Primer probe combination, kit and method for simultaneously detecting chicken infectious anemia virus and chicken circle virus type 3 based on fluorescent RAA and application
Through the dual amplification technology based on fluorescent RAA, the design of specific primer probe combinations has solved the problem that the existing technology cannot simultaneously detect chicken infectious anemia virus and chicken circle virus type 3, and achieved rapid, high specificity and high sensitivity on-site detection, which is suitable for large-scale promotion and application.
Patent Information
- Application Number
- CN202510759261.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2045-06-09
AI Technical Summary
Existing virus detection methods such as conventional PCR and qPCR require complex thermal cyclers, which limit their application in the case of scarce medical resources and on-site detection, and cannot simultaneously detect chicken infectious anemia virus and chicken circle virus type 3, affecting the sensitivity and specificity of the detection.
Using dual amplification technology based on fluorescent RAA, a specific primer probe combination is designed, including RAA-C-F2, RAA-C-R1, RAA-C-P, RAA-G-F1, RAA-G-R3 and RAA-G-P, which are used to simultaneously detect chicken infectious anemia virus and chicken circle virus type 3, combining FAM and ROX fluorescence signal acquisition to achieve fast and efficient on-site detection.
It realizes rapid, high specificity and high sensitivity detection of chicken infectious anemia virus and chicken circle virus type 3, and does not require expensive instruments and equipment. It is suitable for large-scale promotion and application, with short detection time and sensitivity no less than single-weight detection.
Smart Images

Figure CN120400431A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of avian virus detection, and in particular to a primer-probe combination, a kit, a method and an application for simultaneously detecting Chicken infectious anaemia virus and Gyrovirus 3 in chickens based on fluorescence RAA. Background Art
[0002] Chicken infectious anaemia virus (CIAV) and Gyrovirus 3 (GyV3) can both cause aplastic anaemia and immunosuppression in chickens, and are often co-infected with other pathogens. Therefore, the detection of these two viruses in clinical practice is challenging.
[0003] After Chicken infectious anaemia virus was first reported in Japan in 1979, it has been detected almost worldwide, causing huge economic losses. Chicken infectious anaemia virus mainly invades the bone marrow hematopoietic tissue and the central immune organ thymus. The clinical symptoms are manifested as aplastic anaemia and systemic lymphoid tissue atrophy. Chickens are the only recognized natural host, and chickens of all ages can be infected, but the disease is common in chicks at 2-3 weeks of age. Single infection with Chicken infectious anaemia virus or co-infection with other pathogens will cause immunosuppression of the body and secondary diseases. Chicken infectious anaemia virus can be transmitted horizontally as well as vertically. In addition, Chicken infectious anaemia virus can also be transmitted through contaminated live poultry vaccines. Therefore, in terms of prevention and control, a method for specifically detecting Chicken infectious anaemia virus is particularly important.
[0004] Gyrovirus 3 (GyV3) is the third member of the genus Gyrovirus after Chicken infectious anaemia virus. The virus was first discovered in the diarrheal feces of Chilean children with acute gastroenteritis in 2012, and then detected in ferret feces, wild birds, commercial chickens and pet cats, indicating its wide host range. Studies have found that Chicken infectious anaemia virus and Gyrovirus 3 can co-infect in poultry flocks, and can synergistically promote immunosuppression, pathogenicity and virus replication in co-infected chickens. In view of the harm caused by these two viruses to the poultry farming industry, it is urgent to establish a rapid and sensitive detection system for on-site rapid detection.
[0005] At present, the main detection methods for viral pathogens are conventional PCR, qPCR, etc. However, these methods all require complex thermal cyclers, which limits their application in situations with scarce medical resources and on-site detection. In contrast, isothermal amplification technologies such as fluorescence RAA (Recombinase aided amplification) have the advantages of short detection time, no need for expensive instruments and equipment, being suitable for on-site rapid detection and large-scale popularization and application. For example, the patent application with publication number CN 114959120 A discloses a primer-probe set, kit and its application for detecting chicken infectious anemia virus by RAA fluorescence method. However, only the detection of chicken infectious anemia virus is achieved in this patent application, and it is impossible to detect chicken infectious anemia virus and chicken circovirus type 3 simultaneously. Compared with single detection, dual RAA can detect two pathogens simultaneously, so it has significant advantages such as higher efficiency and lower cost. However, due to many influencing factors, the sensitivity and specificity of detection are not as good as those of their respective single detections if not optimized well. In order to achieve the simultaneous rapid and efficient diagnosis of chicken infectious anemia virus and chicken circovirus type 3, this study established a rapid diagnosis method based on RAA technology, aiming to establish a dual fluorescence RAA detection technology with specificity and sensitivity not inferior to single detection, short amplification time, simple operation, no need for special instruments and professional laboratories, being convenient for on-site isothermal rapid detection and being more easily applied in clinical practice, providing a new technical means for the on-site detection of chicken infectious anemia virus and chicken circovirus type 3. Summary of the Invention
