Method for improving high-temperature catalytic activity of alpha-glucan phosphorylase, mutant Tp alpha GPM1, gene and application

Abstract

The invention relates to the technical field of biology, in particular to a method for improving the high-temperature catalytic activity of alpha-glucan phosphorylase, a mutant Tp alpha GPM1, a gene and application. The amino acid sequence of the alpha-glucan phosphorylase mutant Tp alpha GPM1 is as shown in SEQ ID NO: 2. Compared with a mutant female parent Tp alpha GP, the alpha-glucan phosphorylase mutant has the advantages that the catalytic activity is improved under the condition of 60 DEG C, the forward enzyme activity of Tp alpha GPM1 is improved by 36.24% compared with that of Tp alpha GP, and the reverse enzyme activity of Tp alpha GPM1 is improved by 7.99% compared with that of Tp alpha GP. Therefore, the alpha-glucan phosphorylase mutant provided by the invention can be well applied to production of polysaccharides such as artificially synthesized starch and the like, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for improving the high temperature catalytic activity of α-glucan phosphorylase and a mutant thereof. Tp αGPM1, genes, and applications. Background Art

[0002] Traditional plant-based starch production relies heavily on photosynthetic carbon fixation, limited by low light energy conversion efficiency and complex metabolic regulation, making it difficult to break through production bottlenecks. In recent years, synthetic biology has made breakthroughs in synthesizing starch from straw, with alpha-glucan phosphorylase (αGP) being a key enzyme.

[0003] α-Glucan phosphorylase (αGP) is a key glycosyltransferase (classified as glycosyltransferase family 35) found widely in plants, animals, and microorganisms. This enzyme catalyzes the reversible phosphorolysis of α-1,4-glucan chains. In the forward reaction, in the presence of a primer (a short-chain α-1,4-glucan), the enzyme uses G-1-P to synthesize and extend the α-1,4-glucan chain through a glucosyl transfer reaction. In the reverse reaction, the glycosyl group is phosphorylated from the non-reducing end of the glucan chain to form glucose-1-phosphate (G-1-P). Notably, this catalytic process requires no additional energy input, providing an economical method for polysaccharide synthesis in industrial production.

[0004] In industrial bioconversion processes such as artificial starch synthesis, high-temperature (60°C) operation has significant advantages: it can significantly reduce the risk of microbial contamination, increase substrate solubility and reaction rate, and reduce system viscosity to facilitate mixing and mass transfer. Therefore, it is crucial to develop α-glucan phosphorylase αGP with high catalytic activity in a high-temperature environment (60°C). Some α-glucan phosphorylase αGPs derived from thermophilic microorganisms that have been analyzed generally have a wide operating temperature range (50-100°C) and good thermal stability, but their catalytic activity is generally low, resulting in insufficient catalytic efficiency, which limits the economic feasibility of industrial applications, such as the parent used in this patent. Therefore, the core challenge facing current industrial applications is that existing α-glucan phosphorylase αGPs are difficult to simultaneously meet the excellent thermal stability required for high-temperature operation and the high specific activity required for efficient catalysis.

[0005] In order to obtain α-glucan phosphorylase αGP that has both high catalytic activity and excellent stability at high temperatures to meet the needs of efficient and robust industrial biocatalysis, the use of protein engineering technology to perform protein engineering modification of existing α-glucan phosphorylase αGP has become a key means to achieve this goal. Summary of the Invention

[0006] In order to increase the Thermotoga petrophila α-glucan phosphorylase Tp The catalytic activity of αGP at high temperature was proposed and completed.

[0007] The object of the present invention is to provide an α-glucan phosphorylase mutant having improved catalytic activity at high temperatures.

[0008] Another object of the present invention is to provide a gene encoding the aforementioned α-glucan phosphorylase mutant.

[0009] Another object of the present invention is to provide a recombinant vector comprising the gene encoding the aforementioned α-glucan phosphorylase mutant.

[0010] Another object of the present invention is to provide a recombinant strain comprising the gene encoding the aforementioned α-glucan phosphorylase mutant.

[0011] Another object of the present invention is to provide the use of the above-mentioned α-glucan phosphorylase mutant.

[0012] Another object of the present invention is to provide a method for preparing α-glucan phosphorylase with improved catalytic activity.

[0013] Another object of the present invention is to provide a method for improving the catalytic activity of α-glucan phosphorylase.

