and in the order of black side-sponge pad-filter paper-protein gel-PVDF membrane-filter paper-white side, tightly attach the protein gel and PVDF membrane to form a "sandwich" transfer structure. After removing air bubbles, place the transfer clamp in the transfer tank according to the corresponding electrode direction; add transfer buffer to the mark and then move the transfer tank into the cold storage, and transfer the membrane at a constant current of 200mA for 2-3 hours.

[0061] (5) Membrane sealing: Prepare a 5% skim milk powder or BSA membrane sealing solution with TBST, and completely immerse the PVDF membrane after transfer in the sealing solution and seal at room temperature for 1 hour;

[0062] (6) Antibody incubation: ① Wash the blocked PVDF membrane three times with TBST, 5 min each time; ② Trim the target band and add it to the corresponding primary antibody solution, incubate overnight at 4℃; ③ Remove the antibody and wash three times with TBST, 10 min each time; ④ Add the prepared secondary antibody solution to the corresponding membrane and incubate at room temperature for 45-60 min; ⑤ Wash three times with TBST, 10 min each time.

[0063] (7) ECL development: Place the PVDF membrane protein side up, add ECL chemiluminescence solution, incubate for 1-2 min, then develop with an ultrasensitive chemiluminescence imager and save the image results for data analysis.

[0064] 4. Cell RNA Extraction

[0065] RNA extraction was performed using the Trizol method, and the entire process had to be carried out on ice. All consumables used were RNase-free.

[0066] (1) Discard the cell supernatant culture medium from the 6-well plate, wash once with PBS, add 1 ml of Trizol solution to each well, gently blow the cells off, and transfer them to a 1.5 ml RNase-free EP tube;

[0067] (2) Place the EP tube in a vibratory rotator and vortex for a few seconds, or freeze the EP tube in a -80°C freezer and freeze-thaw once to better promote cell lysis.

[0068] (3) Add 200 μL of chloroform to the tube at a ratio of 1:5, vortex for 5-10 seconds, let stand on ice for 5 minutes, then invert and mix 3-5 times, and centrifuge at 13000 rpm / min at 4℃ for 15 minutes;

[0069] (4) Remove the EP tube and place it on ice. At this time, the liquid in the tube has separated into layers. Slowly aspirate the upper transparent liquid into a new 2ml RNase-free EP tube (about 500-600ul). Add 2.5-3 times the volume of anhydrous ethanol to each tube (add 10ul of sodium acetate and 1ul of glycogen to every 600ul of anhydrous ethanol). Quickly invert the EP tube at the upper limit to mix well, and then freeze at -80℃ overnight.

[0070] (5) Remove the EP tube and place it on ice for 5-10 min, then centrifuge at 13000 rpm / min at 4℃ for 15 min, discarding the supernatant;

[0071] (6) Add 1.0 ml of 75% anhydrous ethanol (prepared with DEPC water) and continue centrifuging at 13000 rpm / min for 15 min at 4℃;

[0072] (7) Gently aspirate the supernatant, open the tube cap to allow the residual ethanol in the tube to evaporate, then add 30-50ul of DEPC water to dissolve it, measure the concentration and continue to use it for subsequent experiments or freeze it at -80.

[0073] 5RT-PCR:

[0074] Total RNA was extracted from experimental cells using cDNA synthesis and real-time PCR, and then reversed using a cDNA synthesis kit (Takara).

[0075] 1 μg of RNA was used to obtain cDNA, and then 20 p1 of cDNA was analyzed by quantitative PCR (RT-qPCR) using SYBR Green Supermix reagent (Bio-Rad). The results are shown in [link to results]. Figure 2 and Figure 3 Gene expression levels were normalized to GAPDH. Relative mRNA expression was calculated as 2 using the cycle threshold variation method. -△△C(t) The specificity of RT-qPCR amplification was assessed by melting curve analysis.

[0076] 6. Cell Immunofluorescence Assay

[0077] (1) Culture the cells in a confocal cell culture dish for 12 hours in advance until the cells are fully attached;

[0078] (2) Remove the cell supernatant, add 1 ml of room temperature PBS solution, and wash away the non-adherent cells in the upper cell layer;

[0079] (3) Add 1 ml of 4% paraformaldehyde and incubate at room temperature for 15 min;

[0080] (4) Discard the paraformaldehyde and add 1 ml of PBS to wash away the residual liquid;

[0081] (5) Prepare cell permeation solution (PBS solution containing 0.5% Triton X-100), add it to a culture dish, and permeate at room temperature for 15 min;

[0082] (6) Discard the supernatant and wash once with PBS;

[0083] (7) Add 1 ml of PBS blocking solution containing 2% BSA and incubate at room temperature for 1 h;

[0084] (8) Prepare primary antibody with PBST solution containing 1% BSA at a ratio of 1:100-500, and incubate overnight at 4°C in a humidified chamber;

[0085] (9) Remove the primary antibody solution and wash three times with 0.2% PBS on a shaker for 5 minutes each time;

[0086] (10) Prepare secondary antibody solution with 1% BSA in PBST solution and incubate at 4°C in the dark for 30 min;

[0087] (11) Discard the secondary antibody solution and continue washing three times with 0.2% PBS on a shaker for 5 minutes each time.