[0006] Aiming at the above deficiencies, the present invention provides a primer-probe combination, kit, method and application for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA, which can simultaneously detect chicken infectious anemia virus and chicken circovirus type 3, and has the advantages of simple detection method, high sensitivity, no need for expensive instruments and equipment, short detection time, and being suitable for large-scale popularization and application. The specific technical solutions are as follows:
[0007] The primer-probe combination for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA includes the following primer-probe sets:
[0008] The primer-probe set for detecting chicken infectious anemia virus consists of a primer pair composed of an upstream primer RAA-C-F2 shown in SEQ ID NO.2 and a downstream primer RAA-C-R1 shown in SEQ ID NO.5, and an RAA-C-P probe shown in SEQ ID NO.9; the specific sequences are as follows:
[0009] Upstream primer RAA-C-F2: 5′-TCACTCTATCGCTGTGTGGCTGCGCGAATG-3′ (SEQ ID NO.2);
[0010] Downstream primer RAA-C-R1: 5′-TTCTTCGAGGGAGGCTTGGGTTGATCGG-3′ (SEQ ID NO.5);
[0011] RAA-C-P probe:
[0012] 5′-GGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGG-3′ (SEQ ID NO.9);
[0013] The primer-probe set for detecting avian circovirus type 3 consists of the upstream primer RAA-G-F1 shown in SEQ ID NO.10, the downstream primer RAA-G-R3 shown in SEQ ID NO.16, and the RAA-G-P probe shown in SEQ ID NO.18; the specific sequences are as follows:
[0014] Upstream primer RAA-G-F1: 5′-TCAACCCACATCCGGGATCTTACCTGGT-3′ (SEQ ID NO.10);
[0015] Downstream primer RAA-G-R3: 5′-CCTTTAGTTGTGTCTGGTAAGTAGCTTGTG-3′ (SEQ ID NO.16);
[0016] RAA-G-P probe:
[0017] 5′-GACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCT-3′ (SEQ ID NO.18).
[0018] Preferably, in the above primer-probe combination, the 3′ end of the RAA-C-P probe is modified with C3 spacer block, and the 31st base from the 5′ end is modified with a fluorescent reporter group, the 32nd base is modified with a tetrahydrofuran residue, and the 33rd base is modified with a fluorescent quenching group;
[0019] The 3′ end of the RAA-G-P probe is modified with C3 spacer block, and the 31st base from the 5′ end is modified with a fluorescent reporter group, the 32nd base is modified with a tetrahydrofuran residue, and the 33rd base is modified with a fluorescent quenching group.
[0020] Preferably, in the above primer-probe combination, the fluorescent reporter group of the RAA-C-P probe is FAM, and the fluorescent quenching group is BHQ1; the fluorescent reporter group of the RAA-G-P probe is ROX, and the fluorescent quenching group is BHQ2;
[0021] The modified RAA-C-P probe is:
[0022] GGACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACTTGAGG-C3Spacer;
[0023] The modified RAA-G-P probe is:
[0024] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCAAGGGCT-C3Spacer.
[0025] On the other hand, the present invention also provides an application of the above primer-probe combination in the preparation of a product for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 by fluorescent RAA.
[0026] Preferably, in the above application, the product is a kit or a reagent.
[0027] On the other hand, the present invention also provides a kit for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescent RAA, and the kit includes the above primer-probe combination.
[0028] Preferably, in the above kit, the kit further includes: reaction dry powder, A Buffer, B Buffer, positive control, negative control; further, the negative control sample is enzyme-free water, and the positive control is a plasmid standard of chicken infectious anemia virus and a plasmid standard of chicken circovirus type 3.
[0029] On the other hand, the present invention also provides an application of the above primer-probe combination or the above kit in simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 for non-disease diagnosis or treatment purposes.
[0030] On the other hand, the present invention also provides a method for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescent RAA, comprising the following steps:
[0031] (1) Extract the DNA of the sample to be tested;
[0032] (2) Using the DNA of the sample to be tested as a template, perform double constant-temperature fluorescence amplification with the above primer-probe combination or the above kit to obtain a constant-temperature amplification curve;
[0033] (3) According to the constant-temperature amplification curve, determine whether the sample to be tested contains chicken infectious anemia virus or chicken circovirus type 3.
[0034] Preferably, in the above method, in step (2), the RAA reaction system for dual constant-temperature fluorescence amplification includes: a primer-probe group for detecting Chicken infectious anemia virus and a primer-probe group for detecting Chicken circovirus type 3. In the reaction system, the final concentrations of the upstream primer RAA-C-F2, the downstream primer RAA-C-R1, the upstream primer RAA-G-F1, and the downstream primer RAA-G-R3 are all 0.4 μM, and the final concentrations of the RAA-C-P probe and the RAA-G-P probe are both 0.12 μM.
[0035] Preferably, in the above method, in step (2), the reaction system for the constant-temperature fluorescence amplification is as follows: 25 μL of A buffer, 2.5 μL of B buffer, 2 μL each of the upstream and downstream primers for Chicken infectious anemia virus, 0.6 μL of the probe, 2 μL each of the upstream and downstream primers for Chicken circovirus type 3, 0.6 μL of the probe, 5 μL of the DNA template of the positive control or negative control or the sample to be tested, 8.3 μL of enzyme-free water, and the total volume is 50 μL; the concentrations of the upstream primer, the downstream primer, and the probe are all 10 μM; during the constant-temperature fluorescence amplification, 5 μL of the DNA template of the negative control or positive control or the sample to be tested is added to the reaction system for constant-temperature fluorescence amplification to obtain the constant-temperature amplification results of the negative control, positive control, and the sample to be tested respectively.