[0014] The present invention is derived from Thermotoga petrophila α-glucan phosphorylase Tp αGP was mutated to obtain an α-glucan phosphorylase mutant with improved catalytic activity at high temperature, wherein the parent α-glucan phosphorylase Tp The amino acid sequence of αGP is shown in SEQ ID NO: 1.

[0015] SEQ ID NO: 1: .

[0016] According to a specific embodiment of the present invention, α-glucan phosphorylase Tp The 171st amino acid of αGP was mutated from Glu to Gly, resulting in the mutant E170G. Tp αGPM1, the α-glucan phosphorylase mutant Tp The amino acid sequence of αGPM1 is shown in SEQ ID NO: 2.

[0017] As shown in SEQ ID NO:2: MLEKLPENLKELESLAYNLWWSWSRPAQRLWRMIDSEKWEEHRNPVKILREVSKERLEELSKDEDFIALYELTLERFTDYMEREDTWFNVNYPEWDEKIVYMCMEYGLTKALPIYSGGLGILAGDHLKSASDLGLPLIAVGLLYKHGYFTQQIDSDGRQIEIFPEYDIEGLPMKPLRDEDGNQVIVEVPIDNDTVKARVFEVQVGRVKLYLLDTDFEENEDRFRKICDYLYNPEPDVRVSQEILLGIGGMKLLKTLKIKPGVIHLNEGHPAFSSLERIKSYMEEGYSFTEALEIVRQTTVFTTHTPVPAGHDRFPFDFVEKKLTKFFEGFESKELLMNLGKDEDGNFNMTYLALRTSSFINGVSKLHADVSRRMFKNVWKGVPVEEIPIEGITNGVHMGTWINREMRKLFDRYLGRVWREHTDLEGIWYGVDRIPDEELWEAHLNAKKRFIDYIRESIKRRNERLGINEPLPEISENVLIIGFARRFATYKRAVLLFSDLERLKRIVNNSERPVYIVYAGKAHPRDEGGKEFLRRIYEVSQMPDFKNKIIVLENYDIGMARLMVSGVDVWLNNPRRPMEASGTSGMKAAANGVLNASVYDGWWVEGYNGRNGWVIGDESVLPETEADDPKDAEALYELLENEIIPTYYENREKWIFMMKESIKSVAPKFSTTRMLKEYTEKFYIKGLVNREWLERRENVEKIGAWKERILKNWENVSIERIVLEDSKSVEVTVKLGDLTPNDVIVELVAGRGEGMEDLEVWKVIHIRRYRKENDLFVYTYTNGVLGHLGSPGWFYAVRVIPYHPRLPIKFLPEVPVVWKKVL。

[0018] According to the specific embodiments of the present invention, the α-glucan phosphorylase mutant Tp The coding gene sequence of αGPM1 is as shown in SEQ ID NO:3.

[0019] SEQ ID NO:3:

[0020] The method for improving the catalytic activity of α-glucan phosphorylase at high temperature according to the present invention comprises the following steps: α-glucan phosphorylase Tp αGP underwent a single-point mutation, with the 171st amino acid mutated from Glu to Gly.

[0021] The present invention provides a recombinant vector comprising the gene encoding the α-glucan phosphorylase mutant.

[0022] The present invention also provides a recombinant strain comprising the coding gene of the above-mentioned α-glucan phosphorylase mutant. Preferably, the starting strain of the recombinant bacteria is BL21(DE3)(pET-28a(+) -tpαgp ).

[0023] According to a specific embodiment of the present invention, a method for preparing α-glucan phosphorylase with improved high-temperature catalytic activity is as follows: (1) transforming a host cell with a recombinant vector containing a gene encoding an α-glucan phosphorylase mutant to obtain a recombinant strain; (2) culturing the recombinant strain to induce the expression of α-glucan phosphorylase; (3) Purify the expressed α-glucan phosphorylase.

[0024] Beneficial effects of the present invention: The present invention is to treat α-glucan phosphorylase Tp αGP was subjected to a single point mutation E170G to obtain a mutant Tp αGPM1.

