Method for improving high-temperature catalytic activity of alpha-glucan phosphorylase, mutant Tm alpha GPM6, gene and application
By performing a five-point amino acid mutation on the α-glucan phosphorylase TmαGP of Thermoplastics marinei, TmαGPM6 was formed, which solved the problem of insufficient catalytic activity at high temperatures and enabled the efficient production and application of polysaccharides.
Patent Information
- Application Number
- CN202510929188.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-10-28
AI Technical Summary
Existing α-glucan phosphorylases have insufficient catalytic activity at high temperatures, which makes it difficult to meet the needs of industrial biocatalysis and limits their application in polysaccharide production such as artificial starch synthesis.
Five amino acid mutations were performed on the α-glucan phosphorylase TmαGP derived from Thermophyton floccosum, specifically P671T/P672T/A673R/C674M/C675L, to form the mutant TmαGPM6, which improved its catalytic activity at high temperatures.
The mutant TmαGPM6 exhibits significantly enhanced catalytic activity at 60℃, with its forward enzyme activity being 34 times that of the parent and its reverse enzyme activity being 37 times, making it suitable for the production of artificially synthesized starch and other polysaccharides.
Smart Images
Figure CN120843468A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a method for improving the high-temperature catalytic activity of α-glucan phosphorylase, a mutant TmαGPM6, its gene, and its applications. Background Technology
[0002] Traditional plant-derived starch production relies heavily on photosynthetic carbon fixation pathways, and its production capacity remains limited by low light energy conversion efficiency and complex metabolic regulation. In recent years, synthetic biology technology has made breakthrough progress in the synthesis of starch from straw, with alpha-glucan phosphorylase (αGP) being a key enzyme element.
[0003] α-Glucan phosphorylase (αGP) is a key glycosyltransferase (classified as family 35 of glycosyltransferases) widely found in plants, animals, and microorganisms. This enzyme catalyzes the reversible phosphorylation of α-1,4-glucan chains: in the forward reaction, in the presence of primers (short-chain α-1,4-glucan), extended α-1,4-glucan chains are synthesized via glucosyl transfer reaction using G-1-P; in the reverse reaction, the glycosyl group dissociates from the non-reducing phosphate terminus of the glucan chain to generate glucose-1-phosphate (G-1-P). Notably, this catalytic process requires no additional energy input, providing an economical method for polysaccharide synthesis in industrial production.
[0004] In industrial biotransformation processes such as artificial starch synthesis, high-temperature (60°C) operation offers significant advantages: it can substantially reduce the risk of microbial contamination, increase substrate solubility and reaction rate, and reduce system viscosity, facilitating mixing and mass transfer. Therefore, developing α-glucan phosphorylases (αGPs) with high catalytic activity in high-temperature environments (60°C) is crucial. Currently, some thermophilic microbial-derived αGPs typically exhibit wide operating temperature ranges (50-100°C) and good thermal stability, but their catalytic activity is generally low, leading to insufficient catalytic efficiency and limiting the economic feasibility of industrial applications, as exemplified by the parent strain used in this patent. Therefore, the core challenge currently facing industrial applications is that existing αGPs cannot simultaneously satisfy the requirements of excellent thermal stability necessary for high-temperature operation and high specific activity required for efficient catalysis.
[0005] In order to obtain α-glucan phosphorylase αGP that can exhibit both high catalytic activity and excellent stability at high temperatures (60℃) to meet the needs of efficient and robust industrial biocatalysis, protein engineering technology has been used to modify the existing α-glucan phosphorylase αGP, which has become a key means to achieve this goal. Summary of the Invention
[0006] This invention was proposed and completed in order to improve the catalytic activity of α-glucan phosphorylase TmαGP derived from Thermotoga maritima at high temperatures.
[0007] The purpose of this invention is to provide an α-glucan phosphorylase mutant with enhanced catalytic activity at high temperatures.
[0008] Another object of the present invention is to provide the encoding gene of the above-mentioned α-glucan phosphorylase mutant.
[0009] Another object of the present invention is to provide a recombinant vector comprising the gene encoding the above-mentioned α-glucan phosphorylase mutant.
[0010] Another object of the present invention is to provide a recombinant strain containing the gene encoding the above-described α-glucan phosphorylase mutant.
[0011] Another object of the present invention is to provide the application of the above-mentioned α-glucan phosphorylase mutant.
[0012] Another object of the present invention is to provide a method for preparing α-glucan phosphorylase with enhanced catalytic activity.
[0013] Another object of the present invention is to provide a method for improving the catalytic activity of α-glucan phosphorylase.
