SNP (Single Nucleotide Polymorphism) molecular marker related to sheep body weight character and application of SNP molecular marker
By marking the C/T base SNP molecular at position 35074122bp of chromosome 11 of the sheep genome, combined with PCR amplification and fluorescent labeling primer combination, the problem of inefficient weight trait selection in sheep breeding was solved, and efficient identification and breeding improvement of sheep weight traits were achieved.
Patent Information
- Application Number
- CN202510611760.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-08
AI Technical Summary
In the prior art, it is difficult to efficiently and accurately select sheep with excellent weight traits in sheep breeding, resulting in low breeding efficiency.
The SNP molecular marker with the C/T base at position 35074122bp of chromosome 11 of the sheep genome was used to distinguish high-weight and low-weight sheep by PCR amplification and fluorescent marker primers, and the TT genotype was selected for seed preservation and hybridization management during breeding.
Early accurate identification and efficient breeding of sheep weight traits were achieved, the breeding efficiency of sheep population was improved, and the variance of weight variance was explained by 6.11% and the genetic excellent weight traits were stabilized.
Smart Images

Figure CN120442808A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a SNP molecular marker related to sheep weight traits and an application thereof. Background Art
[0002] In the field of sheep genetic breeding, weight is one of the most important indicators for measuring growth and development. This important indicator is closely related to meat production. Generally speaking, heavier sheep have larger bodies and more muscle mass, resulting in higher meat production. By measuring weight, it is possible to predict a sheep's meat production performance, providing an important reference for weight traits in meat production and sheep breeding, and is widely used in genetic evaluation. By selecting sheep with excellent weight traits as breeding sheep, the growth and development levels and production performance of offspring can be improved. The high genetic stability of weight traits means that sheep weight and overall growth performance can be continuously improved through genetic improvement. Traditional breeding methods mainly rely on phenotypic selection or hybrid improvement, which are inefficient and difficult to accurately predict the phenotype of offspring.
[0003] Marker-assisted selection (MAS) involves analyzing the association between the genotype and phenotypic traits of molecular markers closely linked to target genes, enabling more accurate early selection for specific traits. Single nucleotide polymorphisms (SNPs) are a type of molecular marker that refer to changes in the DNA sequence caused by variations in a single nucleotide at the same position in the genome between individuals, which in turn influence gene expression. Using SNPs for early assisted selection of sheep weight is crucial to providing a comprehensive breeding process for weight-based sheep. Summary of the Invention
[0004] The purpose of the present invention is to provide a SNP molecular marker related to sheep weight traits and its application, to quickly screen and identify sheep weight traits, and to improve the breeding efficiency of sheep populations with weight advantages.
[0005] The invention provides a SNP molecular marker related to the weight trait of sheep. The SNP molecular marker corresponds to the 35074122 bp of chromosome 11 of the sheep genome, and the base is C / T.
[0006] The present invention also provides a DNA fragment related to the body weight trait of sheep, wherein the DNA fragment comprises the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is the base C / T.
[0007] The present invention also provides a primer combination for amplifying the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution, wherein the primer combination includes a first forward primer with a nucleotide sequence as shown in SEQ ID NO: 2, a second forward primer with a nucleotide sequence as shown in SEQ ID NO: 3, and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4.
[0008] Preferably, the 5' ends of the first forward primer and the second forward primer are connected to fluorescent groups respectively, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescence colors.
[0009] Preferably, the 5' end of the first forward primer is connected to a fluorescent group VIC; the 5' end of the second forward primer is connected to a fluorescent group FAM.
[0010] The present invention also provides a kit for detecting the SNP molecular markers described in the above technical solution, wherein the kit comprises the primer combination described in the above technical solution.
[0011] The present invention also provides the use of a substance for detecting the SNP molecular marker described in the above technical solution, or a substance for detecting the DNA fragment described in the above technical solution, or a primer combination described in the above technical solution, or a kit described in the above technical solution in one or more of the following:
[0012] (1) Identify or assist in identifying sheep weight traits;
[0013] (2) distinguish between high-weight and low-weight sheep;
[0014] (3) Breeding or assisting in breeding high-weight sheep;
[0015] (4) Screening or assisting in screening high-weight sheep.
[0016] Preferably, the sheep include Bamer sheep; the age of the sheep is ≥12 months.