[0025] The α-glucan phosphorylase mutant of the present invention and the mutant parent Tp Compared with αGP, the catalytic activity is improved at 60℃. Tp The forward enzyme activity of αGPM1 is Tp αGP increased by 36.24%, Tp The reverse enzyme activity of αGPM1 is Tp The αGP was increased by 7.99%. Therefore, the α-glucan phosphorylase mutant provided by the present invention can be well applied to the production of artificially synthesized starch and other polysaccharides, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The mutants and Tp Comparison of bidirectional enzyme activity of αGP. DETAILED DESCRIPTION

[0027] Test materials and reagents: 1. Strains and vectors: The expression host is BL21 (DE3) Escherichia coli, and the expression plasmid vector is pET-28a (+).

[0028] 2. Enzymes: endonucleases, ligases.

[0029] 3. Culture medium: (1) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1% NaCl, natural pH); Note: Molecular biology experimental methods not specifically described in the following examples were performed with reference to the specific methods listed in the book "Molecular Cloning Laboratory Manual" (3rd edition) by J. Sambrook, or in accordance with the kits and product instructions. Example 1. Preparation of recombinant strain BL21(DE3)(pET-28a(+)-tpαgp)

[0030] Amplification of the parent α-glucan phosphorylase Tp αGP encoding gene tpαgp.

[0031] Amplification by PCR tpαgp Gene fragment. The vector pET-28a(+) was obtained by culturing the preserved bacteria in a bottle and extracting it. After the amplification was completed, the PCR product and the extracted plasmid were subjected to nucleic acid electrophoresis detection. tpαgp The band sizes of pET-28a(+) and pET-28a(+) were 2466 bp and 5335 bp respectively. BamH I and Xho After enzyme digestion, the PCR product and the enzyme digestion product were recovered and purified respectively.

[0032] will be recycled tpαgp The pET-28a(+) gene fragment was recombined and connected with the recombinase of the kit to construct the plasmid pET-28a(+)- tpαgp The recombinant product was then transformed into E. coli Trans1-T1 competent cells and plated on LB (containing 50 μg / mL Kanamycin) for screening. After sequencing was correct, the plasmid was transformed into BL21 (DE3) E. coli expression host to obtain the recombinant expression strain BL21 (DE3) (pET-28a (+) -tpαgp ). Example 2. Preparation of recombinant strain BL21(DE3)(pET-28a(+)-tpαgp-E170G)

[0033] (1) Recombinant plasmid pET-28a(+)- tpαgp -E170G construction Design mutation primers and use plasmid pET-28a(+)- tpαgp As a template, the mutant amino acid was introduced by a point mutation kit, and the PCR product containing the mutant amino acid was used Dpn The template was removed by digestion treatment, and the digested PCR product was transformed into Escherichia coli Tans1-T1 competent cells and sequenced to obtain Escherichia coli pET-28a(+)- tpαgp -E170G. The primers used are as follows: Tp αGPM1-F(SEQ ID NO:4)TGATATCGAGGGACTGCCGATGAAACCGCTGC, Tp αGPM1-R (SEQ ID NO:5) GCAGTCCCTCGATATCATATTCCGGAAAAATT.

[0034] (2) Construction of recombinant strain BL21(DE3)(pET-28a(+)- tpαgp -E170G) The recombinant plasmid pET-28a(+)- tpαgp -E170G was transformed into BL21(DE3) Escherichia coli expression host and induced to express, and the recombinant expression strain BL21(DE3) (pET-28a(+)- tpαgp -E170G). Example 3. Obtaining α-glucan phosphorylase TpαGP and high catalytic activity mutant enzyme protein E170G (TpαGPM1)

[0035] 3.1 Tp αGP and mutant E170G ( Tp Inducible expression of αGPM1 The obtained recombinant expression strain BL21(DE3)(pET-28a(+) -tpαgp ) and BL21(DE3) (pET-28a(+)- tpαgp -E170G) was inoculated into 40 mL of LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured overnight in a shaking incubator at 37°C and 200 rpm.

[0036] On the second day, 4 mL of seed solution was taken from 40 mL of LB liquid medium and inoculated into 400 mL of LB liquid medium containing a final concentration of 50 μg / mL Kanamycin, and cultured in a shaker at 37°C and 200 rpm.

[0037] When the bacterial solution OD 600 When the pH value was 0.6-0.8, IPTG was added at a final concentration of 0.1 mM and cultured in a shaker at 16 °C and 200 rpm for 18 h to induce expression.