[0014] This invention mutates the α-glucan phosphorylase TmαGP derived from Thermophyton floccosum to obtain an α-glucan phosphorylase mutant with enhanced catalytic activity at high temperatures. The amino acid sequence of the parent α-glucan phosphorylase TmαGP is shown in SEQ ID NO:1.
[0015] SEQ ID NO:1:
[0016] 。
[0017] According to a specific embodiment of the present invention, the 671st amino acid of α-glucan phosphorylase TmαGP is mutated from Pro to Thr, the 672nd amino acid is mutated from Pro to Thr, the 673rd amino acid is mutated from Ala to Arg, the 674th amino acid is mutated from Cys to Met, and the 675th amino acid is mutated from Cys to Leu, to obtain the mutant P671T / P672T / A673R / C674M / C675L, namely the mutant TmαGPM6. The amino acid sequence of the α-glucan phosphorylase mutant TmαGPM6 is shown in SEQ ID NO:2.
[0018] As shown in SEQ ID NO:2:
[0019] VLEKLPENLKELESLAYNLWWSWSRPAQRLWRMIDSEKWEEHRNPVKILREVSKERLEELSKDEDFIALYELTLERFTDYMEREDTWFNVNYPEWDEKIVYMCMEYGLTKALPIYSGGLGILAGDHLKSASDLGLPLIAVGLLYKHGYFTQQIDSDGRQIEIFPEYDIEGLPMKPLRDEDGNQVIVEVPIDNDTVKARVFEVQVGRVKLYLLDTDFEENEDRFRKICDYLYNPEPDVRVSQEILLGIGGMKLLKTLKIKPGVIHLNEGHPAFSSLERIKSYMEEGYSFTEALEIVRQTTVFTTHTPVPAGHDRFPFDFVEKKLTKFFEGFESKELLMNLGKDEDGNFNMTYLALRTSSFINGVSKLHADVSRRMFKNVWKGVPVEEIPIEGITNGVHMGTWINREMRKLFDRYLGRVWREHTDLEGIWYGVDRIPDEELWEAHLNAKKRFIDYIRESIKRRNERLGINEPLPEISENVLIIGFARRFATYKRAVLLFSDLERLKRIVNNSERPVYIVYAGKAHPRDEGGKEFLRRIYEVSQMPDFKNKIIVLENYDIGMARLMVSGVDVWLNNPRRPMEASGTSGMKAAANGVLNASVYDGWWVEGYNGRNGWVIGDESVLPETEADDPKDAEALYELLENEIIPTYYENREKWIFMMKESIKAWLQNSATTRMLKEYTEKFYIKGLVNREWLERRENVEKIGAWKERILKNWENVSIERIVLEDSKSVEVTVKLGDLTPNDVIVELVAGRGEGMEDLEVWKVIHIRRYRKENESIRLHLHQWCLGHLGSPGWFYAVRVIPYHPRLPIKFLPEVPVVWKKVL。
[0020] According to the specific embodiments of the present invention, the coding gene sequence of the α-glucan phosphorylase mutant TmαGPM6 is as shown in SEQ ID NO:3.
[0021] SEQ ID NO:3:
[0022]
[0023] The method for improving the catalytic activity of α-glucan phosphorylase at 60°C according to the present invention comprises the following steps:
[0024] The α-glucan phosphorylase TmαGP was subjected to five point mutations: amino acid 671 was mutated from Pro to Thr, amino acid 672 was mutated from Pro to Thr, amino acid 673 was mutated from Ala to Arg, amino acid 674 was mutated from Cys to Met, and amino acid 675 was mutated from Cys to Leu.
[0025] The present invention provides a recombinant vector containing the coding gene of the above-mentioned α-glucan phosphorylase mutant.
[0026] The present invention also provides a recombinant strain containing the coding gene of the above-mentioned α-glucan phosphorylase mutant. Preferably, the starting strain of the recombinant strain is BL21(DE3)(pET-30a(+)-tmαgp).
[0027] According to a specific embodiment of the present invention, a method for preparing α-glucan phosphorylase with enhanced catalytic activity at high temperatures is described below:
[0028] (1) Host cells were transformed with a recombinant vector containing the encoding gene of α-glucan phosphorylase mutant to obtain recombinant strains;
[0029] (2) Culture recombinant strains and induce α-glucan phosphorylase expression;
[0030] (3) Purify the expressed α-glucan phosphorylase.