[0036] Preferably, in the above method, the reaction conditions for the constant-temperature fluorescence amplification are as follows: constant temperature at 39 °C, reaction time 20 min, and FAM fluorescence signal and ROX fluorescence signal are collected; further, the FAM channel represents Chicken infectious anemia virus; the ROX channel represents Chicken circovirus type 3.
[0037] Preferably, in the above method, in step (3), the process of determining whether the sample to be tested contains Chicken infectious anemia virus and Chicken circovirus type 3 includes:
[0038] ① The constant-temperature amplification result of the positive control: There is a typical amplification curve, and Ct ≤ 30; the constant-temperature amplification result of the negative control: There is no amplification curve, or Ct ≥ 40; the above positive control and negative control are both valid results and used as a control benchmark to determine whether the sample to be tested contains Chicken infectious anemia virus and Chicken circovirus type 3;
[0039] ② The sample to be tested:
[0040] Positive: There is a typical amplification curve, and the Ct of the sample to be tested ≤ 36, which is judged as a positive sample. If a typical amplification curve appears in the FAM channel or ROX channel and Ct ≤ 36, it means that the sample to be tested contains Chicken infectious anemia virus or Chicken circovirus type 3;
[0041] Negative: If Ct > 36 or no amplification curve appears, it is judged as a negative sample, that is, the test sample does not contain Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 or does not reach the detection threshold of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3.
[0042] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0043] 1. The primer-probe combination and kit for simultaneously detecting Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 based on fluorescence RAA of the present invention can be used to simultaneously detect Chicken Infectious Anemia Virus and Chicken Circovirus Type 3, and has the characteristics of rapid detection, good specificity, high sensitivity, etc.
[0044] 2. The detection method of the present invention has the advantages of simple operation, short detection time, good specificity, high sensitivity, no need for expensive instruments and equipment, support for on-site rapid detection, suitability for large-scale popularization and application, etc., and can provide effective technical support for the rapid detection and screening of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3. Description of the Drawings
[0045] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required for use in the description of the embodiments. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0046] Figure 1 (A) is the agarose gel electrophoresis pattern of the PCR amplification product of Chicken Infectious Anemia Virus in Example 1 of the present invention. Among them, M is 2000 DNA Marker, lane 1 is the amplification band of Chicken Infectious Anemia Virus, the amplified size of the target fragment is 423 bp, and lane 2 is the negative control; Figure 1 (B) is the agarose gel electrophoresis pattern of the PCR amplification product of Chicken Circovirus Type 3. Among them, M is 2000 DNA Marker, lane 1 is the amplification band of Chicken Circovirus Type 3, the amplified size of the target fragment is 762 bp, and lane 2 is the negative control;
[0047] Figure 2 is the agarose gel electrophoresis pattern of the gel recovery result of the PCR amplification products of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 in Example 1 of the present invention. Among them, M is 2000 DNA Marker, lane 1 is Chicken Infectious Anemia Virus, and lane 2 is Chicken Circovirus Type 3.
[0048] Figure 3It is the screening result curve graph of the fluorescence amplification of the primer-probe group of chicken infectious anemia virus in Example 2 of the present invention, where 1-8 are F1R1, FIR2, F1R3, F1R4, F4R3, F4R4, F2R1, F2R2 respectively; 9-16 are F2R3, F2R4, F4R2, F4R1, F3R1, F3R2, F3R3, F3R4 respectively.
[0049] Figure 4 It is the screening result curve graph of the fluorescence amplification of the primer-probe group of chicken circovirus type 3 in Example 2 of the present invention, where 1-8 are F1R1, FIR2, F1R3, F1R4, F2R1, F2R2, F2R3, F2R4 respectively; 9-16 are F3R1, F3R2, F3R3, F3R4, F4R1, F4R2, F4R3, F4R4 respectively.
[0050] Figure 5 It is the sensitivity investigation result curve graph of the dual-fluorescence RAA primer-probe group of chicken infectious anemia virus and chicken circovirus type 3 in Example 4 of the present invention. Among them, 1-7 represent the concentration gradients of the positive standard plasmid of chicken infectious anemia virus, which are 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL; 8-14 represent the concentration gradients of the positive standard plasmid of chicken circovirus type 3, which are 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL; 15 represents the negative control.
[0051] Figure 6 It is the specificity investigation result curve graph of the dual-fluorescence RAA primer-probe group of chicken infectious anemia virus and chicken circovirus type 3 in Example 4 of the present invention; among them, 1 represents chicken infectious anemia virus; 2 represents chicken circovirus type 3; 3-8 represent avian influenza virus (H5), Marek's disease virus, infectious bronchitis virus, infectious bursal disease virus (strain B87), infectious laryngotracheitis virus, and negative control respectively.
[0052] Figure 7 It is the repeatability investigation result curve graph of the dual-fluorescence RAA primer-probe group of chicken infectious anemia virus and chicken circovirus type 3 in Example 4 of the present invention: (A) the concentration is 10 5 copies / μL; (B) the concentration is 104 copies / μL; (C) Concentration is 10 2 copies / μL; In the three figures, 1 - 3 represent Chicken infectious anemia virus; 4 - 6 represent Chicken circovirus type 3. Detailed implementation manners
[0053] The following is a detailed description of the specific implementation manners of the present invention, but it should be understood that the protection scope of the present invention is not limited by the specific implementation manners. Unless otherwise defined, all professional terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention. Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or can be prepared by existing methods.