[0017] The present invention also provides a method for identifying the weight trait of sheep, comprising the following steps:
[0018] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer combination described in the above technical solution to obtain a PCR amplification product;
[0019] If the PCR amplification product corresponds to the deoxyribonucleotide pair 35074122 of chromosome 11 of the sheep genome is TT, the sheep to be tested is a high-weight sheep.
[0020] The present invention also provides a genetic breeding method for sheep weight traits, comprising the following steps: determining the base type of Y in the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution in the sheep population; selecting individuals with the base type of TT type, and eliminating individuals with CC and CT types, so as to increase the frequency of gene T from generation to generation, thereby optimizing the weight traits of offspring sheep.
[0021] Beneficial effects:
[0022] The present invention provides a single-nucleotide polymorphism (SNP) molecular marker associated with sheep weight. The SNP molecular marker corresponds to chromosome 11, bp 35,074,122, of the sheep genome, and has a C / T base sequence. The SNP molecular marker is significantly correlated with sheep weight, explaining 6.11% of the weight variance. In the SNP molecular marker, T is a favorable allele for the sheep weight trait. The SNP molecular marker can be used to identify sheep weight traits, distinguishing high-weight from low-weight sheep. During breeding, the TT genotype can be selected for seed preservation. During breeding, the TT genotype is used as breeding stock, and sheep with the C allele are excluded from crossbreeding with other sheep. Artificial insemination using semen from TT genotype rams can greatly improve breeding efficiency, resulting in a flock with a weight advantage and ensuring stable inheritance. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0024] Figure 1 This is a diagram showing the KASP typing results of the SNP molecular marker (chr11_35074122: C>T) of the present invention;
[0025] Figure 2 This is a box plot of the residual values of the SNP molecular marker (chr11_35074122: C>T) of the Bamberg sheep with different genotypes after weight correction of the fixed effect. DETAILED DESCRIPTION
[0026] The invention provides a SNP molecular marker related to the weight trait of sheep. The SNP molecular marker corresponds to the 35074122 bp of chromosome 11 of the sheep genome, and the base is C / T.
[0027] As an embodiment, the reference genome for the sheep genome described in the present invention is ovis_aries_rambouillet_1.0 (https: / / uswest.ensembl.org / Ovis_aries_rambouillet / Info / Index). The present invention found a C / T mutation at bp 35,074,122 of chromosome 11 of the sheep genome, specifically between the PIK3R5 and PIK3R6 genes, which was significantly correlated with sheep weight.
[0028] The present invention also provides a DNA fragment related to sheep weight traits, wherein the DNA fragment comprises the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is the base C / T.
[0029] The nucleotide sequence shown in SEQ ID NO: 1 of the present invention is specifically: 5'-TTTTTGGCTGTGCTGGGTCTCTGTTGCTACGCCGGCTTTTCCCTAGTTGC AGAGAACAGGAAGTCATCTGTAGTTGCGGTGCGCAGGCTGCACCTTGCGGYGGTGTCTCGTTGCGGAGCATGGGCTCTGGGCTCACGGCCTCAGTAGCTGTGGTTCCCAAGCTCCAGAGCACAGGCTCAATAGCTGCTCCAAGGCATGTGG-3'; wherein, Y is the base C / T.
[0030] The present invention also provides a primer combination for amplifying the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution, wherein the primer combination includes a first forward primer with a nucleotide sequence as shown in SEQ ID NO: 2, a second forward primer with a nucleotide sequence as shown in SEQ ID NO: 3, and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4.
[0031] The nucleotide sequences shown in SEQ ID NOs: 2 to 4 of the present invention are as follows:
[0032] SEQ ID NO: 2: 5'-TCCGCAACGAGACACCG-3';
[0033] SEQ ID NO: 3: 5'-CTCCGCAACGAGACACCA-3';
[0034] SEQ ID NO: 4: 5'-AGTCATCTTGTAGTTGCGGTGC-3'.