[0031] The beneficial effects of this invention are:
[0032] This invention involves five-point mutations of α-glucan phosphorylase TmαGP: P671T / P672T / A673R / C674M / C675L, to obtain the mutant TmαGPM6.
[0033] Compared to the mutant parent TmαGP, the α-glucan phosphorylase mutant of this invention exhibits significantly enhanced catalytic activity at 60°C. The forward enzyme activity of TmαGPM6 is 34 times that of TmαGP, and the reverse enzyme activity is 37 times that of TmαGP. Therefore, the α-glucan phosphorylase mutant provided by this invention can be well applied to the production of polysaccharides such as starch and has broad application prospects.
[0034] This invention provides the application of the above-mentioned α-glucan phosphorylase mutant with enhanced catalytic activity, which can well meet the application needs in the production of artificially synthesized starch and other polysaccharides, and has a very broad application prospect. Attached Figure Description
[0035] Figure 1 This shows a bidirectional comparison of enzyme activities between the mutant of this application and TmαGP. Detailed Implementation
[0036] Experimental materials and reagents
[0037] 1. Strains and vectors: The expression host was BL21(DE3) Escherichia coli, and the expression plasmid vector was pET-30a(+).
[0038] 2. Enzymes: endonucleases and ligases.
[0039] 3. Culture medium:
[0040] (1) Escherichia coli culture medium LB (1% peptone, 0.5% yeast extract, 1% NaCl, natural pH);
[0041] Note: Molecular biology experimental methods not specifically described in the following examples were performed in accordance with the specific methods listed in J. Sambrook's "Molecular Cloning: A Laboratory Manual" (3rd Edition), or according to the kit and product instructions.
[0042] Example 1: Preparation of recombinant strain BL21(DE3)(pET-30a(+)-tmαgp)
[0043] The gene encoding the maternal α-glucan phosphorylase TmαGP, tmαgp, was amplified.
[0044] The tmαgp gene fragment was amplified by PCR. The vector pET-30a(+) was extracted after inoculating preserved bacterial strains into flasks. After amplification, the PCR product and the extracted plasmid were detected by nucleic acid electrophoresis. The band sizes of tmαgp and vector pET-30a(+) were 2466 bp and 5397 bp, respectively. The vector was digested with BamHI and NotI, and the PCR product and digestion product were recovered and purified separately.
[0045] The recovered tmαgp and pET-30a(+) gene fragment were recombinantly ligated using a recombinase kit to construct the plasmid pET-30a(+)-tmαgp. The recombinant product was then transformed into E. coli Trans1-T1 competent cells and plated on LB filtrate (containing 50 μg / mL Kanamycin) for selection. After successful sequencing, the plasmid was transformed into the BL21(DE3) E. coli expression host to obtain the recombinant expression strain BL21(DE3)(pET-30a(+)-tmαgp).
[0046] Example 2: Preparation of recombinant strain BL21(DE3)(pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L)
[0047] (1) Construction of recombinant plasmid pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L
[0048] Mutant primers were designed, and mutated amino acids were introduced using plasmid pET-30a(+)-tmαgp as a template via a point mutation kit. The PCR product containing the mutated amino acids was digested with DpnI to remove the template. The digested PCR product was transformed into *E. coli* Tans1-T1 competent cells, and sequenced to verify the results. *E. coli* pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L containing the α-glucan phosphorylase mutant plasmid was obtained. The primers used are shown below:
[0049] TmαGPM6-F(SEQ ID NO:4)AACCACCAGAATGCTCAAAGAGTACACGGAGAAATTCTA CATAAA,
[0050] TmαGPM6-R (SEQ ID NO:5)TGAGCATCTGGTGGTTGCTGAATTTTGGAGCCACG.
[0051] (2) Construction of recombinant strain BL21(DE3)(pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L)
[0052] The recombinant plasmid pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L was transformed into the BL21(DE3) Escherichia coli expression host and induced expression to obtain the recombinant expression strain BL21(DE3)(pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L).
[0053] Example 3: Obtaining α-glucan phosphorylase TmαGP and highly catalytically active mutant enzyme proteins P671T / P672T / A673R / C674M / C675L (TmαGPM6)
[0054] 3.1 Inducible expression of TmαGP and mutants P671T / P672T / A673R / C674M / C675L (TmαGPM6)
[0055] The obtained recombinant expression strains BL21(DE3)(pET-30a(+)-tmαgp) and BL21(DE3)(pET-30a(+)-tmαgp-P671T / P672T / A673R / C674M / C675L) were inoculated into 40 mL LB liquid medium containing a final concentration of 50 μg / mL Kanamycin and cultured overnight in a shaker at 37°C and 200 rpm.
