A SNP molecular marker closely linked to the genetic sex of the snakehead and application thereof
By developing SNP molecular markers and KASP primers that are closely linked to the genetic sex of snakehead fish, and combining them with PCR amplification and fluorescence detection, the problems of accuracy and cost in snakehead fish sex identification have been solved, and efficient asexual breeding and farming have been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies cannot accurately, efficiently, and cost-effectively identify the genetic sex of snakehead fish, which limits the promotion of parthenogenetic farming of snakehead fish. Furthermore, traditional methods are prone to errors, costly, and cumbersome.
Develop SNP molecular markers and their specific KASP primers that are closely linked to the genetic sex of snakehead fish, and combine them with PCR amplification and fluorescence detection to achieve rapid and accurate sex identification.
It achieves high-precision, high-throughput, and low-cost sex identification of snakehead fish, shortens breeding time, improves detection efficiency, and supports the parthenogenesis breeding and aquaculture of snakehead fish.
Smart Images

Figure CN120442771B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to an SNP molecular marker closely linked to the genetic sex of snakehead fish and its application. Background Technology
[0002] The snakehead (Channa striata) belongs to the order Anabantoidei, family Channidae, genus Channa. It is an important freshwater economic fish in Southeast Asia and South Asia, widely distributed in rivers, lakes, and rice paddy ecosystems in countries such as India, Bangladesh, Thailand, Vietnam, and Indonesia. It is also farmed on a large scale in some parts of my country. Due to its delicious and nutritious meat, market demand for snakehead continues to grow. According to FAO statistics, global snakehead farming production exceeded 500,000 tons in 2022. In snakehead farming, males exhibit a significant growth advantage, growing 20%-30% faster than females. This difference is evident even in juveniles (1-2 months old) and gradually increases with the length of the farming cycle. This characteristic of snakehead has significant economic value because the monosex farming of snakehead can shorten the farming cycle, significantly reduce farming costs, and increase unit yield, thereby improving farming efficiency. However, because snakehead fish lack obvious external sex characteristics, especially in the juvenile stage, it is impossible to distinguish males and females by appearance. Traditional methods of dissecting and observing the gonads can cause damage or even death. However, by using molecular markers closely linked to sex, the sex of snakehead fish can be identified quickly, accurately, and without damage in the early stages of snakehead fish farming. Therefore, developing molecular markers closely linked to sex in snakehead fish is a key technology for promoting the asexual farming of snakehead fish.
[0003] Currently, there is still limited research on the sex determination mechanism of snakehead fish, and the mechanism remains unclear. The conservation of reported sex-related genes (such as Dmrt1 and Foxl2) in the population is also unclear, making them unsuitable for direct use in marker development.
[0004] Existing technologies disclose marker primers and methods for identifying the genetic sex of snakehead fish, but they do not accurately identify SNP loci closely linked to the genetic sex of snakehead fish. They only amplify the snakehead gene using one forward primer and one reverse primer, assuming that a single band indicates a female and two bands indicate a male. This method carries a high risk of error in determining the genetic sex of snakehead fish. If amplification fails, it is easy to mistakenly identify a genetically male snakehead fish as a genetically female, making accuracy difficult to guarantee. Furthermore, this method requires electrophoretic analysis, which is cumbersome, difficult to perform high-throughput detection, and has a high cost per sample, making it unsuitable for large-scale molecular marker screening and limiting its contribution to the aquaculture of snakehead fish with asexual reproduction. Summary of the Invention
[0005] To address the technical problems existing in the prior art, this invention aims to provide a specific molecular marker and a matching detection method that is closely linked to the genetic sex of snakehead fish, so as to achieve rapid, high-throughput, high-precision, and low-cost sex identification of snakehead fish, and promote parthenogenesis breeding and aquaculture.
[0006] The first aspect of this invention aims to provide SNP molecular markers that are closely linked to the genetic sex of snakehead fish.
[0007] A second aspect of the present invention aims to provide KASP primers for amplifying SNP molecular markers of the first aspect of the present invention.
[0008] A third aspect of the present invention is to provide a reagent or kit.
[0009] The fourth aspect of this invention aims to provide the application of the SNP molecular marker of the first aspect of this invention, the KASP primer of the second aspect of this invention, and the reagent or kit of the third aspect of this invention.
