Oligonucleotide compositions and methods thereof
Through oligonucleotide modification targeting SARM1, the problem of difficulty in reducing the levels of SARM1 transcripts and polypeptides in the prior art is solved, and effective therapeutic effects on neurodegenerative diseases are achieved.
Patent Information
- Application Number
- CN202380067032.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-07-21
- Filing Date
- 2023-07-21
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to effectively reduce the levels of SARM1 transcripts and polypeptides, resulting in poor therapeutic effects for related neurodegenerative diseases.
Oligonucleotides targeting SARM1 are provided, which reduce their levels by hybridizing to SARM1 transcripts, and improve the stability and binding affinity of oligonucleotides by using various modifications such as nucleobase modification, sugar modification and internucleotide bond modification.
Effectively reduce the levels of SARM1 transcripts and peptides, and slow down or treat neurodegenerative diseases associated with SARM1, such as amyotrophic lateral sclerosis, Parkinson's disease and Alzheimer's disease.
Smart Images

Figure BDA0005317301410000571 
Figure BDA0005317301410000581 
Figure BDA0005317301410000591
Abstract
Description
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. Provisional Application Serial No. 63 / 391,161, filed on July 21, 2022, the entire contents of which are incorporated herein by reference. Background Art
[0003] Oligonucleotides can be used in various applications, e.g., therapeutic, diagnostic and / or research applications. For example, oligonucleotides targeted to various genes can be used to treat conditions, disorders or diseases associated with such target genes. Summary of the Invention
[0004] Among other things, the present disclosure provides technologies (e.g., oligonucleotides, compositions, methods, etc.) for treating various conditions, disorders, or diseases associated with SARM1. In some embodiments, the present disclosure provides oligonucleotides comprising various modifications, such as nucleobase modifications, sugar modifications, internucleotide linkage modifications, and the like, and which can hybridize to SARM1 transcripts. In some embodiments, the present disclosure provides oligonucleotides and compositions thereof that, when administered or delivered to a system comprising or expressing a SARM1 transcript, can reduce the level of a SARM1 transcript. In some embodiments, the provided technology reduces the level of a SARM1 transcript and / or polypeptide in a system. In some embodiments, the present disclosure provides technologies for preventing and / or treating various conditions, disorders, or diseases associated with SARM1.
[0005] In some embodiments, the present disclosure encompasses oligonucleotides that recognize that certain base sequences can more effectively reduce the level of SARM1 transcripts (e.g., SARM1 mRNA) and / or their products (e.g., SARM1 polypeptides). In some embodiments, the base sequence of the oligonucleotide comprises about 5 or more (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive nucleobases of: CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA, GCTGGCTGTACTCACTCTCC, GTGCTCTGTCCTTGGTCCTG, CCCATTCTCATGCA GCCTAC, CTGTGACCTAGGCTCCTTGA, GGTCTGAGAGGCTGTGGGTC, GCTCCCAGTTCTTCTGTGGT, GATGTCCTCCACAGGTGACA, GCTTCCTGCCTTACTGACCT, CTCTCCTTTGTCCCTGACCA, GCCTTGCCTTTTCCTCACTC, GCCTGGTCACTAACCCTCTC, CACCCACCTTGGTCTTGCCT, CACACTGATGTCCTGTCCCA, CACACTCT GGGTCTTGGCC,GCTGCCCATCACTCCCAGTT,CTCTCCATCTGCCCTGGCCC,CAGTCCCTCTCCTTGTCCTT,ATCCACCTGCTGCTCCTGGG,CCCTTGTGTCTTGTGGG TGC, GCCCTAGGATTTTCCTGTTG, GCCTCAACTCCTGCCTCCA, AGACACCTGGGTATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCACTGTCAGGTA, GTCA GTGCCACAGCCTTGTC, GGCACCTACCTTATGCACCC, ACTACTGCATCCCTCAGCCC, GCTGTCTCATCCTGTCTCT, TGTCTCTGAGCTGACTGCTT, GGGCTTGACTCCACACTCCA, GGCATGGCATCTCAGCTTCA, TTCAGGATCACCTAGCTGGT, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTCACTTGTGGT, TGCCCACACTCTGCCTGTCA,CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCAGTTGGAAGACC, GGTTCTCAGCCACCAGGATC, GTGCTCCAAGATGCCTGCCA, CCTTGCAGGCTCTTGATGGC, GTGCCATTGGTAGAGTAGGA, GTGAGCTCCCTAAAGAACCT, GGTTTGCCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTC, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAATCCTTGCAGTCATGG, AGCACAGCCTGCATGTCCTC, CAAACTGGTGTCAGAGCCTG, GCAGCACCCTCCAAACTGGT, TGGTTAGGTTGGACCCATGG, GCCCAGGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCCCTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGGAGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG or GGGAGTGGAAGGAAGGAGCC, wherein each T is optionally and independently replaced by U. In some embodiments, the base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA,GCTGGCTGTACTCACTCTCC、GTGCTCTGTCCTTGGTCCTG、CCCATTCTCATGCAGCCTAC、CTGTGACCTAGGCTCCTTGA、GGTCTGAGAGGCTGTGGGTC、GCTCCCAGTTCTTCTGTGGT、GATGTCCTCCACAGGTGACA、GCTTCCTGCCTTACTGACCT、CTCTCCTTTGTCCCTGACCA、GCCTTGCCTTTTCCTCACTC、GCCTGGTCACTAACCCTCTC、CACCCACCTTGGTCTTGCCT、CACACTGATGTCCTGTCCCA、CACACCTCTGGGTCTTGGCC、GCTGCCCATCACTCCCAGTT、CTCTCCATCTGCCCTGGCCC、CAGTCCCTCTCCTTGTCTCT、ATCCACCTGCTGCTCCTGGG、CCCTTGTGTCTTGTGGGTGC、GCCCTAGGATTTTCCTGTTG、GCCTCAACTCCTGCCTCCCA、AGACACCTGGGTATCAGCCT、TCCTTCTTCCCTATTTCCCA、GCATCACTCACTGTCAGGTA、GTCAGTGCCACAGCCTTGTC、GGCACCTACCTTATGCACCC、ACTACTGCATCCCTCAGCCC、GCTTGTCTCATCCTGTCTCT、TGTCTCTGAGCTGACTGCTT、GGGCTTGACTCCACACTCCA、GGCATGGCATCTCAGCTTCA、TTCAGGATCACCTAGCTGGT、CCTCTTTGCCATCTGCTGGG、GAGTGCAGTTCACTTGTGGT、TGCCCACACTCTGCCTGTCA、CAGAGGGAGCTGCTAGTCAG、TTGGCAAAGGTGATGCAGGC、CCTCCACCAGTTGGAAGACC、GGTTCTCAGCCACCAGGATC、GTGCTCCAAGATGCCTGCCA、CCTTGCAGGCTCTTGATGGC、GTGCCATTGGTAGAGTAGGA、GTGAGCTCCCTAAAGAACCT、GGTTTGCCACCAGTACAGGG、TCCAGCTTCTCCACATCAAT、GAACTTGCCTGCTTCCAGCT、ACACTCTGGATGAGTTTGTC、GGGCACCCATGACACTCTGG,ACTTGTCCAGTGCTCCAGGT,CCCAATCCTTGCAGTCATGG,AGCACAGCCTGCATGTCCTC,CAAACTGGTGTCAGAGCCTG,GCAGCACCCTCCAAACTGGT,TGGTTAGGTTGGACCCATGG,GCCCA GGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCC CTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGG AGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG, or GGGAGTGGAAGGAAGGAGCC. ,