[0054] The dry powder reaction tubes, A buffer, and B buffer involved in the following examples are from Nanning Zhuangbo Biotechnology Co., Ltd. and are RAA nucleic acid amplification reagents (fluorescent type), product number: ZBA12001.
[0055] Example 1 Construction of plasmid standards for Chicken infectious anemia virus and Chicken circovirus type 3
[0056] Take the positive samples of Chicken infectious anemia virus and Chicken circovirus type 3 stored in this laboratory, and design specific PCR amplification primers according to the Chicken infectious anemia virus genome (GenBank accession number: OQ267594.1) and Chicken circovirus type 3 genome (GenBank accession number: NC_017091.1) published on GenBank.
[0057] Among them, the specific PCR amplification primers for Chicken infectious anemia virus are as follows:
[0058] CIAV-F: 5′-GGACCATCAACGGTGTTCAG-3′ (SEQ ID NO.19);
[0059] CIAV-R: 5′-CTTCGTCGAAGTCGCTTGAG-3′ (SEQ ID NO.20).
[0060] The amplification size of the target fragment is 423bp.
[0061] Among them, the specific PCR amplification primers for Chicken circovirus type 3 are as follows:
[0062] Gyv3-F: 5′-ATTACCGTATCGCTTCCTG-3′ (SEQ ID NO.21);
[0063] Gyv3-R: 5'-CATCGCCACCATTCTGAA-3' (SEQ ID NO.22).
[0064] The amplified size of the target fragment is 762 bp.
[0065] Using the virus genomic DNA / RNA extraction kit from Takara Bio Inc. (Dalian), the DNA of chicken infectious anemia virus and chicken circovirus type 3 was extracted. The PCR reaction system was prepared according to the components listed in Table 1, and then placed in a PCR instrument to set the specific reaction program. The specific reaction program is as follows:
[0066] Chicken infectious anemia virus: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 30 sec, for a total of 30 cycles; extension at 72°C for 10 min; storage at 4°C;
[0067] Chicken circovirus type 3: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 45 sec, for a total of 30 cycles; extension at 72°C for 10 min; storage at 4°C.
[0068] Table 1 Conventional PCR reaction system
[0069] Reagent Name Reaction System (μL) PCR Buffer 12.5 Forward Primer 1 Reverse Primer 1 DNA 1 Enzyme-Free Water 9.5 Total Volume 25
[0070] The target genes of chicken infectious anemia virus and chicken circovirus type 3 were amplified by PCR. The results are as Figure 1 shown. Bands of 423 bp and 762 bp were amplified from chicken infectious anemia virus and chicken circovirus type 3 respectively, which were consistent with the expected results.
[0071] The PCR amplification products were subjected to gel extraction. The results are as Figure 2 shown. The gel-extracted products were ligated with pMD18-T vector overnight at 16°C. The ligation products were transformed into Escherichia coli DH5α competent cells, and then the transformed products were inoculated onto LB solid medium containing ampicillin resistance using a spreader and cultured at 37°C for 10 hours. The colonies growing on the LB solid medium containing ampicillin resistance were picked and inoculated into LB liquid medium containing ampicillin resistance for enlarged culture.
[0072] The plasmid was extracted from the enlarged culture broth of the previous step and its concentration was measured. The constructed plasmid was stored at -20°C after being verified by sequencing. The concentration of the plasmid with correct digestion and sequencing was measured using a spectrophotometer, and according to the following formula:
[0073]
[0074] Dilute the correctly sequenced plasmid 10-fold serially with enzyme-free water to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL and 10 0 copies / μL to obtain plasmid standards for chicken infectious anemia virus and chicken circovirus type 3, and store them at -20°C for later use.
[0075] Example 2 Design and screen dual-fluorescent RAA primers and probes for chicken infectious anemia virus and chicken circovirus type 3
[0076] 1. Design and synthesis of primers and probes
[0077] In this example, a conserved region of approximately 200 bp for chicken infectious anemia virus and chicken circovirus type 3 was used as the target region for the design of RAA primers and probes. One probe and 4 upstream and downstream primers were designed respectively. The primers and probes were synthesized by Nanning Zhuangbo Biotechnology Co., Ltd.
[0078] Among them, the length of the conserved region of the selected chicken infectious anemia virus is 197 bp, and the specific DNA sequence is as follows: (5'-3')
[0079] CGCTGGAATTACAATCACTCTATCGCTGTGTGGCTGCGCGAATGCTCGCGCTCCCACGCTAAGATCTGCAACTGCGGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGGACCGATCAACCCAAGCCTCCCTCGAAGAAGCGATCCTGCGACCCCTCCGAGTACAGGGTAAGCGAGCTAAAAGAAA. (SEQ ID NO.23)
[0080] Among them, the length of the conserved region of the selected chicken circovirus type 3 is 202 bp, and the specific DNA sequence is as follows: (5'-3')
[0081] GACCCAGTGCTCGCAGCGTTAAAAGGAAGATATTCAACCCACATCCGGGATCTTACCTGGTAAGACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCTCGTATTCATACCTAGAGCCACAAGCTACTTACCAGACACAACTAAAGGCAAAAACGTTACAACAACTAATGTGGCACTAATTAACGTTAACCT。(SEQ ID NO.24)
[0082] Among them, the primer and probe sequences for the dual-fluorescent RAA of chicken infectious anemia virus and chicken circovirus type 3 are shown in Table 2.