[0010] The fifth aspect of this invention aims to provide a method.
[0011] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0012] In a first aspect, the present invention provides an SNP molecular marker closely linked to the genetic sex of snakehead fish, the sequence of which is shown in SEQ ID NO:1, the SNP site being located at position 151 from the 5' end of the sequence shown in SEQ ID NO:1, and the bases being T / G.
[0013] In some embodiments of the present invention, when the base is T / T homozygous, the snakehead fish is female, and when the base is T / G heterozygous, the snakehead fish is male.
[0014] In this invention, the physical location of the SNP molecular marker is determined based on the snakehead genome GCA_033026295.1 (Genomeassembly C. striata_1.0), located at position 393098 on chromosome 1 of the snakehead genome.
[0015] A second aspect of the present invention provides KASP primers for amplifying SNP molecular markers of the first aspect of the present invention, comprising a forward primer X, a forward primer Y, and a reverse primer;
[0016] The forward primer X contains a nucleotide sequence as shown in SEQ ID NO:6 (ATGAGAGTACACGTCTTCCT);
[0017] The forward primer Y contains the nucleotide sequence shown in SEQ ID NO:7 (AGTACACGTCTTCCGGC);
[0018] The nucleotide sequence of the reverse primer is shown in SEQ ID NO:5.
[0019] In some embodiments of the present invention, the forward primer X and the forward primer Y contain a tag sequence of a fluorescent group, and the fluorescent groups of the forward primer X and the forward primer Y are different.
[0020] In some embodiments of the present invention, the tag sequence of the fluorescent group is located at the 5' end of the forward primer X and the forward primer Y.
[0021] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.
[0022] In some embodiments of the present invention, the 5' end of the forward primer X is given a FAM fluorescent tag sequence as shown in SEQ ID NO:8(GAAGGTGACCAAGTTCATGCT).
[0023] In some embodiments of the present invention, the nucleotide sequence of the forward primer X is shown in SEQ ID NO:3.
[0024] In some embodiments of the present invention, the 5' end of the forward primer Y is given a HEX fluorescent tag sequence as shown in SEQ ID NO:9 (GAAGGTCGGAGTCAACGGATT).
[0025] In some embodiments of the present invention, the nucleotide sequence of the forward primer Y is shown in SEQ ID NO:4.
[0026] A third aspect of the present invention provides a reagent or kit comprising the KASP primers of the second aspect of the present invention.
[0027] In some embodiments of the present invention, the reagent or kit further contains DNA polymerase, dNTPs, and MgCl2.
[0028] In some embodiments of the present invention, the kit further includes TRET cassette fluorescent primers and ROX internal reference dye.
[0029] A fourth aspect of the present invention provides the application of the SNP molecular marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention in any of the following aspects:
[0030] 1) Determining the sex of snakehead fish;
[0031] 2) Used for marker-assisted breeding of sex-related species in snakehead;
[0032] 3) Snakehead genotyping;
[0033] 4) Constructing a DNA fingerprint of snakehead;
[0034] 5) Snakehead-assisted breeding;
[0035] 6) Prepare products for snakehead assisted breeding.
[0036] A fifth aspect of the present invention provides a method comprising the step of detecting, using the KASP primers of the second aspect of the present invention, the reagents or kits of the third aspect of the present invention, the SNP molecular markers of the first aspect of the present invention in the genome of a snakehead to be tested;
[0037] The method includes any one of (1) to (4):
[0038] (1) A method for identifying the sex of snakehead fish;
[0039] (2) A method for assisted breeding of snakehead fish;
[0040] (3) A method for genotyping snakehead;
[0041] (4) A method for constructing DNA fingerprinting of snakehead.
[0042] In some embodiments of the present invention, the method includes the following steps:
[0043] (1) Extract genomic DNA from the snakehead fish to be tested;
[0044] (2) Using DNA as a template, perform PCR amplification using the KASP primers of the second aspect of the present invention or the reagents or kits of the third aspect of the present invention;
[0045] (3) Analyze the PCR amplification products to obtain the genotypes of SNP molecular markers in the genome of the snakehead to be tested.
[0046] In some embodiments of the present invention, when the genotype is TT, the genetic sex of the snakehead fish to be tested is female, and when the genotype is TG, the genetic sex of the snakehead fish to be tested is male.