[0006] In some embodiments, the oligonucleotides provided include various modifications, such as nucleobase modifications, sugar modifications, internucleotide linkage modifications, and the like. Various useful modifications exist in the art and can be utilized in accordance with the present disclosure. In some embodiments, the modifications provide various benefits, such as improved stability, binding affinity, pharmacokinetic properties, pharmacodynamic properties, and the like.
[0007] For example, in some embodiments, provided oligonucleotides include various sugar modifications. In some embodiments, the modified sugar is a 2'-OR s Modified natural RNA sugars, where R s is an optionally substituted C 1-6 Aliphatic, and -OR s Replacement of the 2'-OH group ("2'-OR s In some embodiments, R s is an optionally substituted C 1-6In some embodiments, R s In some embodiments, R s It is -CH2CH2OCH3.
[0008] In some embodiments, provided oligonucleotides comprise or consist of wing-core-wing structures, wherein each wing independently has about 1-10 (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleosides, the core has about 5 or more (e.g., about 5-20, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.) nucleosides, and each wing independently comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified sugars. In some embodiments, each sugar in the wing is independently a modified sugar. In some embodiments, each sugar in the wing is independently 2'-OR s In some embodiments, the modified sugar is a 2'-MOE modified sugar (2'-OR s Modified sugars, where R s In some embodiments, each wing independently comprises one or more (e.g., about 1, 2, 3, 4, 5, or more) 2'-MOE modified sugars. In some embodiments, each sugar in a wing is independently a 2'-MOE modified sugar. In some embodiments, the core region comprises fewer modified sugars and / or a lower level of modified sugars than one or both wings. In some embodiments, the core region has no modified sugars. In some embodiments, each sugar in the core region is independently a natural DNA sugar.
[0009] Additionally or alternatively, in some embodiments, the oligonucleotide provided comprises a modified internucleotide bond. In certain embodiments, compared with a natural phosphate bond, the modified internucleotide bond provides improved characteristic and / or activity. There is a various internucleotide bond in this area, and can be utilized according to the disclosure. In certain embodiments, the modified internucleotide bond is a thiophosphate internucleotide bond (-OP (O) (SH) -O-, which can exist in various salt forms). In certain embodiments, each bond in the oligonucleotide provided is a thiophosphate internucleotide bond.
[0010] In certain embodiments, the present disclosure provides a technology for preparing oligonucleotides and compositions thereof. In certain embodiments, the oligonucleotides provided and compositions thereof have high purity. In certain embodiments, the oligonucleotides are provided as diastereomeric mixtures relative to the chiral bond phosphorus, for example, as phosphorothioate internucleotide bonds. In certain embodiments, the compositions provided are enriched in one or more diastereomers relative to the chiral bond phosphorus.
[0011] As described herein, the oligonucleotides and compositions of the present disclosure can be provided / used in various forms. In some embodiments, the present disclosure provides compositions comprising one or more forms of the oligonucleotides, e.g., acid forms (e.g., wherein the native phosphate bond is present as -O(P(O)(OH)-O- and the phosphorothioate internucleotide bond is present as -O(P(O)(SH)-O-)), salt forms (e.g., wherein one or more or all of the native phosphate bonds are independently present as salt forms (e.g., sodium salts (-O(P(O)(O-)), - Na + )-O-), one or more or all phosphorothioate internucleotide bonds are present as salts (e.g., sodium salts (-O(P(O)(S - Na + )-O-) exists), hydrates, etc. As will be appreciated by those skilled in the art, oligonucleotides may exist in various salt forms, including pharmaceutically acceptable salts, and in solutions (e.g., various aqueous buffer systems), cations may dissociate from anions. In some embodiments, the present disclosure provides a pharmaceutical composition comprising the provided oligonucleotides and / or one or more pharmaceutically acceptable salts thereof and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is or comprises a buffer. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutically acceptable carrier is cerebrospinal fluid.