[0035] As an embodiment, the 5' end of the first forward primer and the second forward primer of the present invention are respectively connected to fluorescent groups, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescent colors. As an embodiment, the 5' end of the first forward primer of the present invention is connected to the fluorescent group VIC; the 5' end of the second forward primer is connected to the fluorescent group FAM. As an embodiment, the nucleotide sequence of the first forward primer of the present invention is shown in SEQ ID NO:5. As an embodiment, the nucleotide sequence of the second forward primer of the present invention is shown in SEQ ID NO:6. The present invention uses the fluorescent group VIC and the fluorescent group FAM to distinguish between two isogenic sites C and T, and has the best accuracy when used for fluorescent signal intensity and stability assessment.
[0036] The present invention also provides a kit for detecting the SNP molecular markers described in the above technical solution, wherein the kit comprises the primer combination described in the above technical solution.
[0037] As an embodiment, the kit of the present invention further comprises 2×Taq DNA Polymerase Mix.
[0038] The present invention also provides the use of a substance for detecting the SNP molecular marker described in the above technical solution, or a substance for detecting the DNA fragment described in the above technical solution, or a primer combination described in the above technical solution, or a kit described in the above technical solution in one or more of the following: (1) identifying or assisting in identifying the weight trait of sheep; (2) distinguishing between high-weight sheep and low-weight sheep; (3) breeding or assisting in breeding high-weight sheep; (4) screening or assisting in screening high-weight sheep.
[0039] As an embodiment, the sheep of the present invention include Bamian sheep.
[0040] As one embodiment, the age of the sheep of the present invention is ≥12 months; as another embodiment, the age of the sheep of the present invention is 24 months.
[0041] The present invention also provides a method for identifying the weight trait of sheep, comprising the following steps:
[0042] Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer combination described in the above technical solution to obtain a PCR amplification product;
[0043] If the PCR amplification product corresponds to the deoxyribonucleotide pair 35074122 of chromosome 11 of the sheep genome is TT, the sheep to be tested is a high-weight sheep.
[0044] As an embodiment, the amplification system for PCR amplification described in the present invention includes: 2 μL 2×Taq DNA Polymerase Mix, 1 μL primer combination, and 2 μL genomic DNA of the sheep to be tested. As an embodiment, the primer combination described in the present invention includes 100 μL / mL of a first forward primer, 100 μL / mL of a second forward primer, 100 μL / mL of a reverse primer, and water. As an embodiment, the volume ratio of 100 μL / mL of the first forward primer, 100 μL / mL of the second forward primer, 100 μL / mL of the reverse primer, and water in the primer combination described in the present invention is 24:24:48:100. As an embodiment, the concentration of the genomic DNA of the sheep to be tested described in the present invention is 20 ng / μL. As an embodiment, the amplification program of the PCR amplification described in the present invention includes: pre-denaturation at 94°C for 10 minutes; denaturation at 94°C for 20 seconds, annealing / extension at 61-55°C (reduction of 0.6°C / cycle) for 45 seconds, 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 45 seconds, 37 cycles.
[0045] The present invention also provides a genetic breeding method for sheep weight traits, comprising the following steps: determining the base type of Y in the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution in the sheep population; selecting individuals with the base type of TT type, and eliminating individuals with CC and CT types, so as to increase the frequency of gene T from generation to generation, thereby optimizing the weight traits of offspring sheep.
[0046] In one embodiment, the present invention uses genomic DNA from a sheep to be tested as a template and performs PCR amplification using the primer combination described in the above technical solution to obtain a PCR amplification product. The PCR amplification product is then used to determine the base type of Y in the SNP molecular marker described in the above technical solution or the DNA fragment described in the above technical solution in the sheep population. The reaction system and procedure for PCR amplification described in the present invention have been described above and are not further described here.
[0047] In the SNP molecular marker described herein, T represents a favorable allele for the sheep weight trait. The SNP molecular marker described herein can be used to identify sheep weight traits and distinguish between heavier and lighter sheep. By selecting the TT genotype for seed preservation during breeding, using TT genotypes as breeding stock, and excluding sheep with the C allele during crossbreeding with other sheep, artificial insemination using semen from TT genotype rams can significantly improve breeding efficiency and produce flocks with advantageous weight.
[0048] To further illustrate the present invention, a SNP molecular marker associated with sheep weight traits and its application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.
[0049] Example 1
[0050] 1. Experimental materials: 184 24-month-old Bamian sheep.