[0047] In some embodiments of the present invention, the snakehead DNA can be extracted using conventional methods in this technical field, including the phenol-chloroform method and various DNA extraction kits.
[0048] In some embodiments of the present invention, the PCR amplification reaction program is as follows: 90–94°C for 10–15 minutes; 90–94°C for 20–30 seconds, 56–65°C for 50–60 seconds, with the annealing extension temperature decreasing by 0.8°C per cycle, for 8–10 cycles; 90–94°C for 20–30 seconds, 56–57°C for 56–60 seconds, for 28–30 cycles.
[0049] The beneficial effects of this invention are:
[0050] This invention provides an SNP molecular marker (Cshen 098) that is closely linked to the sex gene of snakehead fish. The SNP site is located at 392098bp on chromosome 1. The genetic sex of snakehead fish can be accurately identified by the single base difference in this molecular marker.
[0051] This invention also provides a specific KASP primer for amplifying molecular markers tightly linked to sex genes in snakehead fish, which can detect the genetic sex of snakehead fish. It is simple to use, has high throughput and high accuracy, and is suitable for the detection of large numbers of samples.
[0052] The molecular markers provided by this invention can help to quickly and accurately screen germplasm materials for the desired genetic sex of snakehead fish, greatly accelerating the breeding or farming process of snakehead fish for parthenogenesis. While reducing time and labor costs, it also allows for high-throughput detection of multiple samples, significantly improving detection efficiency and playing a crucial role in snakehead fish parthenogenesis breeding or farming. Specifically, detecting these molecular markers has significant practical implications for the rapid and accurate screening of female and male snakehead fish, shortening breeding time, and improving breeding efficiency. Attached Figure Description
[0053] Figure 1 The results show the genome sequence comparison between female and male snakehead samples.
[0054] Figure 2 Results of the detection of 56 tailed snakeheads using Cshen 098 as a marker. Detailed Implementation
[0055] The present invention will be further described in detail below through specific embodiments.
[0056] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0057] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.
[0058] The features and performance of the present invention will be further described in detail below with reference to embodiments.
[0059] Example 1: Development of molecular markers for detecting genetic sex in snakehead fish
[0060] Based on the results of previous germplasm resource surveys, the collected snakehead germplasm resources were organized, and 40 germplasm resources were selected, including 20 female snakehead samples and 20 male snakehead samples. The genetic sex of these samples was determined through dissection and gonadal section analysis. All 40 snakehead samples were sent to BGI Genomics Co., Ltd., where paired-end resequencing was performed using the Illumina Xten platform. The sequencing read length was 150 bp, and the sequencing depth was 10×.
[0061] The resequencing data of the snakehead genome was aligned with the snakehead genome sequence. Based on the sequence alignment results, a differentially matched sequence was found between male and female snakeheads. Then, using high-multiplier sequencing, a specific sequence was found by comparing read coverage. Based on this sequence, a closely linked SNP molecular marker (denoted as SNP Cshen 098) was found around it. This SNP molecular marker is located at 392098 bp on chromosome 1 of the snakehead, and its polymorphism is T / G.
[0062] SNP locus information for Cshen 098 ( Figure 1 )as follows:
[0063] >C. striata female
[0064] GTGTGTTTCTCCCGGAAGTAAGGGTTTTTACAGTGTGAGCACAGCCTGCTCGATGCAATTTCTGTTTTTAATGCGCATAGCTTCACTGTCGTATGTTTTCTCTGTGAGCTAATGCAGCGTTTTATGGTTTTATGAGAGTACACGTCTTCCTGCAAACTCAAACAAACAACTTAAGGCAAATAATACTGTATAAGAAACATGGCTGTGGTGTGTGCCGCACAGG CCTTCTGGTGGGAAGCCTCGCTCCTAAAGAAAGGAAAAACTCCACACCGTTGACAGCTTAACGGAATAAGAGAAGTT (SEQ ID NO: 1), the bold bases in the sequence are SNP sites.