[0012] In some embodiments, the present disclosure describes useful techniques for evaluating oligonucleotides and compositions thereof. Certain useful techniques are described in the Examples.
[0013] The provided technology can be used for various purposes. For example, in some embodiments, the provided technology can be used to prevent and / or treat various conditions, disorders or diseases related to SARM1. In some embodiments, the present disclosure provides a method for preventing a condition, disorder or disease, comprising administering or delivering an effective amount of a provided oligonucleotide to a subject susceptible to the condition, disorder or disease. In some embodiments, the present disclosure provides a method for treating a condition, disorder or disease, comprising administering or delivering an effective amount of a provided oligonucleotide to a subject suffering from the condition, disorder or disease. In some embodiments, the oligonucleotide is administered or delivered in the form of a pharmaceutical composition. In some embodiments, the oligonucleotide is administered or delivered in one or more forms, for example, in some embodiments, in the form of one or more pharmaceutically acceptable salts. In some embodiments, the oligonucleotide is administered or delivered in a solution, for example, in an aCSF solution. Various technologies exist in the art and can be used to administer or deliver the provided oligonucleotides and compositions thereof. For example, in some embodiments, the oligonucleotides and compositions thereof are administered or delivered intrathecally.
[0014] In some embodiments, the condition, disorder or disease is a neurodegenerative condition, disorder or disease. In some embodiments, the condition, disorder or disease is or comprises Wallerian degeneration. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder or disease is neuropathy. In some embodiments, the condition, disorder or disease is peripheral neuropathy. In some embodiments, the condition, disorder or disease is chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder or disease is Parkinson's disease. In some embodiments, the condition, disorder or disease is Huntington's disease. In some embodiments, the condition, disorder or disease is Alzheimer's disease. In some embodiments, the condition, disorder or disease is frontotemporal dementia. In some embodiments, the condition, disorder or disease is brain injury. In some embodiments, the condition, disorder or disease is traumatic brain injury. In some embodiments, the condition, disorder or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder or disease is corticobasal degeneration. In some embodiments, the condition, disorder or disease is Wolfram Syndrome. In some embodiments, the condition, disorder or disease is Friedreich's Ataxia. In some embodiments, the condition, disorder or disease is multiple system atrophy. In some embodiments, the condition, disorder or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder or disease is Pick's disease. In some embodiments, the condition, disorder or disease is progressive motor atrophy. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1The provided oligonucleotides can reduce the level of SARM1 mRNA. (A) and (B): Various oligonucleotides demonstrate SARM1 knockdown. Human iPSC-derived glutamatergic neurons were treated with various oligonucleotides targeting SARM1 by naked uptake for 72 hours. The cells were lysed and RNA was collected. RNA was used for real-time RT-qPCR to quantify the fold change in SARM1 expression. The average fold change in SARM1 expression for biological replicates (black dots) is shown in the top panel, the average SARM1 Cp value for technical replicates (black dots) is shown in the middle panel, and the average RPLP0 Cp value for technical replicates (black dots) is shown in the bottom panel. The X-axis represents the oligonucleotide; the Y-axis represents the fold change in SARM1 expression (top panel), SARM1 Cp value (middle panel), or RPLP0 Cp value (bottom panel). The horizontal dashed line represents the corresponding fold change or Cp value relative to the negative control treated with vehicle alone. Error bars represent standard deviation. * indicates data from only one technical replicate is shown.
[0016] Figure 2 . Various oligonucleotides provided provide knockdown of SARM1. Various oligonucleotides were evaluated for knockdown of SARM1. Human iPSC-derived glutamatergic neurons were treated with various oligonucleotides targeting SARM1 or NEAT1 (positive and negative controls) by naked uptake for 72 hours. Cells were lysed and RNA was collected. RNA was used for real-time RT-qPCR to quantify the fold change of SARM1 or NEAT1 expression. The average fold change of SARM1 or NEAT1 expression of biological replicates (black dots) is shown in the top panel, the average SARM1 or NEAT1 Cp value (black dots) of technical replicates is shown in the middle panel, and the average RPLP0 Cp value (black dots) of technical replicates is shown in the bottom panel. The X-axis represents oligonucleotides; the Y-axis represents the fold change in SARM1 or NEAT1 expression (top panel), SARM1 or NEAT1 Cp value (middle panel) or RPLP0 Cp value (bottom panel). The horizontal dotted line represents the corresponding fold change or Cp value relative to the negative control treated with vehicle alone. Error bars represent standard deviation. For NEAT1, from left to right are vehicle, positive control, and negative control. For SARM1 and RPLP0, from left to right are vehicle, positive control for NEAT1, negative control, and various evaluated oligonucleotides. *Indicates data from only one technical replicate.
[0017] Figure 3Compared with vehicle treatment, the various oligonucleotides provided did not show obvious cytotoxicity. (A) and (B): Various oligonucleotides were confirmed to have no significant change in the percentage of viable cells. Glutamatergic neurons derived from human iPSC were treated with various oligonucleotides by naked uptake for 48 hours. After this incubation period, cells were harvested and subjected to Hoechst staining (5 μg / mL). The number of living cells, dead cells and total cells (living cells + dead cells) was counted, and the percentage of living cells was calculated. The average living cell percentage of biological replicates is shown in the top small figure, and the average living cell count of biological replicates is shown in the bottom small figure. The X-axis represents oligonucleotides; the Y-axis represents the percentage of living cells in the total cells (top small figure) or the total number of living cells (bottom small figure). The horizontal dotted line represents the corresponding living cell percentage or the total number of living cells treated with vehicle only. From left to right: vehicle, positive control, negative control and various oligonucleotides evaluated for NEAT1. For the percentage of living cells, the lower dotted line represents the corresponding living cell percentage treated with the negative control oligonucleotide composition. The error bar represents the standard deviation.