[0083] Table 2 Dual-fluorescent RAA primer and probe sequences
[0084]
[0085]
[0086] The RAA-C-P probe in Table 2 is blocked and modified with C3 spacer at the 3' end, and a fluorescent reporter group FAM is modified at the 31st T base position from the 5' end, the 32nd nucleotide G is modified with a tetrahydrofuran (THF) d Spacer in the middle, and the 33rd T base is modified with a fluorescent quenching group BHQ1. The modified RAA-C-P probe is as follows:
[0087] GGACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACT TGAGG-C3Spacer;
[0088] The 3' end of the RAA-G-P probe in Table 2 is blocked and modified with C3 spacer. A fluorescent reporter group ROX is modified at the 31st T base position from the 5' end of the probe sequence; a fluorescent quenching group BHQ2 is modified at the 33rd T base position from the 5' end of the probe sequence, and the 32nd nucleotide A is modified with a tetrahydrofuran (THF) d Spacer in the middle. The modified RAA-G-P probe is as follows:
[0089] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCAA GGGCT-C3Spacer.
[0090] 2. Screening of primer pairs
[0091] The upstream and downstream primers of chicken infectious anemia virus and chicken circovirus type 3 were combined in pairs to obtain 16 primer-probe combinations, and the results are shown in Table 3.
[0092] Table 3 Dual-fluorescence RAA Multiple Primer-Probe Combinations
[0093]
[0094]
[0095] And nuclease-free water was used as a negative control, and a plasmid standard of 10 6 copies / μL was used as a positive control template to construct an RAA amplification system for fluorescence reaction to screen out the primer-probe combination with the best amplification efficiency.
[0096] Among them, the RAA amplification system includes: 1 tube of reaction dry powder, 25 μL of A Buffer, 2.5 μL of B Buffer, 2.0 μL (10 μM) of upstream primer, 2.0 μL (10 μM) of downstream primer, 0.6 μL (10 μM) of probe, 5 μL of sample, 12.9 μL of nuclease-free water, and the total volume is 50 μL.
[0097] Reaction program: constant temperature at 39°C, reaction time 20 min.
[0098] The test results of the best primer-probe combination for chicken infectious anemia virus are as Figure 3 shown. Figure 3 Among them, the abscissa represents the reaction time and the ordinate represents the fluorescence value. Figure 3 The results show that the primer pair RAA-C-F2R1 has the earliest peak and the highest amplification efficiency, which is more conducive to achieving rapid and efficient amplification of chicken infectious anemia virus. Therefore, the selected good RAA primer set and probe sequence are as follows:
[0099] Nucleotide sequence of upstream primer RAA-C-F2:
[0100] TCACTCTATCGCTGTGTGGCTGCGCGAATG-3′(SEQ ID NO.2);
[0101] Nucleotide sequence of downstream primer RAA-C-R1:
[0102] TTCTTCGAGGGAGGCTTGGGTTGATCGG(SEQ ID NO.5);
[0103] Nucleotide sequence of probe RAA-C-P:
[0104] GGACAATTCAGAAAGCACTGGTTTCAAGAATGTGCCGGACTTGAGG (SEQ ID NO.9);
[0105] The modified RAA-C-P probe is:
[0106] GACAATTCAGAAAGCACTGGTTTCAAGAA[FAM-dT][THF][BHQ1-dT]GCCGGACTTGAGG-C3Spacer.
[0107] The test results of the best primer-probe combination for chicken circovirus type 3 are as Figure 4 shown. Figure 4 In it, the abscissa represents the number of cycles, and the ordinate represents the fluorescence value. Figure 4 The results show that the primer pair RAA-G-F1R3 has the earliest peak and the highest amplification efficiency, which is more conducive to the rapid and efficient amplification of chicken circovirus type 3. The selected good RAA primer sets and probe sequences are as follows:
[0108] The nucleotide sequence of the upstream primer RAA-G-F1:
[0109] TCAACCCACATCCGGGATCTTACCTGGT (SEQ ID NO.10);
[0110] The nucleotide sequence of the downstream primer RAA-G-R3:
[0111] CCTTTAGTTGTGTCTGGTAAGTAGCTTGTG (SEQ ID NO.16);
[0112] The nucleotide sequence of the RAA-G-P probe:
[0113] GACTGCCGAACCCCTATAACGCGATTAACCTATACTTTCAAGGGCT (SEQ ID NO.18);
[0114] The modified RAA-G-P probe is as follows:
[0115] GACTGCCGAACCCCTATAACGCGATTAACC[ROX-dT][THF][BHQ2-dT]ACTTTCAAGGGCT-C3Spacer.
