A molecular marker associated with growth traits in Hu sheep and its application

Abstract

This invention provides a molecular marker associated with growth traits in Hu sheep and its application. The nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, where M at position 355 bp represents A or C. This invention, through PCR amplification and sequence analysis of the GC gene in Hu sheep, discovered an A / C polymorphic site at position 355 of the amplified fragment. Further analysis using KASPar primers to detect the polymorphic site in 1228 Hu sheep and establishing a least-squares model, along with genotype-growth trait association analysis, ultimately determined that the amplified GC gene fragment can serve as a molecular marker associated with average daily weight gain and feed conversion ratio in Hu sheep. This invention, by detecting the molecular marker, can be used to select homozygous AA-type Hu sheep for breeding stock in the core flock, thereby improving growth traits and increasing economic benefits.

Description

Technical Field

[0001] This invention belongs to the technical field of molecular markers, specifically relating to the use of GC gene fragments as molecular markers affecting the growth traits of Hu sheep and their applications. Background Technology

[0002] The GC gene encodes a vitamin D-binding protein. Liping Guo et al. (Guo, Wei, Yi, Yang, & Chen, 2021) identified GC as a key candidate gene for subcutaneous fat in adult to aged ducks through transcriptome analysis. Vitamin D (VitD) is a fat-soluble vitamin that is transported to the liver for hydroxylation to produce 25-hydroxyvitamin D [25(OH)D] (Ab Bas, 2017). 25(OH)D is mainly distributed in the fat, liver, and muscles of animals and is the primary circulating form of vitamin D, produced by enzymes required for the production of active vitamin D (Wamberg et al., 2013). In humans, a serum 25(OH)D concentration below 50 nmol / L is defined as vitamin D deficiency (Holick et al., 1911). Furthermore, obese individuals have lower serum 25(OH)D levels, which are negatively correlated with body mass index and body fat index (González-Molero et al., 2013; Xiao-Mei Mai* & Langhammer, 2012). Therefore, the GC gene may play an important role in altering animal body weight. However, research on the GC gene in Hu sheep is limited, and its specific effects on Hu sheep remain unclear. Summary of the Invention

[0003] To overcome the shortcomings of the prior art, the present invention provides a molecular marker and its application related to the growth traits of Hu sheep.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] On the one hand, the present invention provides a molecular marker related to the growth traits of Hu sheep. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the M at position 355 bp represents A or C. Since there is an A / C mutation at position 355 of the above sequence, it leads to the A / C polymorphism of the Hu sheep GC gene at this site.

[0006] The results of genotype-trait association analysis showed that, with the extension of the testing period, the GC g.19484A>C mutation site was significantly associated with the body weight, height, and length of Hu sheep. Hu sheep carrying the AA genotype had better body weight, height, and length than those carrying the CC genotype (P<0.05), indicating that the A allele was the dominant allele.

[0007] Secondly, the present invention provides primer pairs for detecting the above-mentioned molecular markers. Any primer that can specifically amplify the molecular markers of the present invention or fragments containing the above-mentioned polymorphic sites is suitable for detecting the molecular markers. Preferably, it includes primer MF and primer MR, wherein the nucleotide sequence of primer MF is shown in SEQ ID NO.2 and the nucleotide sequence of primer MR is shown in SEQ ID NO.3.

[0008] Furthermore, the present invention also provides a primer pair for detecting the above-mentioned molecular markers, preferably a KASPar primer pair, which includes a forward primer 1 for detecting AlleleA, a forward primer 2 for detecting AlleleC, and a universal reverse primer. The nucleotide sequence of the forward primer 1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.

[0009] Thirdly, the present invention provides a detection kit for detecting the above-mentioned molecular markers, the kit comprising primer pairs or KASPar primer pairs for detecting the above-mentioned molecular markers.

[0010] Fourthly, the present invention provides a method for detecting molecular markers associated with growth traits in Hu sheep, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the M at position 355 bp represents A or C. The method includes detecting the genomic DNA of Hu sheep using the primer pairs or kits described above, and the specific detection method includes the following steps:

[0011] S1. Amplify the genomic DNA of the Hu sheep using the primer pairs, KASPar primer pairs, or kits containing the primer pairs described above.

[0012] S2. Identify the polymorphic sites in the amplification products obtained in step S1.

[0013] In step S2, the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, probe method, gene chip method, and high-resolution melting curve method.

[0014] More specifically, the method for detecting molecular markers related to growth traits of Hu sheep using the above primer pairs in this invention includes the following steps:

[0015] a) Genomic DNA was extracted from the blood of Hu sheep and amplified by high-throughput water bath PCR using KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0016] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.