[0018] Figure 4 .The oligonucleotides provided can provide knockdown of SARM1 mRNA. Human iPSC-derived motor neurons were treated with an oligonucleotide composition targeting SARM1 or a scrambled (Scr) negative control oligonucleotide by naked uptake for 48 hours. After 48 hours, the culture medium was updated to remove the oligonucleotides. The cells were lysed and RNA was collected at different time points (0, 3, 7, 10, 14, 21 days) after oligonucleotide removal. RNA was used for real-time RT-qPCR to quantify SARM1 expression. The knockdown percentage of SARM1 was determined compared to the knockdown percentage of the average negative control SARM1 at the corresponding time points. The average value is represented by a bar graph, and the replicates (N=3) are represented by dots or triangles. The X-axis represents the number of days after oligonucleotide removal (day 0, day 3, day 7, day 10, day 14, day 21); the Y-axis represents the knockdown percentage of SARM1. Error bars represent standard deviations.
[0019] Figure 5.SARM1 protein levels after oligonucleotide treatment. Human iPSC-derived motor neurons were treated with a SARM1-targeting oligonucleotide composition or a scrambled (Scr) negative control oligonucleotide by naked uptake for 48 hours. After 48 hours, the culture medium was updated to remove the oligonucleotides. The cells were lysed at different time points (0, 3, 7, 10, 14, 21 days) after oligonucleotide removal. The lysates were used for Western blotting to quantify SARM1 protein levels. Data for oligonucleotide 45 (A) and oligonucleotide 62 (B) are shown. The mean values are represented by bars, and replicates (N=2) are represented by dots or triangles. The X-axis represents the number of days after oligonucleotide removal (day 0, day 3, day 7, day 10, day 14, day 21); the Y-axis represents the relative knockdown of SARM1 protein (% of the mean negative control SARM1 protein level above the corresponding time point). Error bars represent standard deviations.
[0020] Figure 6 . Cell morphology after treatment with the oligonucleotide composition provided. The motor neurons derived from human iPSC were treated for 48 hours with an oligonucleotide composition or a scrambled (Scr) negative control oligonucleotide targeting SARM1 by naked uptake. After 48 hours, the culture medium was updated to remove the oligonucleotide. Cell morphology was assessed by bright field imaging at different time points (0, 3, 21 days) after removing the oligonucleotide. Representative images are shown. The labels at the left indicate the time points of each row (day 0, day 3, day 21); the labels at the top indicate the processing of each column image (vehicle (HO), scrambled (Scr) negative control oligonucleotide, oligonucleotide composition 45, oligonucleotide composition 62). DETAILED DESCRIPTION
[0021] The technology of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.
[0022] definition
[0023] As used herein, unless otherwise indicated, the following definitions shall apply. For the purposes of this disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th edition. Additionally, the general principles of organic chemistry are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999 and March's Advanced Organic Chemistry, 5th edition, edited by Smith, MB and March, J., John Wiley & Sons, New York: 2001.
[0024] As used herein in this disclosure, unless the context clearly indicates otherwise, (i) the term "a" or "an" may be understood to mean "at least one"; (ii) the term "or" may be understood to mean "and / or"; (iii) the terms "comprising," "comprise," "including" (whether or not used with "not limited to,") and "include" (whether or not used with "not limited to") may be understood to cover the itemized components or steps, whether presented alone or with one or more additional components or steps; (iv) the term "another" may be understood to mean at least another / a second one or more; (v) the terms "about" and "approximately" may be understood to allow for standard deviation, as would be understood by one of ordinary skill in the art; and (vi) where ranges are provided, the endpoints are inclusive.
[0025] Unless otherwise indicated, descriptions of oligonucleotides and their elements (e.g., base sequence, sugar modifications, internucleotide bonds, bond phosphorus stereochemistry, patterns thereof, etc.) are from 5' to 3'. As will be appreciated by those skilled in the art, in some embodiments, oligonucleotides may be provided and / or used in various forms, e.g., salt form, specifically pharmaceutically acceptable salt forms (e.g., sodium salts). As will also be appreciated by those skilled in the art, in some embodiments, even though a particular oligonucleotide may be in different forms, e.g., salt form, at a particular moment in a composition (e.g., a liquid composition) (and, for example, when it may be dissolved in a liquid composition and the oligonucleotide chain may be present as an anionic form), such individual oligonucleotides in such compositions may still be considered to have the same composition and / or structure. For example, those skilled in the art will appreciate that, at a given pH, a single internucleotide bond along an oligonucleotide chain may be in the acid (H) form or in one of a variety of possible salt forms (e.g., sodium salts or salts of different cations, depending on which ions may be present in the formulation or composition), and will appreciate that as long as its acid form (e.g., with H, if present) is present, the oligonucleotide may be present in the same form as the oligonucleotide chain. + If the oligonucleotides (e.g., replacing all cations) have the same composition and / or structure, such individual oligonucleotides are appropriately considered to have the same composition and / or structure.
[0026] Aliphatic: As used herein, "aliphatic" means a straight (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a combination thereof. In some embodiments, an aliphatic group contains 1-50 aliphatic carbon atoms. In some embodiments, an aliphatic group contains 1-20 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-10 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-9 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-8 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-7 aliphatic carbon atoms. In other embodiments, an aliphatic group contains 1-6 aliphatic carbon atoms. In still other embodiments, an aliphatic group contains 1-5 aliphatic carbon atoms, and in yet other embodiments, an aliphatic group contains 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl, and hybrids thereof, such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl, or (cycloalkyl)alkenyl.