[0116] Example 3 Optimization of primer and probe concentrations
[0117] First, set the concentration of each probe to 0.12 μM, and the concentrations of the upstream and downstream primers for chicken infectious anemia virus and chicken circovirus type 3 are 0.3 μM, 0.4 μM, and 0.5 μM respectively. The primer concentrations of the two viruses are cross-reacted to form 9 combinations, and each group of combinations is set with a negative control. The RAA reaction system is shown in Table 4. The 9 groups of primer-probe combinations are all subjected to RAA amplification at a constant temperature of 39 °C for 20 min, and the combination with the best amplification efficiency is selected (see Table 5).
[0118] Table 4 RAA reaction system
[0119] Components of the RAA Reaction System Usage Final Concentration RAA Reaction Dry Powder 1 tube Solution A 25 μL Solution B 2.5 μL RAA-C-F2 (concentration: 10 μM) X μL Y μM RAA-C-R1 (concentration: 10 μM) X μL Y μM RAA-C-P (concentration: 10 μM) 0.6 μL 0.12 μM RAA-G-F1 (concentration: 10 μM) X μL Y μM RAA-G-R3 (concentration: 10 μM) X μL Y μM RAA-G-P (concentration: 10 μM) 0.6 μL 0.12 μM DNA Template 5 μL ddH2O Make up to 50 μL Total Volume 50 μL
[0120] Table 5 Primer and probe concentration combinations
[0121]
[0122]
[0123] Through the analysis of the detection results, the optimal concentration ratio of the primers and probes confirmed by the present invention is 10:3, where the upstream and downstream primer concentrations of chicken infectious anemia virus and chicken circovirus type 3 are 0.4 μM, and the probe is 0.12 μM.
[0124] Example 4 Construction of a reaction system, kit and detection method for dual-fluorescence RAA of chicken infectious anemia virus and chicken circovirus type 3
[0125] After optimizing the ratio of primers and probes, the preparation of the reaction system for dual-fluorescence RAA of chicken infectious anemia virus and chicken circovirus type 3 is shown in Table 6. Among them, the DNA template is specifically a combination of 5 μL of the templates of chicken infectious anemia virus and chicken circovirus type 3.
[0126] Table 6 Dual-fluorescence RAA reaction system
[0127]
[0128] A kit for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA, the kit includes: upstream primer RAA-C-F2, downstream primer RAA-C-R1, RAA-C-P probe, upstream primer RAA-G-F1, downstream primer RAA-G-R3 and RAA-G-P probe, ddH2O, A Buffer, B Buffer, reaction dry powder; among them, the concentrations of the probe and primers are both 10 μM. The dry powder reaction tube, A buffer, and B buffer are from Nanning Zhuangbo Biotechnology Co., Ltd. and are RAA nucleic acid amplification reagents (fluorescent type).
[0129] A dual-fluorescence RAA detection method for chicken infectious anemia virus and chicken circovirus type 3, comprising the following steps:
[0130] (1) Extract the DNA of the sample to be tested;
[0131] (2) Using the DNA of the sample to be tested as a template, perform dual isothermal fluorescence amplification with the screened primer-probe combination. The reaction system is shown in Table 4. The isothermal fluorescence amplification reaction conditions are: isothermal at 39 °C, reaction time 20 min, collect FAM fluorescence signal and ROX fluorescence signal to obtain an isothermal amplification curve; the FAM channel represents chicken infectious anemia virus, and the ROX channel represents chicken circovirus type 3;
[0132] (3) According to the isothermal amplification curve, determine whether the sample to be tested contains chicken infectious anemia virus or chicken circovirus type 3. Specifically:
[0133] ① Isothermal amplification result of positive control: There is a typical amplification curve, and Ct ≤ 30; Isothermal amplification result of negative control: There is no amplification curve, or Ct ≥ 40; The above positive control and negative control are both valid results, serving as a control benchmark to determine whether the sample to be tested contains chicken infectious anemia virus and chicken circovirus type 3;
[0134] ② Sample to be tested:
[0135] Positive: There is a typical amplification curve, and the Ct of the sample to be tested ≤ 36, judged as a positive sample. If a typical amplification curve appears in the FAM channel or ROX channel and Ct ≤ 36, it means that the sample to be tested contains chicken infectious anemia virus or chicken circovirus type 3;
[0136] Negative: If Ct > 36, or there is no amplification curve, judged as a negative sample, that is, the sample to be tested does not contain chicken infectious anemia virus and chicken circovirus type 3 or does not reach the detection threshold of avian chicken infectious anemia virus and chicken circovirus type 3.
[0137] Example 5 Methodology investigation of the dual-fluorescence RAA detection method for chicken infectious anemia virus and chicken circovirus type 3
[0138] 1. Sensitivity investigation:
[0139] Using the plasmid standard products of chicken infectious anemia virus and chicken circovirus type 3 constructed in Example 1 at a concentration gradient of 10 6 copies / μL - 10 0 copies / μL as templates, and using enzyme-free water as a template as a negative control, and detecting with the dual RAA detection system established in Example 3. From Figure 5It can be seen that when the concentration is as low as 10 copies / μL, obvious amplification curves can appear in both the FAM and ROX channels. Therefore, the lowest detection limits of the detection method provided by the present invention for both Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 are 10 copies / μL.