[0017] Fifthly, the present invention provides the application of the detection method of molecular markers, primer pairs or kits as described above in the detection of growth traits in Hu sheep. By detecting the molecular markers of the present invention in the genomic DNA of the Hu sheep to be tested and analyzing the type of polymorphic sites, the level of growth traits of the Hu sheep can be determined, thereby screening out fast-growing Hu sheep.

[0018] Fifthly, the present invention provides the application of the detection methods of molecular markers, primer pairs or kits as described above in the breeding of Hu sheep. By using the above-mentioned primer pairs or kits to amplify and detect the genomic DNA of Hu sheep, the genotype of the GC gene of the sample to be tested can be determined, thereby enabling the selection of fast-growing Hu sheep breeds.

[0019] Identifying gene variation sites and analyzing their association with traits to discover the relationship between genes and traits is an important method for studying gene function and a foundation for marker-assisted selection. This invention, through PCR amplification and sequencing of the GC gene of the representative Hu sheep breed, revealed an A / C polymorphism site at position 355 of the amplified fragment. By detecting polymorphisms in 1288 Hu sheep and establishing a least-squares model, a molecular marker associated with the growth traits of Hu sheep was identified. This molecular marker can be used for the breeding of new high-quality meat sheep breeds, providing an effective genetic engineering method for the genetic improvement of growth traits in Hu sheep, and has significant practical application value.

[0020] This invention detects the aforementioned molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, allowing all site detections to ultimately use universal fluorescent primers for amplification. This significantly reduces reagent costs and provides high accuracy, offering a simple, accurate, and low-cost method for detecting the molecular markers of this invention.

[0021] The beneficial effects of this invention are as follows:

[0022] This invention provides a molecular marker associated with the growth traits of Hu sheep, specifically the A / C polymorphism at position 355 of the fragment in SEQ ID NO.1. By determining the genotype of this polymorphism, it is possible to effectively identify whether a sheep is a fast-growing Hu sheep, providing an effective detection method for the breeding of fast-growing Hu sheep. This invention, through the detection of the molecular marker and the site leading to this polymorphism, can be used to select Hu sheep with homozygous AA genes as breeding stock for improving their growth traits and thus contributing to increased economic benefits in Hu sheep farming. Attached Figure Description

[0023] Figure 1 This is a gel electrophoresis image of the Hu sheep GC gene fragment used as a molecular marker in this invention.

[0024] Figure 2 This is the sequencing result of the GC gene mutation site in the Hu sheep in this invention.

[0025] Figure 3 The KASPar SNP typing result is for the A / C polymorphic site shown at position 355 of the amplified fragment of the Hu sheep in this invention. Detailed Implementation

[0026] The molecular marker of this invention is amplified from the GC gene of Hu sheep, and its specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying the DNA sequence of the Hu sheep GC gene and sequencing it, polymorphic sites of the GC gene are identified, the correlation between different genotypes and growth traits of Hu sheep is analyzed, and a detection method for molecular markers containing polymorphic sites is established. This molecular marker can be applied to the breeding of new high-quality meat sheep breeds.

[0027] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this invention are of analytical grade or higher.

[0029] Example 1: Amplification of the GC gene

[0030] Using Hu sheep GC gene DNA (GenBank accession number: NC_040257.1) as a template, a pair of primers, MF and MR, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0031] MF (SEQ ID NO.2): 5'-ACATTATTTAAAAGGAATGGC-3'

[0032] MR(SEQ ID NO.3):5'-AGTATTATAACCTCTGCTCT-3'

[0033] (2) Amplification and sequencing of GC genes

[0034] The total reaction volume for PCR amplification was 25 μL, including 12.4 μL of 2×PCR Master Mix, 0.8 μL of M-F (10 μmol / L), 0.8 μL of MR (10 μmol / L), 1 μL of DNA template, and 10 μL of ddH2O. The DNA template was genomic DNA extracted from whole blood cells of Hu sheep.

[0035] PCR amplification reaction conditions: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 53.2℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, and a final extension at 72℃ for 10 min.

[0036] The PCR amplification products were detected by electrophoresis on a 1.5% agarose gel. The electrophoresis results are as follows: Figure 1 As shown in the figure, lane M represents the DL 2000 marker, and lanes 1-10 represent the results of GC gene amplification. The amplified PCR fragment was sequenced, and the sequencing results showed a 387bp specifically amplified fragment. Figure 2 The specific nucleotide sequence of the amplified fragment is shown in SEQ ID NO.1. This fragment contains a polymorphic site, specifically at position 355 bp where M is either A or C. That is, the amplified GC gene fragment (SEQ ID NO.1) exhibits an A / C polymorphism at position 355 bp (see [link to SEQ ID NO.1]). Figure 2 ).