[0056] On the second day, 4 mL of seed culture was taken from 40 mL of LB liquid medium and inoculated into 400 mL of LB liquid medium containing a final concentration of 50 μg / mL Kanamycin. The culture was then expanded in a shaker at 37°C and 200 rpm.
[0057] When the bacterial solution OD 600 When the concentration is 0.6-0.8, add IPTG to a final concentration of 0.1 mM and incubate in a shaker at 16℃ and 200 rpm for 18 h to induce expression.
[0058] 3.2 Purification of TmαGP and mutants P671T / P672T / A673R / C674M / C675L (TmαGPM6)
[0059] After induction, the fermentation broth was centrifuged at 6000 rpm for 10 min at 4°C to collect the cells, and the supernatant was removed. The cell pellet was resuspended in cell lysis buffer (20 mM Tris-HCl, 0.5 M NaCl, 10 mM imidazole, pH 7.4), centrifuged at 6000 rpm for 10 min to collect the cells, and the supernatant was removed.
[0060] The buffer solution used for purification is as follows:
[0061] (1) Cell lysis buffer and binding buffer: 20mM Tris-HCl, 0.5M NaCl, 10mM imidazole, pH 7.4, named NTA10.
[0062] (2) Elution Buffer: Contains imidazole at final concentrations of 20mM, 40mM, 60mM, 80mM, 100mM, 200mM, 400mM, and 500mM. The remaining components are the same as those in the binding buffer and are named NTA20, NTA20, NTA60, NTA80, NTA100, NTA200, NTA400, and NTA500, respectively.
[0063] (3) Buffer solution used for gel filtration chromatography: 20mM Tris-HCl, pH 7.4.
[0064] The purification steps are as follows:
[0065] (1) Preparation of crude enzyme solution: The bacterial cells were resuspended in cell lysis buffer and stirred evenly. After confirming that there were no clumps in the bacterial solution, the bacterial solution was placed in an ice-water bath for ultrasonic disruption. The ultrasonic disruption parameters were set as follows: power 30%, ultrasonic time 4s, interval time 3s, and total processing time 45min. After ultrasonic disruption, the disrupted bacterial solution was centrifuged at 4℃ at 12000rpm for 30min. After centrifugation, the supernatant was collected for SDS-PAGE analysis to determine the expression and distribution of the target protein.
[0066] (2) Nickel affinity chromatography: After obtaining the crude enzyme solution of the target protein, it was filtered through a 0.22 μm filter membrane to remove particles that were not completely precipitated by centrifugation and to prevent contamination of the chromatography column. The nickel affinity chromatography column was then rinsed with deionized water and the 20% ethanol sealant was removed. The nickel column was then equilibrated with binding buffer. 10 mL of the filtered crude enzyme solution was added to the equilibrated nickel column, and gradient elution was performed using elution buffers of different imidazole concentrations. The eluents from each gradient were collected for subsequent SDS-PAGE protein electrophoresis analysis. After elution, the nickel column was washed sequentially with deionized water, 0.5 M NaOH, and then with deionized water. Finally, the nickel column was sealed with 20% ethanol and stored at 4°C.
[0067] (3) Gel filtration chromatography: After SDS-PAGE protein electrophoresis, the enzyme solution containing the target protein and reaching the required purity was centrifuged at 12000 rpm for 15 min and filtered through a 0.22 μm filter membrane. The 20% ethanol in the desalting column was rinsed with deionized water, and then the desalting column was equilibrated with 20 mM Tris-HCl buffer at pH 7.4. 1 mL of the treated enzyme solution was added to the equilibrated desalting column, and then 1.5 mL of buffer was used to elute the target protein to complete the replacement of the target protein buffer environment. Finally, the target protein was quantified using a protein quantification kit.
[0068] 3.3 Bidirectional enzyme activity assay of the mutant and parent TmαGP of this application
[0069] 3.3.1 Determination of the forward enzyme activity of the mutant and parent TmαGP of this application
[0070] Definition of αGP forward reaction enzyme activity unit: 1U is defined as the amount of enzyme required per minute to catalyze the production of 1μmol of phosphate with G-1-P as substrate in the presence of α-1,4-glucan primer, and the unit is U / mg.