[0038] 3.2 Tp αGP and mutant E170G ( Tp Purification of αGPM1 After induction, the fermentation broth was centrifuged at 6000 rpm for 10 min at 4°C to collect the cells, and the supernatant was removed. The cell pellet was resuspended in cell lysis buffer (20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 7.4), and the cells were centrifuged at 6000 rpm for 10 min, and the supernatant was removed.

[0039] The buffer used for purification is as follows: (1) Cell lysis buffer and binding buffer: 20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 7.4, named NTA10.

[0040] (2) Elution Buffer: Contains imidazole at final concentrations of 20 mM, 40 mM, 60 mM, 80 mM, 100 mM, 200 mM, 400 mM, and 500 mM. The remaining components are the same as those in the binding buffer and are named NTA20, NTA20, NTA60, NTA80, NTA100, NTA200, NTA400, and NTA500, respectively.

[0041] (3) Buffer used for gel filtration chromatography: 20 mM Tris-HCl, pH 7.4.

[0042] The purification steps are as follows: (1) Preparation of crude enzyme solution: Resuspend the bacteria in cell lysis buffer and stir evenly. After confirming that there are no lumps in the bacterial solution, place the bacterial solution in an ice-water bath for ultrasonic disruption. The ultrasonic disruption parameters are set as follows: power 30%, ultrasonic time 4 s, interval time 3 s, and total treatment time 45 min. After ultrasonic disruption, the disrupted bacterial solution is subjected to high-speed centrifugation at 4 °C, the centrifugation parameters are 12000 rpm, and the centrifugation time is 30 min. After centrifugation, the supernatant is taken for SDS-PAGE analysis to determine the expression and distribution of the target protein.

[0043] (2) Heat treatment: First, the enzyme solution that has been confirmed to contain the target protein by SDS-PAGE protein electrophoresis is placed in a water bath preheated to 90°C and maintained at this temperature for 20 minutes. The treated enzyme solution is then transferred to a centrifuge precooled to 4°C and centrifuged at 12,000 rpm for 15 minutes. After centrifugation, the supernatant is collected and analyzed again by SDS-PAGE to evaluate the purification effect of the target protein.

[0044] (3) Nickel affinity chromatography: After heat treatment, the enzyme solution was filtered using a 0.22 μm filter membrane to remove particles that were not completely centrifuged and prevent them from contaminating the chromatography column. Subsequently, the 20% ethanol in the nickel affinity chromatography column was rinsed with deionized water, and the nickel column was equilibrated with binding buffer. 10 mL of the filtered crude enzyme solution was added to the equilibrated nickel column, and gradient elution was performed using elution buffers with different imidazole concentrations. The eluates from each gradient were collected for subsequent SDS-PAGE protein electrophoresis analysis. After elution, the nickel column was washed with deionized water, 0.5 M NaOH, and deionized water in turn. Finally, the nickel column was sealed with 20% ethanol and stored in a refrigerator at 4 °C.

[0045] (4) Gel filtration chromatography: After SDS-PAGE protein electrophoresis, the enzyme solution containing the target protein and reaching the required purity for the experiment was centrifuged at 12,000 rpm for 15 min and filtered using a 0.22 μm filter membrane. The 20% ethanol in the sealed desalting column was rinsed with deionized water, and then the desalting column was equilibrated with 20 mM Tris-HCl buffer at pH 7.4. 1 mL of the treated enzyme solution was added to the equilibrated desalting column, and the target protein was eluted with 1.5 mL of buffer to complete the replacement of the target protein buffer environment. Finally, the target protein was quantified using a protein quantification kit.

[0046] 3. Mutants and parent strains of this application Tp Bidirectional enzyme activity assay of αGP 3.3.1 Mutants and parent strains of this application Tp αGP forward enzyme activity assay Definition of αGP forward reaction enzyme activity unit: 1 U is defined as the amount of enzyme required to catalyze the production of 1 μmol of phosphate per minute using G-1-P as substrate in the presence of α-1,4-glucan primer, and the unit is U / mg.