[0027] Alkyl: As used herein, the term "alkyl" is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight chain alkyls, branched chain alkyls, cycloalkyls (alicyclics), cycloalkyls substituted with alkyls, and alkyls substituted with cycloalkyls. In some embodiments, the alkyl group has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl group has about 1-20 carbon atoms in its backbone (e.g., C1-C2 for a straight chain). 20 ; For the branched chain, it is C2-C 20 ), and alternatively about 1-10. In some embodiments, the cycloalkyl ring has about 3-10 carbon atoms in its ring structure, wherein such ring is monocyclic, bicyclic or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, the alkyl group can be a lower alkyl group, wherein the lower alkyl group contains 1-4 carbon atoms (e.g., C1-C4 for a straight chain lower alkyl group).
[0028] Animal: As used herein, the term "animal" refers to any member of the kingdom Animalia. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal, and / or a clone.
[0029] Characteristic Portion: As used herein, the term "characteristic portion" broadly refers to a portion of a substance whose presence (or absence) is associated with the presence (or absence) of a particular characteristic, property, or activity of the substance. In some embodiments, a characteristic portion of a substance refers to a portion found in a substance and related substances that share the particular characteristic, property, or activity, but is absent from substances that do not share the particular characteristic, property, or activity. In certain embodiments, a characteristic portion shares at least one functional property with the entire substance. For example, in some embodiments, a "characteristic portion" of a nucleic acid refers to a characteristic portion of a nucleic acid that contains a plurality of nucleobases (in some embodiments, a continuous stretch of nucleobases) that are unique to the nucleic acid.
[0030] Comparable: The term "comparable" is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to each other to allow comparison of the results obtained or the phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of different features. One of ordinary skill in the art will understand that sets of conditions are comparable to each other when they are characterized by a sufficient number and type of substantially identical features to warrant the reasonable conclusion that differences in the results obtained or the phenomena observed under the sets of conditions or circumstances are caused by or indicative of changes in those features that are varied.
[0031] Heteroatom: As used herein, the term "heteroatom" means an atom that is not carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quaternized forms, forms as iminium groups, etc.), phosphorus, sulfur, oxygen, etc.). In some embodiments, the heteroatom is silicon, phosphorus, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is silicon, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.
[0032] Identity: As used herein, the term "identity" refers to the overall correlation between polymeric molecules, for example, nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or polypeptide molecules. In some embodiments, polymeric molecules are considered to be "substantially identical" to each other if the sequences of the polymeric molecules are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical. The calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed, for example, by comparing the two sequences for optimal comparison purposes (e.g., gaps can be introduced into one or both sequences of the first and second sequences for optimal comparison, and non-identical sequences can be ignored for comparison purposes). In certain embodiments, the length of the sequence compared for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or substantially 100% of the length of the reference sequence. The nucleotides on the corresponding positions are then compared. When the position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, the molecules are identical at the position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of spaces and the length of each space, and it is necessary to introduce the function to perform the optimal comparison of the two sequences. The comparison of sequences and the determination of the percent identity between the two sequences can be completed using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, the nucleic acid sequence comparison performed with the ALIGN program is determined using the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the NWSgapdna.CMP matrix can be used to determine the percent identity between two nucleotide sequences using the GAP program in the GCG software package.
[0033] Internucleotide bond: As used herein, the term "internucleotide bond" generally refers to the bond that connects the nucleoside units of an oligonucleotide or nucleic acid. In some embodiments, the internucleotide bond is a phosphodiester bond, which is widely present in naturally occurring DNA and RNA molecules (natural phosphate bonds (-OP(=O)(OH)O-), which are recognized by those skilled in the art as being able to exist as salts). In some embodiments, the internucleotide bond is a modified internucleotide bond (rather than a natural phosphate bond). In some embodiments, the internucleotide bond is a "modified internucleotide bond" in which at least one oxygen atom or -OH of the phosphodiester bond is replaced by a different organic or inorganic moiety. In some embodiments, such organic or inorganic moieties are selected from =S, =Se, =NR', -SR', -SeR', -N(R')2, B(R') 3、 -S-, -Se- and -N(R')-, wherein each R' is independently -H or selected from C 1-10 Aliphatic, C 6-14 Aryl, C with 1-5 heteroatoms 1-10 In certain embodiments, the present invention provides the substituted nucleotides of the present invention.Assorted aliphatic series, there are 5 to 10 yuan of heteroaryls of 1-5 heteroatoms and the optionally substituted group of 3 to 10 yuan of heterocyclic radicals with 1-4 heteroatoms, or two or more R ' groups form together with their middle atom also having 3 to 10 yuan of optionally substituted rings of 0-5 heteroatoms except the middle atom.In certain embodiments, the bond between modified nucleotides is a phosphorothioate bond.In certain embodiments, the bond between nucleotides is for example, a kind of in PNA (peptide nucleic acid) or PMO (phosphoric acid diamide morpholino oligomer) bond.It will be appreciated by those of ordinary skill in the art that due to the presence of acid or base moiety in the bond between nucleotides, at a given pH, the bond can exist as an anion or a cation.
[0034] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as a test tube or reaction vessel, cell culture medium, etc., rather than within an organism (eg, an animal, plant, and / or microorganism).
[0035] In vivo: As used herein, the term "in vivo" refers to events that occur within an organism (eg, an animal, a plant, and / or a microorganism).
[0036] Phosphorus bond: As defined herein, the phrase "phosphorus bond" is used to indicate that the specific phosphorus atom referred to is a phosphorus atom present in an internucleotide bond that corresponds to the phosphorus atom of a phosphodiester internucleotide bond found in naturally occurring DNA and RNA. In some embodiments, the phosphorus bond atom is in a modified internucleotide bond in which each oxygen atom of the phosphodiester bond is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, the phosphorus bond atom is chiral (e.g., as in a phosphorothioate internucleotide bond). In some embodiments, the phosphorus bond atom is achiral (e.g., as in a natural phosphate ester bond).