[0037] Among them, SEQ ID NO.1:

[0038] GATAAATGTTTAAGCTGAAGTCTCTAGAAATAAATGAGAAATATTTCATTAGACAGTCAGGATACATTGAAAGCAGTGTGCAGAAATAGCAGAAAAAAGGGACATTCTGACTCCTTTTAATGACTAGAAAATGGAATTCTGATCAAAGGAACATTTCCCCCAGAGTTGCTTATGTGTGTTTTTCCAATTAACA AAATAAAAAAGAGGCATTTAAAAAATATTTTCAGATTCCAGAATCTGAATCTTTCTAACATTATTTAAAAGGAATGGCATTAATAGAAGAAAAAAGTACATTAGCTATGTGATAAAATGATAACCTACCTCTTTCAAAAAGCATGCTGTTGGGTTTGGTGAMGTACAGCAGGACCCTACCATAGAGAGATAACT.

[0039] DNA sequence homology retrieval and identification:

[0040] The DNA sequence (SEQ ID NO.1) obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) website to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a portion of the Hu sheep GC gene DNA (GenBank accession number: NC_040257.1).

[0041] Example 2: Establishment of a genotyping detection method

[0042] (1) Primer sequence design

[0043] KASPar primer pairs were designed for the specific detection of the A / C polymorphism site shown in SEQ ID NO.1 of the amplified fragment in Example 1. The nucleotide sequence of the designed KASPar primer pairs is as follows:

[0044] The forward primer A1 used to detect AlleleA is shown in SEQ ID NO.4:

[0045] 5'-GAAGGTGACCAAGTTCATGCTAGCATGCTGTTGGGTTTGGTGAA-3';

[0046] The forward primer A2 used to detect AlleleC is shown in SEQ ID NO.5:

[0047] 5'-GAAGGTCGGAGTCAACGGATTGCATGCTGTTGGGTTTGGTGAC-3';

[0048] The universal reverse primer C is shown in SEQ ID NO.6:

[0049] 5'-GAGTTATCTCTCTAGTGGTAGGGTCC-3'.

[0050] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. All primers in the above KASPar primer pairs were diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:universal reverse primer C for later use.

[0051] (2) DNA quality control

[0052] Genomic DNA was extracted from whole blood of Hu sheep using a DNA extraction kit. The extracted genomic DNA was then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The acceptable DNA requirements were: (1) Agarose gel electrophoresis showed a single DNA band without significant diffusion; (2) Nanodrop 2100 showed A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. Based on the KASPar detection technology from LGC (UK) and the conversion of genome size, the required DNA volume was calculated to be 10–20 ng / sample. The extracted genomic DNA was then diluted to a concentration of 10–20 ng / μL as a DNA template.

[0053] (3) Genotyping detection

[0054] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10-20 ng / μL) and a blank control (No template control, NTC, using sterile water) were added to 384-well reaction plates respectively. The plates were then dried at 60°C for 30 min (drying oven, LGC Corporation) until the DNA became a dry powder for later use.

[0055] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with the primer in a volume ratio of 12:12:30 for forward primer A1:forward primer A2:universal reverse primer C to prepare a primer mixture for later use.

[0056] Then, using a Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, catalog number: Part No. KBS-1016-011) and primer mixture were added to each reaction well. Immediately after mixing, the microplates were sealed sequentially using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:

[0057] Pre-denaturation at 94℃ for 15 minutes;

[0058] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplified in touch-down sequence for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0059] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0060] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure, each dot represents a sample to be tested. The red dot near the left indicates that the locus is homozygous genotype "CC"; the blue dot near the right indicates that the locus is homozygous genotype "AA"; and the green dot near the middle indicates that the locus is heterozygous genotype "CA" or "AC".

[0061] (4) Application in association analysis with growth traits of Hu sheep

[0062] The experiment examined the polymorphism of 1228 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and growth traits.

[0063] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0064] Among them, Y ijkl These are observed values ​​of growth traits, where μ is the population mean and Genotype. iFor genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijkl They are independent of each other and follow an N(0, σ2) distribution.

[0065] Genotyping results showed that among 1228 individuals, there were 53 individuals with the CC genotype, 266 individuals with the CA genotype, and 909 individuals with the AA genotype. The results of the genotype-trait association analysis are shown in Table 1. In the table, BW represents body weight in kg, with BW80-BW180 representing the body weight of the Hu sheep at each stage (80-180 days). BH represents body height in cm, with BH80-BH180 representing the body height of the Hu sheep at each stage (80-180 days). BL represents body length in cm, with BL80-BL160 representing the body length of the Hu sheep at each stage (80-160 days).

[0066] Table 1. Association analysis of GC gene polymorphism and growth traits in Hu sheep.

[0067]

[0068]

[0069] Note: BW represents body weight in kg; BH represents height and BL represents body length in cm. P<0.05 indicates a significant difference.