[0140] 2. Specificity investigation:
[0141] Using the DNA or cDNA of Chicken Infectious Anemia Virus, Chicken Circovirus Type 3, Avian Influenza Virus (H5), Marek's Disease Virus, Infectious Bronchitis Virus, Infectious Bursal Disease Virus (Strain B87), and Infectious Laryngotracheitis Virus as templates respectively, the fluorescence RAA method was used for detection and analysis of the specificity of this method. Among them, the copy numbers of the plasmid standards of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 were 10 6 copies / μL, and nuclease-free water was used as a negative control. The results are as Figure 6 shown. The standard plasmids of Infectious Anemia Virus and Chicken Circovirus Type 3 showed obvious amplification curves, while no amplification curves appeared in the other several samples from beginning to end.
[0142] 3. Repeatability investigation:
[0143] Using the positive control plasmids of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 constructed in Example 1, the nuclease-free water 10-fold serial dilution concentrations were: 10 5 、10 4 、10 2 copies / μL. Three replicate wells were set for each concentration, and a total of three repeated experiments were conducted.
[0144] It can be seen from Figure 7 that stable amplification curves appeared in all three concentration gradients of the double fluorescence RAA of Chicken Infectious Anemia Virus and Chicken Circovirus Type 3, indicating that the established detection method has good repeatability.
[0145] Application Example 1
[0146] Using the determined double fluorescence RAA detection method for Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 to detect clinical samples, the method is as follows:
[0147] Collect 224 avian serum samples from Guangxi region, including 68 samples from Farm A, 64 samples from Farm B, 52 samples from Farm C, and 40 samples from Farm D. They were respectively detected by the conventional PCR method, the double qPCR method, and the double fluorescence RAA detection method for Chicken Infectious Anemia Virus and Chicken Circovirus Type 3 determined in Example 4.
[0148] Among them, the primers and methods for the conventional PCR of chicken infectious anemia virus are those in the literature (Zhang Yubiao, Li Xiaohan, Meng Fanfeng, et al. Comparative analysis of different molecular biology methods for detecting chicken infectious anemia virus), and the specific primer sequences are as follows:
[0149] CIAV-F1: 5′-GCATTCCGAGTGGTTACTATTCC-3′ (SEQ ID NO.25);
[0150] CIAV-R1: 5′-CGTCTTGCCATCTTACAGTCTTAT-3′ (SEQ ID NO.26).
[0151] The primers and methods for the conventional PCR of chicken circovirus type 3 are those in the literature (Diao Zhijun, Yuan Shiyu, Hao Xiaojing, et al. Diagnosis of co-infection of circovirus type 3 and chicken infectious anemia virus with gonad-gastritis), and the specific primer sequences are as follows:
[0152] Gyv3-F1: 5′-GACACAGACTGCGACGAAGA-3′ (SEQ ID NO.27);
[0153] Gyv3-R1: 5′-ATGCTCCTGGCTGTCTAGAT-3′ (SEQ ID NO.28).
[0154] The primer sets and probe sequences for the duplex qPCR are shown in Table 7.
[0155] Table 7 Duplex qPCR primer and probe sequences
[0156]
[0157] Among them, the primer sets and probes for the duplex qPCR were designed by the inventors according to the conserved sequences of chicken infectious anemia virus and chicken circovirus type 3 published on GenBank.
[0158] The reaction system for the duplex qPCR method is shown in Table 8.
[0159] Table 8 Reaction system for the duplex qPCR method
[0160]
[0161] The qPCR program was set as follows: pre-denaturation at 95°C for 30 sec; PCR amplification at 95°C for 15 sec and at 56°C for 30 sec, for a total of 40 cycles, and fluorescence signals of the FAM and VIC channels were collected.
[0162] The detection duration is shown in Table 9. As can be seen from Table 9, the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 only takes 20 minutes, which greatly saves the detection time compared with the other two detection methods.
[0163] Table 9 Detection Duration
[0164]
[0165] The detection results are shown in Table 10. As can be seen from Table 10, when using the conventional PCR detection method, 28 positive samples of chicken infectious anemia virus were detected, and the positive rate was 12.50%; 4 positive samples of chicken circovirus type 3 were detected, and the positive rate was 1.79%. When using qPCR for detection, 53 positive samples of chicken infectious anemia virus were detected, and the positive rate was 23.66%; 7 positive samples of chicken circovirus type 3 were detected, and the positive rate was 3.13%. When using the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 provided by the present invention for detection, 53 positive samples of chicken infectious anemia virus were detected, and the positive rate was 23.66%, and 7 positive samples of chicken circovirus type 3 were detected, and the positive rate was 3.13%.
[0166] Table 10 Detection Results
[0167]
[0168] The above results show that the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 established by the present invention has the same positive detection rate as the qPCR detection method, which is much higher than that of the conventional PCR, indicating that the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 established by the present invention has good sensitivity. From the perspective of the detection time of the three methods, the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 takes 20 minutes, which greatly saves the detection time compared with the other two detection methods.
[0169] In summary, the dual-fluorescent RAA detection method for chicken infectious anemia virus and chicken circovirus type 3 provided by the present invention can specifically detect chicken infectious anemia virus and chicken circovirus type 3 from various viruses, and the minimum detection limit of both viruses is 10 copies / μL, with good repeatability and the detection can be completed in 20 minutes; it has good popularization value and application prospects, and can also provide effective technical support for the rapid detection and screening of chicken infectious anemia virus and chicken circovirus type 3 and the prevention and control of diseases caused by these viruses.