[0037] Modified nucleobase: The terms "modified nucleobase," "modified base," and the like refer to a chemical moiety that is chemically distinct from a nucleobase but is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase comprising a modification. In some embodiments, a modified nucleobase is capable of performing at least one function of a nucleobase, e.g., forming a portion of a polymer capable of base pairing with a nucleic acid comprising at least a complementary sequence of a base. In some embodiments, a modified nucleobase is a substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.
[0038] Modified nucleoside: The term "modified nucleoside" refers to a moiety that is derived from a natural nucleoside or is chemically similar to a natural nucleoside, but the moiety comprises a chemical modification that distinguishes it from a natural nucleoside. Non-limiting examples of modified nucleosides include modified nucleosides comprising modifications at the base and / or sugar. Non-limiting examples of modified nucleosides include modified nucleosides having a 2' modification at the sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (the nucleoside lacks a nucleobase). In some embodiments, the modified nucleoside is capable of having at least one function of a nucleoside, for example, forming a moiety in a polymer that is capable of base pairing with a nucleic acid comprising at least a complementary sequence of bases.
[0039] Modified nucleotide: The term "modified nucleotide" includes any chemical moiety that is structurally different from a naturally occurring nucleotide, but is capable of performing at least one function of a naturally occurring nucleotide. In some embodiments, the modified nucleotide comprises modifications in the sugar, base, and / or internucleotide linkages. In some embodiments, the modified nucleotide comprises a modified sugar, a modified nucleobase, and / or a modified internucleotide linkage. In some embodiments, the modified nucleotide is capable of having at least one function of a nucleotide, for example, forming a subunit in a polymer capable of base pairing with a nucleic acid comprising at least a complementary sequence of bases.
[0040] Modified Sugars The term "modified sugar" refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical properties of a sugar. In some embodiments, as described herein, the modified sugar is a substituted ribose or deoxyribose. In some embodiments, the modified sugar comprises a 2'-modification. Examples of useful 2'-modifications are widely used in the art and are described herein. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, wherein R is an optionally substituted C 1-10 Aliphatic. In some embodiments, the 2'-modification is 2'-OMe (2'-O-methyl). In some embodiments, the 2'-modification is 2'-MOE (2'-O-methoxyethyl). In some embodiments, the modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, the modified sugar is a sugar other than ribose or deoxyribose, as typically found in natural RNA or DNA.
[0041] Nucleic acid: As used herein, the term "nucleic acid" includes any nucleotide and polymers thereof. As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, i.e., ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecule and therefore include double-stranded and single-stranded DNA and double-stranded and single-stranded RNA. As equivalents, these terms include analogs of RNA or DNA containing modified nucleotides and / or modified polynucleotides, such as, but not limited to, methylated, protected and / or blocked nucleotides or polynucleotides. These terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N- or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified internucleotide bonds. The term encompasses nucleic acids containing any combination of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxyribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise indicated, the prefix poly- refers to nucleic acids containing from 2 to about 10,000 nucleotide monomer units, and wherein the prefix oligo- refers to nucleic acids containing from 2 to about 200 nucleotide monomer units.
[0042] Nucleobase: The term "nucleobase" refers to the portion of a nucleic acid that participates in hydrogen bonding, which binds one nucleic acid strand to another complementary strand in a sequence-specific manner. The most common naturally occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the naturally occurring nucleobase is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the naturally occurring nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleobase comprises a heteroaryl ring in which the ring atoms are nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, the nucleobase comprises a heterocyclic ring in which the ring atoms are nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, the nucleobase is a "modified nucleobase," i.e., a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleobase is a substituted A, T, C, G, or U. In some embodiments, the modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, the modified nucleobase is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical properties of a nucleobase and retains the property of hydrogen bonding, which binds one nucleic acid strand to another in a sequence-specific manner. In certain embodiments, modified core base can be paired with all five naturally occurring bases (uracil, thymine, adenine, cytosine or guanine), without substantial impact on the melting behavior of oligonucleotide duplexes, the recognition of intracellular enzymes or the activity. As used herein, the term "core base" also encompasses structural analogs that replace natural or naturally occurring nucleotides, such as modified core bases and core base analogs. In certain embodiments, core base is optionally substituted A, T, C, G or U, or an optionally substituted tautomer of A, T, C, G or U. In certain embodiments, "core base" refers to a core base unit in an oligonucleotide or nucleic acid (e.g., A, T, C, G or U as in an oligonucleotide or nucleic acid).
[0043] Nucleoside: The term "nucleoside" refers to a moiety in which a nucleobase or modified nucleobase is covalently bound to a sugar or modified sugar. In some embodiments, a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a "nucleoside" refers to a nucleoside unit in an oligonucleotide or nucleic acid.
[0044] Nucleotide: As used herein, the term "nucleotide" refers to a monomeric unit of a polynucleotide consisting of a core base, a sugar, and one or more internucleotide bonds (e.g., phosphate bonds in natural DNA and RNA). Naturally occurring bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines or pyrimidines, and naturally, naturally occurring and non-naturally occurring base analogs are also included. Naturally occurring sugars are pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), and naturally, naturally occurring and non-naturally occurring sugar analogs are also included. Nucleotides are connected to form nucleic acids or polynucleotides by internucleotide bonds. Many internucleotide bonds known in the art (such as, but not limited to, phosphates, phosphorothioates, borophosphates, etc.) are known in the art. Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriester, phosphorothioate, H-phosphate, phosphoramide, borophosphate, methyl phosphate, phosphoroacetate, thiophosphoroacetate and other variants of the phosphate backbone of natural nucleic acids, such as variants described herein. In certain embodiments, natural nucleotides comprise naturally occurring bases, sugars and internucleotide bonds. As used herein, the term "nucleotide" also encompasses structural analogs used in place of natural or naturally occurring nucleotides, such as modified nucleotides and nucleotide analogs. In certain embodiments, "nucleotide" refers to a nucleotide unit in an oligonucleotide or nucleic acid.