[0051] 2. Reagents and instruments: Reagents: 2× Taq DNA Polymerase Mix; PCR amplification: ABI 9700196Dual; fluorescence value reading: FLUOstar OEMGA; fluorescence value analysis: Kluster Callergenotypingsoftware; all reagents and instruments were purchased from Beijing Yinuo Zhongda Biotechnology Co., Ltd.
[0052] 3. Extraction of genomic DNA: Take jugular vein blood from Bamberg sheep and use a DNA extraction kit to extract genomic DNA from Bamberg sheep; dilute the DNA to 20 ng / μL.
[0053] 4. PCR amplification
[0054] (1) PCR primer dilution: Beijing Yinuo Zhongda Biotechnology Co., Ltd. was commissioned to synthesize PCR primers (forward primer-VIC (F1), forward primer-FAM (F2), and reverse primer (R)); the dry powder of the PCR primers was diluted to 100 μL / mL, and then the diluted PCR primers were mixed with water in a volume ratio of F1:F2:R:water = 24:24:48:100 to obtain a PCR primer master solution. The nucleotide sequences of the PCR primers are as follows:
[0055] Forward primer-VIC(F1): Among them, the bold part is the universal fluorescent group VIC;
[0056] Forward primer-FAM (F2): Among them, the bold part is the universal fluorescent group FAM;
[0057] Reverse primer (R): 5′-AGTCATCTGTAGTTGCGGTGC-3′ (SEQ ID NO: 4);
[0058] (2) Using the genomic DNA of Bamei sheep as a template, PCR amplification was performed using the diluted PCR amplification primers; wherein, the PCR amplification system was: 2 μL 2× Taq DNA Polymerase Mix, 1 μL 4× PCR amplification primer master solution and 2 μL Bamei sheep genomic DNA;
[0059] The PCR amplification program was as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 20 s, annealing / extension at 61-55°C (decrease 0.6°C / cycle) for 45 s, 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 45 s, 37 cycles.
[0060] 5. Fluorescence value reading
[0061] After PCR amplification, fluorescence was read using a FLUOstar OEM instrument from LGC Genomics Ltd. at temperatures below 40°C. SNP detection used the fluorophores VIC (excitation 535 nm, emission 556 nm) and FAM (excitation 485 nm, emission 520 nm) to distinguish between the two isogenic loci, C and T. A passive reference dye, ROX, was used to correct for signal variations between wells due to reaction volume errors.
[0062] 6. Determination of chr11_35074122:C>T genotype
[0063] The fluorescence values were analyzed using the KlusterCaller genotyping software that comes with the FLUOstar OEM device from LGC Genomics Ltd. In this software, VIC and FAM data are plotted on the x-axis and y-axis, respectively. The fluorescence values of VIC and FAM in each reaction well are corrected and normalized by the fluorescence value of ROX to obtain the relative fluorescence values corresponding to VIC and FAM in each PCR reaction well. Based on the relative fluorescence values, the samples were clustered and the genotypes were determined based on the sample clusters and fluorescence types. The specific results are shown in Figure 2. Figure 1 As shown in the figure, red represents CC type, green represents CT type, and blue represents TT type. The genotype frequencies are shown in Table 1. The gene frequency of CC type is 0.67, the gene frequency of CT type is 0.22, and the gene frequency of TT type is 0.01.
[0064] Table 1 Statistical results of the genotype frequency of chr11_35074122:C>T in the tested Bamei sheep
[0065]
[0066] 7. Calculate the relationship between chr11_35074122:C>T genotype and sheep weight
[0067] First, the general linear model (GLM) was used to correct the effects of age and sheep farm in the weight data, and the residuals were derived as phenotypic values ( Figure 2Principal component analysis (PCA) was then performed, with the first three principal components obtained from the PCA used as covariates. The BLINK function in the BLINK software package (https: / / github.com / YaoZhou89 / BLINK) was then used to calculate the effect of the single-point SNP on the weight phenotype using a mixed linear model (MLM) based on the chr11_35074122:C>T genotype. The MLM was as follows: y = Q + K + S + e; where y represents the phenotypic data; Q represents the first three principal components obtained from the PCA residuals derived from the general linear model (GLM) after adjusting for age and farm effects in the weight data; K represents the kinship matrix between individuals; S represents the coefficient matrix composed of the chr11_35074122:C>T genotypes (0 indicates homozygous CC, 1 indicates heterozygous CT, and 2 indicates homozygous TT); and e represents the random residual effect. The results are shown in Table 4.