[0047] A 200 μL reaction solution contained maltodextrin (9 g / L final concentration), 12.5 mM G-1-P, 0.1 M sodium acetate (pH 5.5), and the appropriate amount of αGP. The reaction was initiated by the addition of αGP and incubated at 60°C for 10 min. The reaction was terminated by the addition of 800 μL of molybdate reagent (15 mM ammonium molybdate, 100 mM zinc acetate, pH 5.0), followed by the addition of 200 μL of ascorbic acid reagent (10% wt / vol, pH 5.0). The mixture was incubated at 30°C for 20 min, and the absorbance response of the reaction mixture was recorded by measuring the absorbance at 850 nm. All reactions were performed in triplicate to ensure data accuracy and reliability.

[0048] 3.3.2 Mutants and parent strains of this application Tp Determination of αGP reverse enzyme activity αGP reverse reaction enzyme activity unit definition: 1 U is defined as the amount of enzyme required to catalyze the production of 1 μmol of G-1-P per minute using α-1,4-glucan and phosphate as substrates. The unit is U / mg. For the quantitative detection of G-1-P, a cascade of PGM and G6PDH (glucose-6-phosphate dehydrogenase) is used to convert G-1-P into NADH (reduced nicotinamide adenine dinucleotide). The formation of NADH causes a change in absorbance at 340 nm, and G-1-P production is indirectly measured spectrophotometrically.

[0049] The detection process consists of two steps. The first step is an enzymatic reaction to generate the target product, G-1-P. A 200 μL reaction solution contains a final concentration of 20 mM phosphate, 9 g / L maltodextrin, 5 mM MgCl2, and an appropriate amount of αGP. The reaction is initiated by the addition of αGP and incubated at 60°C for 10 minutes. The reaction is stopped by the addition of HClO4 and the pH is neutralized with KOH.

[0050] In the second step, PGM catalyzes the conversion of G-1-P to G-6-P, and then G6PDH uses NAD⁺ as a cofactor to oxidize G-6-P to 6-phosphogluconolactone and generate NADH. The 200 μL reaction solution contains 5 mM MgCl2, 6 mM NAD + , 2 U / mL PGM, 2 U / mL G6DPH and an appropriate amount of the first step reaction product, the reaction was started by adding G6DPH, and the reaction kinetics were monitored at a wavelength of 340 nm. 340 The reaction was terminated when the reaction reached a stable state and no longer changed. All reactions were measured in triplicate to ensure data accuracy and reliability.

[0051] like Figure 1 As shown, the purified TpαGP and mutants were subjected to enzymatic reactions at pH 7.4 and 60°C to determine their enzymatic activities. Tp The forward enzyme activity of αGP is 12.68 U / mg, and the reverse enzyme activity is 7.77 U / mg. The mutant enzyme E170G of this application, Tp The forward enzyme activity of αGPM1 was 17.27 U / mg, and the reverse enzyme activity was 8.39 U / mg. Tp The forward enzyme activity of αGPM1 is Tp αGP increased by 36.24%, Tp The reverse enzyme activity of αGPM1 is Tp αGP increased by 7.99%.

[0052] The above embodiments are only used to understand the technical solutions of the present application and do not limit the scope of protection of the present application.

Claims

1. A mutant of α-glucan phosphorylase with improved catalytic activity at high temperature, characterized in that The amino acid sequence of the mutant is shown in SEQ ID NO:

2.

2. An α-glucan phosphorylase gene, characterized in that The gene encodes an α-glucan phosphorylase having an amino acid sequence as shown in SEQ ID NO:

2.

3. The α-glucan phosphorylase gene according to claim 2, characterized in that The nucleotide sequence of the α-glucan phosphorylase gene is shown in SEQ ID NO:

3.

4. A recombinant vector comprising the α-glucan phosphorylase gene according to claim 2.

5. A recombinant strain comprising the α-glucan phosphorylase gene according to claim 2.

6. A method for improving the catalytic activity of α-glucan phosphorylase at high temperature, characterized in that: The method comprises the steps of mutating the α-glucan phosphorylase shown in SEQ ID NO: 1 as follows: The 171st amino acid was mutated from Glu to Gly.

7. Use of the α-glucan phosphorylase mutant with improved catalytic activity at high temperature according to claim 1 in artificial synthesis of starch.

8. A method for preparing α-glucan phosphorylase, characterized in that: The method comprises the following steps: (1) using a recombinant vector comprising the α-glucan phosphorylase gene according to claim 2 to transform a host cell to obtain a recombinant strain; (2) culturing the recombinant strain and inducing the expression of α-glucan phosphorylase; (3) Purify the expressed α-glucan phosphorylase.

Images