[0045] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides and may comprise any combination of natural and unnatural nucleobases, sugars, and internucleotide linkages.
[0046] Oligonucleotide can be single-stranded or double-stranded.Single-stranded oligonucleotide can have double-stranded region (being formed by two parts of single-stranded oligonucleotide), and the double-stranded oligonucleotide comprising two oligonucleotide chains can have single-stranded region, for example, at the district where two oligonucleotide chains are not complementary to each other.Example oligonucleotide includes but is not limited to structural gene, the gene comprising control and terminator region, self-replication system (such as virus or plasmid DNA), single-stranded and double-stranded RNAi medicament and other RNA interference reagent (RNAi medicament or iRNA medicament), shRNA, antisense oligonucleotide, ribozyme, MicroRNA, MicroRNA mimics, super mir, aptamer, anti-mir, antagonistic mir, U1 aptamer, triple chain formation oligonucleotide, G quadruplex oligonucleotide, RNA activator, immunostimulatory oligonucleotide and decoy oligonucleotide.
[0047] Oligonucleotides of the present disclosure can have various lengths. In a particular embodiment, the length of the oligonucleotide can range from about 2 to about 200 nucleosides. In various related embodiments, the length of a single-stranded, double-stranded, or triple-stranded oligonucleotide can range from about 4 to about 10 nucleosides, about 10 to about 50 nucleosides, about 20 to about 50 nucleosides, about 15 to about 30 nucleosides, or about 20 to about 30 nucleosides. In some embodiments, the length of the oligonucleotide is about 9 to about 39 nucleosides. In some embodiments, the length of the oligonucleotide is about 25 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 26 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 27 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 28 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 29 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 30 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 31 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 32 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is about 25 to about 60 nucleosides. In some embodiments, the length of the oligonucleotide is about 25 to about 50 nucleosides. In some embodiments, the length of the oligonucleotide is about 25 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is about 30 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4 nucleosides. In some embodiments, the length of the oligonucleotide is at least 5 nucleosides. In some embodiments, the length of the oligonucleotide is at least 6 nucleosides. In some embodiments, the length of the oligonucleotide is at least 7 nucleosides. In some embodiments, the length of the oligonucleotide is at least 8 nucleosides. In some embodiments, the length of the oligonucleotide is at least 9 nucleosides. In some embodiments, the length of the oligonucleotide is at least 10 nucleosides. In some embodiments, the length of the oligonucleotide is at least 11 nucleosides. In some embodiments, the length of the oligonucleotide is at least 12 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 15 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 15 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 16 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 17 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 18 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 19 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 20 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 25 nucleosides. In certain embodiments, the length of the oligonucleotide is at least 26 nucleosides.In some embodiments, the oligonucleotide is at least 27 nucleosides in length. In some embodiments, the oligonucleotide is at least 28 nucleosides in length. In some embodiments, the oligonucleotide is at least 29 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is at least 31 nucleosides in length. In some embodiments, the oligonucleotide is at least 32 nucleosides in length. In some embodiments, the oligonucleotide is at least 33 nucleosides in length. In some embodiments, the oligonucleotide is at least 34 nucleosides in length. In some embodiments, the oligonucleotide is at least 35 nucleosides in length. In some embodiments, the oligonucleotide is at least 36 nucleosides in length. In some embodiments, the oligonucleotide is at least 37 nucleosides in length. In some embodiments, the oligonucleotide is at least 38 nucleosides in length. In some embodiments, the oligonucleotide is at least 39 nucleosides in length. In some embodiments, the oligonucleotide is at least 40 nucleosides in length. In some embodiments, the oligonucleotide is 25 nucleosides in length. In some embodiments, the oligonucleotide is 26 nucleosides in length. In some embodiments, the oligonucleotide is 27 nucleosides in length. In some embodiments, the oligonucleotide is 28 nucleosides in length. In some embodiments, the oligonucleotide is 29 nucleosides in length. In some embodiments, the oligonucleotide is 30 nucleosides in length. In some embodiments, the oligonucleotide is 31 nucleosides in length. In some embodiments, the oligonucleotide is 32 nucleosides in length. In some embodiments, the oligonucleotide is 33 nucleosides in length. In some embodiments, the oligonucleotide is 34 nucleosides in length. In some embodiments, the oligonucleotide is 35 nucleosides in length. In some embodiments, the oligonucleotide is 36 nucleosides in length. In some embodiments, the oligonucleotide is 37 nucleosides in length. In some embodiments, the oligonucleotide is 38 nucleosides in length. In some embodiments, the oligonucleotide is 39 nucleosides in length. In some embodiments, the oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside calculated in the oligonucleotide length independently comprises a nucleobase comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside calculated in the oligonucleotide length independently comprises A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or optionally substituted tautomers of A, T, C, G, or U.
[0048] Optionally substituted: As described herein, the compounds of the present disclosure (e.g., oligonucleotides) can contain optionally substituted parts and / or substituted parts. Generally speaking, the term "substituted", whether or not there is the term "optionally" in front, means that one or more hydrogens of the specified part are replaced by suitable substituents. Unless otherwise indicated, the "optionally substituted" group can have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure can be substituted by more than one substituent selected from a specific group, the substituent at each position can be the same or different. In certain embodiments, the optionally substituted group is unsubstituted. The combination of substituents envisioned by the present disclosure is preferably a combination of substituents that form a stable or chemically feasible compound. As used herein, the term "stable" refers to a compound that does not substantially change when subjected to conditions that allow the generation of the compound, detection, and recovery, purification of the compound described in certain embodiments, and for one or more purposes disclosed herein. Certain substituents are described below.