[0065] >C. striata male
[0066] GTGTGTTTCTCCCGGAAGTAAGGGTTTTTACAGTGTGAGCACAGCCTGCTCGATGCAATTTCTGTTTTTAATGCGCATAGCTTCACTGTCGTATGTTTTCTCTGTGAGCTAATGCAGCGTTTTATGGTTTTATGAGAGTACACGTCTTCCGG CAAACTCAAACAAACAACTTAAGGCAAATAATACTGTATAAGAAACATGGCTGTGGTGTGTGCCGCACAGGCCTTCTGGTGGGAAGCCTCGCTCCTAAAGAAAGGAAAAACTCCACACCGTTGACAGCTTAACGGAATAAGAGAAGTT(SEQ ID NO: 2), the bold bases in the sequence are SNP sites.
[0067] The SNP positions in the sequence were determined based on the publicly available whole genome sequence of Snakehead cichlid GCA_033026295.1 (Genome assembly C. striata_1.0).
[0068] Example 2: Primer Combination Design for KSAP Detection of Molecular Markers
[0069] In this embodiment, based on the SNP locus obtained in Example 1, sequences within 150 bp upstream and downstream of the 392098 bp position on chromosome 1 were searched. Copy number and GC content analyses were performed on this developed locus to ensure its high success rate with KASP markers. This locus was then designed as a KASP marker, and a set of KASP primers, ChS900001_K02, was designed based on the sequence characteristics of the SNP locus for detecting genotypes of different genetic sexes in snakehead. The primer sequences are shown in Table 1, including Primer X, Primer Y, and a reverse primer. The 5' end of the forward primer Primer X carries a FAM fluorescent signal tag (underlined in Table 1), and the 5' end of the forward primer Primer Y carries a HEX fluorescent signal tag (underlined in Table 1). This primer combination can specifically bind to the corresponding sequences upstream and downstream of the SNP locus.
[0070] Table 1 KASP primer sequences
[0071] Primer X 5'-GAAGGTGACCAAGTTCATGCTATGAGAGTACACGTCTTCCT-3'(SEQ ID NO:3) Primer Y 5'-GAAGGTCGGAGTCAACGGATTAGTACACGTCTTTCCGGC-3'(SEQ ID NO:4) reverse primer 5'-AGGCTTCCCACCAGAAGGCCTGTG-3'(SEQ ID NO:5)
[0072] The primer sequences described above were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping method provided by this invention offers high throughput and is simple to operate. It only requires adding the specific KASP Primer mix and the universal KASP Master mix to a PCR microplate containing a DNA sample for PCR amplification. The final results can be analyzed using a fluorescence detector.
[0073] The KASP Master mix contains the following components: universal TRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl2. The KASP Master mix is a product of LGC Ltd., UK, with catalog number KBS-1016-002.
[0074] Example 3: Validation of SNP molecular markers
[0075] The detection accuracy was verified using 56 snakehead fish of different genetic sexes, including 28 females and 28 males (Table 2). DNA was extracted from the 56 snakehead fish using the phenol-chloroform extraction method, and KASP primers ChS900001_K02 provided in Example 2 were used for KASP primer genotyping.
[0076] Table 2. Genetic sex information of snakehead fish
[0077] Sample number Genetic sex Sample number Genetic sex Sample number Genetic sex Sample number Genetic sex A1 Female, XX A15 Female, XX B1 Male, XY B15 Male, XY A2 Female, XX A16 Female, XX B2 Male, XY B16 Male, XY A3 Female, XX A17 Female, XX B3 Male, XY B17 Male, XY A4 Female, XX A18 Female, XX B4 Male, XY B18 Male, XY A5 Female, XX A19 Female, XX B5 Male, XY B19 Male, XY A6 Female, XX A20 Female, XX B6 Male, XY B20 Male, XY A7 Female, XX A21 Female, XX B7 Male, XY B21 Male, XY A8 Female, XX A22 Female, XX B8 Male, XY B22 Male, XY A9 Female, XX A23 Female, XX B9 Male, XY B23 Male, XY A10 Female, XX A24 Female, XX B10 Male, XY B24 Male, XY A11 Female, XX A25 Female, XX B11 Male, XY B25 Male, XY A12 Female, XX A26 Female, XX B12 Male, XY B26 Male, XY A13 Female, XX A27 Female, XX B13 Male, XY B27 Male, XY A14 Female, XX A28 Female, XX B14 Male, XY B28 Male, XY
[0078] The extracted DNA was diluted to 18–22 ng / μL (preferably 20 ng / μL) and used as a template. Amplification was performed using a 10 μL PCR reaction mixture, comprising 5 μL DNA template, 5 μL KASP Primer mix (Primer X and Primer Y at 1 μM, reverse primer at 3 μM), and 0.14 μL KASP Master mix. The PCR reaction program was as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃–56℃ for 60 seconds, with the annealing extension temperature decreasing by 0.8℃ per cycle, for 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, for 30 cycles. The PCR amplification products were scanned for fluorescence signals using ARAYA, and then data analysis and genotyping were performed using INTELLICS.