[0170] The foregoing description of the specific exemplary embodiments of the present invention is for purposes of illustration and exemplification. These descriptions are not intended to limit the invention to the precise forms disclosed, and it is apparent that many modifications and variations are possible in light of the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the invention and its practical applications, so that those skilled in the art can implement and utilize the various different exemplary embodiments of the invention, as well as various different selections and modifications. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. A primer-probe combination for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA, characterized in that, Comprising the following primer-probe sets: A primer-probe set for detecting Chicken infectious anemia virus, consisting of a primer pair composed of an upstream primer RAA-C-F2 shown in SEQ ID NO.2 and a downstream primer RAA-C-R1 shown in SEQ ID NO.5, and an RAA-C-P probe shown in SEQ ID NO.9; A primer-probe set for detecting Chicken circovirus type 3, consisting of an upstream primer RAA-G-F1 shown in SEQ ID NO.10, a downstream primer RAA-G-R3 shown in SEQ ID NO.16, and an RAA-G-P probe shown in SEQ ID NO.
18.
2. The primer-probe combination according to claim 1, wherein The 3'-end of the RAA-C-P probe is modified with C3spacer blocking, and a fluorescent reporter group is modified at the 31st base from the 5'-end, a tetrahydrofuran residue is modified at the 32nd base, and a fluorescent quenching group is modified at the 33rd base; The 3'-end of the RAA-G-P probe is modified with C3 spacer blocking, and a fluorescent reporter group is modified at the 31st base from the 5'-end, a tetrahydrofuran residue is modified at the 32nd base, and a fluorescent quenching group is modified at the 33rd base.
3. The primer-probe combination according to claim 2, wherein The fluorescent reporter group of the RAA-C-P probe is FAM, and the fluorescent quenching group is BHQ1; the fluorescent reporter group of the RAA-G-P probe is ROX, and the fluorescent quenching group is BHQ2.
4. Use of the primer-probe combination according to any one of claims 1 to 3 in the preparation of a product for simultaneously detecting Chicken infectious anemia virus and Chicken circovirus type 3 based on fluorescence RAA.
5. The application according to claim 4, wherein The product is a kit or a reagent.
6. A kit for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA, characterized in that, The kit comprises the primer-probe combination according to any one of claims 1 to 3.
7. Use of the primer-probe combination according to any one of claims 1 to 3 or the kit according to claim 4 in simultaneously detecting Chicken infectious anemia virus and Chicken circovirus type 3 for non-disease diagnosis or treatment purposes.
8. A method for simultaneously detecting chicken infectious anemia virus and chicken circovirus type 3 based on fluorescence RAA, characterized in that, Comprising the following steps: (1) Extracting the DNA of the sample to be tested; (2) Using the DNA of the sample to be tested as a template, performing double constant-temperature fluorescence amplification with the primer-probe combination according to any one of claims 1 to 3 or the kit according to claim 6 to obtain a constant-temperature amplification curve; (3) According to the constant-temperature amplification curve, determining whether the sample to be tested contains Chicken infectious anemia virus or Chicken circovirus type 3.
9. The method according to claim 8, wherein In the step (2), the RAA reaction system for double constant-temperature fluorescence amplification includes: a primer-probe set for detecting Chicken infectious anemia virus, a primer-probe set for detecting Chicken circovirus type 3. In the reaction system, the final concentrations of the upstream primer RAA-C-F2, the downstream primer RAA-C-R1, the upstream primer RAA-G-F1, and the downstream primer RAA-G-R3 are all 0.4 μM, and the final concentrations of the RAA-C-P probe and the RAA-G-P probe are both 0.12 μM.
10. The method according to claim 8, wherein In the step (3), the process of determining whether the sample to be tested contains Chicken infectious anemia virus and Chicken circovirus type 3 includes: ① The positive control isothermal amplification results: a typical amplification curve appears, and Ct ≤ 30; the negative control isothermal amplification results: no amplification curve appears, or Ct ≥ 40. Both the positive and negative controls are considered valid results and serve as reference standards to determine whether the sample to be tested contains chicken infectious anemia virus and chicken circovirus type 3. ② Samples to be tested: Positive: If a typical amplification curve appears and the sample Ct is ≤36, it is judged as a positive sample. If a typical amplification curve appears in the FAM channel or ROX channel and Ct is ≤36, the sample contains chicken infectious anemia virus or chicken circovirus type 3. Negative: If Ct>36, or no amplification curve appears, it is judged as a negative sample, which means that the sample does not contain chicken infectious anemia virus and chicken circovirus type 3 or does not reach the detection threshold of chicken infectious anemia virus and chicken circovirus type 3.
Citation Information
Patent Citations
PEDV (porcine epidemic diarrhea virus) and PDCoV (porcine delta coronavirus) double RT-RAA detection primer group, kit and application
CN110283938A
Kit for differential diagnosis of novel chicken orbivirus virus and chicken infectious anemia virus
CN110628943A
Primer probe group and kit for detecting chicken infectious anemia virus by RAA fluorescence method and application of primer probe group and kit
CN114959120A
Detection system for simultaneously detecting circle virus poultry source type 1 and circle virus human source type 1 and application thereof
CN119662911A
Cited By
RT-RPA / RAA detection kit and detection method for four Hunipah viruses
CN120796597A