[0071] A 200 μL reaction solution contained maltodextrin to a final concentration of 9 g / L, 12.5 mM G-1-P, 0.1 M sodium acetate (pH 5.5), and an appropriate amount of αGP. The reaction was initiated by adding αGP and carried out at 60 °C for 10 min. The reaction was terminated by adding 800 μL of molybdate reagent (15 mM ammonium molybdate, 100 mM zinc acetate, pH 5.0), followed by the addition of 200 μL of ascorbic acid reagent (10% wt / vol, pH 5.0). The mixture was incubated at 30 °C for 20 min, and the absorbance was measured at 850 nm to record the response of the reaction mixture. All reactions were performed in triplicate to ensure the accuracy and reliability of the data.
[0072] 3.3.2 Determination of reverse enzyme activity of the mutant and parent TmαGP of this application
[0073] The αGP reverse reaction enzyme activity unit is defined as follows: 1 U is defined as the amount of enzyme required per minute to catalyze the production of 1 μmol of G-1-P using α-1,4-glucan and phosphate as substrates, expressed in U / mg. For the quantitative detection of G-1-P, a cascade of PGM and G6PDH (glucose-6-phosphate dehydrogenase) is used to convert G-1-P into NADH (reduced nicotinamide adenine dinucleotide). The formation of NADH causes a change in absorbance at 340 nm, and the yield of G-1-P is indirectly measured by spectrophotometry.
[0074] The detection process consists of two steps. The first step involves generating the target product G-1-P through an enzymatic reaction. A 200 μL reaction solution contains 20 mM phosphate, 9 g / L maltodextrin, 5 mM MgCl2, and an appropriate amount of αGP. The reaction is initiated by adding αGP, carried out at 60 °C for 10 min, and stopped by adding HClO4 and neutralizing the pH with KOH.
[0075] In the second step of the reaction, PGM catalyzes the conversion of G-1-P to G-6-P, followed by G6PDH utilizing NAD. + As a cofactor, G-6-P is oxidized to 6-phosphogluconolactone, simultaneously generating NADH. A 200 μL reaction solution contains 5 mM MgCl2 and 6 mM NAD2. + The reaction was initiated by adding 2 U / mL PGM, 2 U / mL G6DPH, and an appropriate amount of the first-step reaction product, and the reaction kinetics were monitored at a wavelength of 340 nm. When the absorbance (OD) reached a certain level... 340 The reaction is considered terminated when it reaches a stable state and no longer changes. All reactions are performed in triplicate to ensure data accuracy and reliability.
[0076] like Figure 1As shown, purified TmαGP and the mutant were subjected to an enzymatic reaction at pH 7.4 and 60℃ to determine their enzyme activities. The forward enzyme activity of TmαGP was 0.39 U / mg, and the reverse enzyme activity was 0.14 U / mg. The forward enzyme activity of the mutant enzyme P671T / P672T / A673R / C674M / C675L (TmαGPM6) of this application was 13.25 U / mg, and the reverse enzyme activity was 5.23 U / mg. The forward enzyme activity of TmαGPM6 was 34 times that of TmαGP, and the reverse enzyme activity of TmαGPM6 was 37 times that of TmαGP.
[0077] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.
Claims
1. A mutant α-glucan phosphorylase with enhanced catalytic activity at high temperatures, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO:
2.
2. An α-glucan phosphorylase gene, characterized in that, The gene encodes α-glucan phosphorylase with the amino acid sequence shown in SEQ ID NO:
2.
3. The α-glucan phosphorylase gene according to claim 2, characterized in that, The nucleotide sequence of the α-glucan phosphorylase gene is shown in SEQ ID NO:
3.
4. A recombinant vector comprising the α-glucan phosphorylase gene of claim 2.
5. A recombinant strain comprising the α-glucan phosphorylase gene as described in claim 2.
6. A method for improving the catalytic activity of α-glucan phosphorylase at high temperatures, characterized in that, The method includes the following steps of mutating the α-glucan phosphorylase shown in SEQ ID NO:1: The amino acid at position 671 is mutated from Pro to Thr, the amino acid at position 672 is mutated from Pro to Thr, the amino acid at position 673 is mutated from Ala to Arg, the amino acid at position 674 is mutated from Cys to Met, and the amino acid at position 675 is mutated from Cys to Leu.
7. The application of the α-glucan phosphorylase mutant with enhanced catalytic activity at high temperature as described in claim 1.
8. A method for preparing α-glucan phosphorylase, characterized in that, The method includes the following steps: (1) Transform host cells with a recombinant vector containing the α-glucan phosphorylase gene as described in claim 2 to obtain a recombinant strain; (2) Culture the recombinant strain and induce the expression of α-glucan phosphorylase; (3) Purify the expressed α-glucan phosphorylase.