[0068] Table 2 Statistical results of body weight and chr11_35074122:C>T genotype of tested Bamei sheep
[0069]
[0070]
[0071] Table 3 Statistical analysis results of body weight and chr11_35074122:C>T genotype of tested Bamei mutton sheep
[0072]
[0073] Note: Different lowercase letters in the table indicate significant differences.
[0074] Table 4 Association analysis between body weight and chr11_35074122:C>T genotype of Bamei sheep
[0075] SNP total P.value Effects of mutations Phenotypic variance explained by SNPs (%) chr11_35074122:C>T 184 1.59E-10 3.31115 6.11%
[0076] according to Figure 2As can be seen from Tables 2 to 4, the molecular marker chr11_35074122: C>T is significantly associated with the weight of Bamei meat sheep. Sheep carrying the CT genotype weigh less than those carrying the TT genotype (P.value = 1.59E-10). The T allele increases sheep weight, with an effect size of 3.31115. This SNP locus can explain 6.11% of the phenotypic variance. Although weight is controlled by multiple genes, this SNP locus still has a large effect. During breeding, the TT genotype is selected for seed preservation. During breeding, the TT genotype is used as breeding sheep. When crossing with other sheep, the C allele needs to be excluded. In particular, artificial insemination using semen from TT genotype rams can greatly improve breeding efficiency, obtain sheep with an advantage in weight, and ensure stable inheritance.
[0077] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A SNP molecular marker associated with sheep body weight traits, characterized in that: The SNP molecular marker corresponds to the 35074122 bp of chromosome 11 of the sheep genome, and the base is C / T.
2. A DNA fragment associated with a sheep weight trait, characterized in that: The DNA fragment includes the nucleotide sequence shown in SEQ ID NO: 1, wherein Y is the base C / T.
3. A primer combination for amplifying the SNP molecular marker according to claim 1 or the DNA fragment according to claim 2, characterized in that: The primer combination includes a first forward primer whose nucleotide sequence is shown in SEQ ID NO: 2, a second forward primer whose nucleotide sequence is shown in SEQ ID NO: 3, and a reverse primer whose nucleotide sequence is shown in SEQ ID NO:
4.
4. The primer combination according to claim 3, characterized in that The 5' ends of the first forward primer and the second forward primer are respectively connected to fluorescent groups, and the fluorescent groups connected to the first forward primer and the first upstream primer emit different fluorescence colors.
5. The primer combination according to claim 4, characterized in that The 5' end of the first forward primer is connected to the fluorescent group VIC; the 5' end of the second forward primer is connected to the fluorescent group FAM.
6. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the primer combination according to any one of claims 3 to 5.
7. Use of the substance for detecting the SNP molecular marker of claim 1, the substance for detecting the DNA fragment of claim 2, the primer combination of any one of claims 3 to 5, or the kit of claim 6 in one or more of the following: (1) Identify or assist in identifying the weight traits of sheep; (2) distinguish between high-weight and low-weight sheep; (3) Breeding or assisting in breeding high-weight sheep; (4) Screening or assisting in screening high-weight sheep.
8. The use according to claim 7, characterized in that The sheep include Bamer sheep; the age of the sheep is ≥12 months.
9. A method for identifying the weight trait of sheep, characterized in that: The steps include: Using the genomic DNA of the sheep to be tested as a template, PCR amplification is performed using the primer combination according to any one of claims 3 to 5 to obtain a PCR amplification product; If the PCR amplification product corresponds to the deoxyribonucleotide pair 35074122 of chromosome 11 of the sheep genome is TT, the sheep to be tested is a high-weight sheep.
10. A genetic breeding method for sheep weight traits, characterized in that: The method comprises the following steps: determining the base type of the SNP molecular marker according to claim 1 or the base type of Y in the DNA fragment according to claim 2 in a sheep population; selecting individuals with the base type of TT type and eliminating individuals with CC and CT types, so as to increase the frequency of gene T generation by generation, thereby optimizing the weight trait of offspring sheep.
Citation Information
Cited By
Molecular marker related to age-round weight character of sheep and application of molecular marker
CN121204260A