[0070] The results showed that with the extension of the assay period, the A / C polymorphism site at position 355 of the amplified fragment SEQ ID NO.1 was significantly correlated with the body weight, height, and length of Hu sheep. The results indicated that Hu sheep carrying the AA genotype had significantly higher body weight, height, and length than those carrying the CC genotype (P<0.05). This suggests that the A allele is the dominant allele. In breeding, the AA genotype should be selected for preservation, and AA genotype sheep should be used as breeding stock for crossbreeding with other sheep. In particular, artificial insemination using semen from AA genotype rams can greatly improve breeding efficiency and produce a flock with superior growth rate.

Claims

1. The application of a molecular marker associated with growth traits of Hu sheep in Hu sheep breeding, characterized in that, The purpose of the breeding is to select Hu sheep with rapid weight gain. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The M at 355bp represents A or C. This mutation leads to the A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype have a significantly higher weight at 80-120 days than sheep carrying the CC genotype. Sheep carrying the AA genotype have a higher weight at 80-180 days than sheep carrying the CC and AC genotypes.

2. The application of primer pairs for detecting molecular markers related to growth traits in Hu sheep breeding, characterized in that, The purpose of this breeding program is to select Hu sheep with rapid weight gain. The primer pair includes primer MF and primer MR. The nucleotide sequence of primer MF is shown in SEQ ID NO.2, and the nucleotide sequence of primer MR is shown in SEQ ID NO.

3. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The M at position 355bp represents A or C. This mutation leads to A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype have a significantly higher weight gain at 80-120 days than sheep carrying the CC genotype. Sheep carrying the AA genotype have a higher weight gain at 80-180 days than sheep carrying the CC and AC genotypes.

3. The application of KASPar primer pairs for detecting molecular markers related to growth traits in Hu sheep breeding, characterized in that, The breeding objective is to select Hu sheep with rapid weight gain. The KASPar primer pair includes a forward primer 1 for detecting AlleleA, a forward primer 2 for detecting AlleleC, and a universal reverse primer. The nucleotide sequence of the forward primer 1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where M at 355bp represents A or C. This mutation leads to A / C polymorphism of the molecular marker. Sheep carrying the AA genotype have significantly better weight gain at 80-120 days than sheep carrying the CC genotype, and sheep carrying the AA genotype have better weight gain at 80-180 days than sheep carrying the CC and AC genotypes.

4. The application of a detection kit for molecular markers related to growth traits in Hu sheep breeding, characterized in that, The purpose of the breeding program is to select Hu sheep with rapid weight gain. The test kit contains primer pairs; the primer pairs include primer MF and primer MR, whose nucleotide sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The M at position 355bp represents A or C. This mutation leads to the A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype have a significantly higher body weight at 80-120 days than sheep carrying the CC genotype. Sheep carrying the AA genotype have a higher body weight at 80-180 days than sheep carrying the CC and AC genotypes.

5. The application according to claim 4, characterized in that, Alternatively, the primer pair may be a KASPar primer pair, which includes primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.

6.

6. The application of a method for detecting molecular markers associated with growth traits in Hu sheep breeding, with the aim of selecting Hu sheep with rapid weight gain, the method comprising the following steps: S1. Amplify the genomic DNA of Hu sheep using PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, or using a kit containing the aforementioned PCR primer set or KASPar primer set; S2. Identify the M position (representing A / C polymorphism) at 355 bp of the amplification product obtained in step S1, corresponding to the sequence shown in SEQ ID NO.1; wherein, Sheep carrying the AA genotype had a significantly higher body weight at 80-120 days than sheep carrying the CC genotype, and sheep carrying the AA genotype had a higher body weight at 80-180 days than sheep carrying the CC and AC genotypes.

7. The application according to claim 6, characterized in that, The typing identification method in step S2 is sequencing, fluorescent probe, gene chip, or high-resolution melting curve method.

8. The application according to claim 6, characterized in that, PCR amplification was performed using KASPar primer pairs. After amplification, the genotyping results were determined by detecting the fluorescence signal.

9. The application of molecular markers related to growth traits of Hu sheep, or primer pairs used to detect growth traits of Hu sheep, or KASPar primer pairs used to detect growth traits of Hu sheep, or methods for detecting molecular markers related to growth traits of Hu sheep, in the detection of growth traits of Hu sheep, characterized in that, The growth trait is body weight. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The M at position 355bp represents A or C. This mutation leads to A / C polymorphism of the molecular marker. Among them, sheep carrying the AA genotype have a significantly better body weight at 80-120 days than sheep carrying the CC genotype. Sheep carrying the AA genotype have a better body weight at 80-180 days than sheep carrying the CC and AC genotypes.

Images