[0079] KASP genotyping results are as follows: Figure 2As shown in the figure, two genotypes were detected: TT and TG. The genotype was determined by detecting the two fluorescent colors and intensities in the KASP product. Each dot in the figure represents a test sample. All samples were divided into red and purple areas, with red dots representing the homozygous TT genotype and purple dots representing the heterozygous TG genotype. There were 28 tails with the TT genotype and 28 tails with the TG genotype. Statistical analysis was performed on the relationship between genotype and sex inheritance in snakehead (Table 3).
[0080] The genotypes obtained from KASP were compared with the corresponding genetic sex of snakehead fish to determine the detection accuracy. As shown in Table 3, when the genotype detected at this SNP locus was TT, it was 100% genetically female; when the genotype was TG, it was 100% genetically male.
[0081] Therefore, molecular marker typing of snakehead fish using KASP primer ChS900001_K02 can accurately predict its genetic sex, providing a reliable method and basis for sex selection of snakehead fish during the seedling stage, and also laying the foundation for the development of molecular-assisted parthenocarpy breeding technology for snakehead fish.
[0082] Table 3. Results of genetic sex determination in snakehead based on SNP loci.
[0083] Sample number Genetic sex KASP genotype Sample number Genetic sex KASP genotype A1 Female, XX T:T B1 Male, XY T:G A2 Female, XX T:T B2 Male, XY T:G A3 Female, XX T:T B3 Male, XY T:G A4 Female, XX T:T B4 Male, XY T:G A5 Female, XX T:T B5 Male, XY T:G A6 Female, XX T:T B6 Male, XY T:G A7 Female, XX T:T B7 Male, XY T:G A8 Female, XX T:T B8 Male, XY T:G A9 Female, XX T:T B9 Male, XY T:G A10 Female, XX T:T B10 Male, XY T:G A11 Female, XX T:T B11 Male, XY T:G A12 Female, XX T:T B12 Male, XY T:G A13 Female, XX T:T B13 Male, XY T:G A14 Female, XX T:T B14 Male, XY T:G A15 Female, XX T:T B15 Male, XY T:G A16 Female, XX T:T B16 Male, XY T:G A17 Female, XX T:T B17 Male, XY T:G A18 Female, XX T:T B18 Male, XY T:G A19 Female, XX T:T B19 Male, XY T:G A20 Female, XX T:T B20 Male, XY T:G A21 Female, XX T:T B21 Male, XY T:G A22 Female, XX T:T B22 Male, XY T:G A23 Female, XX T:T B23 Male, XY T:G A24 Female, XX T:T B24 Male, XY T:G A25 Female, XX T:T B25 Male, XY T:G A26 Female, XX T:T B26 Male, XY T:G A27 Female, XX T:T B27 Male, XY T:G A28 Female, XX T:T B28 Male, XY T:G
[0084] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. The use of reagents for detecting a SNP molecular marker that is closely linked to the genetic sex of the snakehead in identifying the sex of the snakehead, characterized in that, The sequence of the SNP molecular marker is shown as SEQ ID NO:1, the SNP site is located at the 151th site from the 5' end of the sequence shown in SEQ ID NO:1, and the base is T / G; when the genotype of the SNP molecular marker in the genome of the Ophiocephalus veinalis to be measured is TT homozygote, the genetic sex of the Ophiocephalus veinalis to be measured is female; when the genotype of the SNP molecular marker in the genome of the Ophiocephalus veinalis to be measured is TG heterozygote, the genetic sex of the Ophiocephalus veinalis to be measured is male.
Citation Information
Patent Citations
Molecular marker, primer group, kit and method for identifying sex of ophicephalus obscura
CN116042856A
SNP molecular marker related to genetic sex of oxyeleotris marmorata and application of SNP molecular marker
CN117925805A