[0088] (12) Add the DAPI nuclear dye dilution solution and incubate in the dark for 10 min;

[0089] (13) Wash the cells three times with 0.2% PBS on a shaker for 5 minutes each time to complete the immunofluorescence staining. Immediately afterwards, photograph the samples using a confocal microscope. See the results below. Figure 4 .

[0090] 7. ZIKV virus titer determination (plaque assay)

[0091] Vero cells were cultured in 24-well plates until approximately 90% confluence. The viral strains (Zika virus strains MR766 and PRVABC.59) were then serially diluted 10-fold with DMEM medium, with seven consecutive dilutions (10, 10, ...). 2 10 3 10 4 10 5 10 6 10 7Add 500 μL of virus solutions of each gradient to the cells and incubate at 37°C for 2 hours. Discard the supernatant, then add fresh MEM medium containing 1% FBS and agar to each well. After the agar solidifies, invert the 12-well plate and continue incubating for 3-5 days, observing the appearance of cell plaque formation (CPE). When obvious CPE appears, discard the supernatant, add 500 μL of 4% paraformaldehyde solution, and fix the cells at room temperature for 1 hour. Discard the supernatant, gently rinse the wells with sterile water to remove the gel, add 500 μL of staining solution containing 1.5% crystal violet, and stain for 30 minutes. Discard the stain, gently rinse the remaining stain with water, and observe the formation of cell plaques under white light. Take cell wells with appropriate dilutions for plaque counting, and calculate the final virus titer using the formula: Virus titer = (number of plaques) x (dilution factor x 2) PFU / ml. See the results below. Figure 5 .

[0092] 8. ZIKV infection of suckling mice experiment

[0093] We used the PRVABC.59 strain of ZIKV to establish a ZIKV infection model in neonatal mice. On the first day of life, we injected 4 μl of 10 mg / ml mouse IFNR-1 antibody into the left and right hemispheres of each C57 neonatal mouse. Subsequently, the mice were randomly divided into three groups of 10 mice each. Then, each group was injected with either vsiRNA-Amimic, vsiRNA-1mimic, or Scramble mimic into the left and right hemispheres, respectively, at a dose of 2 nmol per mouse. A second injection was given on the fourth day. Twelve hours later, 2 μl of ZIKV (1*10) was injected into the left and right hemispheres of each group. 5 PFU was administered only once. The suckling mice were continued to be fed, and their weight, health score, and mortality rate were monitored daily. The experiment ended at the death of the suckling mice (9 days). Results are shown in [link to results]. Figure 6 .

[0094] Mice were dissected at the end of the experiment, weighed, and photographed. One-quarter of the brain was harvested for RNA extraction to detect viral load in the brain (see [link to experiment]). Figure 7 The changes in 1 / 4 of the brain and vsiRNA were observed, and another 1 / 4 of the brain was cryopreserved in liquid nitrogen for later use. Finally, the remaining 1 / 2 of the brain was fixed and sectioned, and immunohistochemistry and in situ hybridization techniques were used to analyze the differences in mouse brain development and differentiation, viral load and vsiRNA expression.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A miRNA for inhibiting Zika virus, characterized in that, The sequence of the miRNA is as follows: Positive strand: 5'-UUAGUGUUGUCAGGCCUGCUA-3'; Negative strand: 5'-UAGCAGGCCUGACAACACUAA-3'.

2. A vector comprising the miRNA of claim 1.

3. The carrier according to claim 2, characterized in that, The vector is a viral vector or a liposome vector.

4. The carrier according to claim 3, characterized in that, The viral vector is an adenovirus vector.

5. The use of the miRNA of claim 1 or the vector of any one of claims 2-4 in the preparation of products for inhibiting Zika virus.

6. The application according to claim 5, characterized in that, The product is a reagent or kit.

7. The application according to claim 5, characterized in that, The product is a medicine.

8. A product for inhibiting Zika virus, characterized in that, The product contains the miRNA of claim 1 or the vector of any one of claims 2-4.

9. The product according to claim 8, characterized in that, The product is a reagent or kit.

10. The product according to claim 8, characterized in that, The product is a medicine.

Images