[0049] Suitable monovalent substituents on a substitutable atom (e.g., a suitable carbon atom) are independently halogen; -(CH2) 0-4 R o ; -(CH2) 0-4 OR o ;-O(CH2) 0-4 R o 、-O-(CH2) 0-4 C(O)OR o ; -(CH2) 0-4 CH(OR o )2;-(CH2) 0-4 Ph, which can be R o Substitution; -(CH2) 0-4 O(CH2) 0-1 Ph, which can be R o Substituted; -CH=CHPh, which can be R o Substitution; -(CH2) 0-4 O(CH2) 0-1 -pyridyl, which may be replaced by R o Substitution; -NO2; -CN; -N3; -(CH2) 0-4 N(R o )2;-(CH2) 0-4 N(R o )C(O)R o ;-N(R o )C(S)R o ; -(CH2) 0-4 N(R o )C(O)NRo 2;-N(R o )C(S)NR o 2;-(CH2) 0-4 N(R o )C(O)OR o ;-N(R o )N(R o )C(O)R o ;-N(R o )N(R o )C(O)NR o 2;-N(R o )N(R o )C(O)OR o ;-(CH2) 0-4 C(O)R o ;-C(S)R o ;-(CH2) 0-4 C(O)OR o ;-(CH2) 0-4 C(O)SR o ;-(CH2) 0-4 C(O)OSiR o 3;-(CH2) 0-4 OC(O)R o ;-OC(O)(CH2) 0- 4SR o 、SC(S)SR o ;-(CH2) 0-4 SC(O)R o ;-(CH2) 0-4 C(O)NR o 2;-C(S)NR o 2;-C(S)SR o ;-(CH2) 0-4 OC(O)NR o 2;-C(O)N(OR o )R o ;-C(O)C(O)R o ;-C(O)CH2C(O)R o ;-C(NOR o )R o ;-(CH2) 0-4 SSR o ;-(CH2) 0-4 S(O)2R o ;-(CH2) 0-4 S(O)2OR o ;-(CH2) 0-4 OS(O)2R o;-S(O)2NR o 2; -(CH2) 0-4 S(O)R o ;-N(R o )S(O)2NR o 2;-N(R o )S(O)2R o ;-N(OR o )R o ;-C(NH)NR o 2;-Si(R o )3;-OSi(R o )3;-B(R o )2;-OB(R o )2;-OB(OR o )2;-P(R o )2;-P(OR o )2;-P(R o )(OR o );-OP(R o )2;-OP(OR o )2;-OP(R o )(OR o );-P(O)(R o )2;-P(O)(OR o )2;-OP(O)(R o )2;-OP(O)(OR o )2;-OP(O)(OR o )(SR o );-SP(O)(R o )2;-SP(O)(OR o )2;-N(R o )P(O)(R o )2;-N(R o )P(O)(OR o )2;-P(R o )2[B(R o )3];-P(OR o )2[B(R o )3];-OP(R o )2[B(R o )3];-OP(OR o )2[B(R o )3];-(C 1-4 linear or branched alkylene)ON(R o )2; or -(C 1-4 linear or branched alkylene) C(O)ON(R o )2, where each Ro may be substituted as defined herein and are independently hydrogen, C 1-20 aliphatic, C having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus 1-20 Heteroaliphatic, -CH2-(C 6-14 Aryl), -O(CH2) 0-1 (C 6-14 aryl), -CH2-(5- to 14-membered heteroaryl ring), a 5- to 20-membered monocyclic, bicyclic or polycyclic saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the above definitions, two independent occurrences of R o Together with its central atoms, it forms a 5- to 20-membered monocyclic, bicyclic or polycyclic saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which aryl ring may be substituted as defined below.
[0050] R o (or through two independent occurrences of R o Suitable monovalent substituents on the ring formed by taking the middle atom thereof into account are independently halogen, -(CH2) 0-2 R · 、-(halogenated R · ), -(CH2) 0-2 OH, -(CH2) 0-2 OR · 、-(CH2) 0-2 CH(OR · )2;-O(halogenated R · )、-CN、-N3、-(CH2) 0-2 C(O)R · 、-(CH2) 0-2 C(O)OH, -(CH2) 0-2 C(O)OR · 、-(CH2) 0-2 SR · 、-(CH2) 0-2 SH, -(CH2) 0-2 NH2, -(CH2) 0-2 NHR · 、-(CH2) 0-2 NR · 2. -NO2, -SiR · 3. -OSiR · 3. -C(O)SR · 、-(C 1-4 linear or branched alkylene)C(O)OR · or SSR · , where each R· is unsubstituted or, in the case of being preceded by "halo", is substituted only by one or more halogens and is independently selected from C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph and a 5- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur. o Suitable divalent substituents on a saturated carbon atom of include =0 and =S.
[0051] For example, suitable divalent substituents on suitable carbon atoms are independently the following divalent substituents: =0, =S, =NNR * 2. =NNHC(O)R * 、=NNHC(O)OR * 、=NNHS(O)2R * 、=NR * 、=NOR * 、-O(C(R * 2)) 2-3 O-or-S(C(R * 2)) 2-3 S-, where each independent occurrence of R * is selected from hydrogen; C which may be substituted as defined below 1-6 aliphatic; and unsubstituted 5- to 6-membered saturated, partially unsaturated, or aromatic rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents bonded to the ortho-substitutable carbon of an "optionally substituted" group include: -O(CR * 2) 2-3 O-, where each independent occurrence of R * Selected from: hydrogen; C which may be substituted as defined below 1-6 aliphatic; and unsubstituted 5- to 6-membered saturated, partially unsaturated, and aryl rings having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0052] R * Suitable substituents on the aliphatic group are independently halogen, -R · 、-(halogenated R · ), -OH, -OR · 、-O(halogenated R · )、-CN、-C(O)OH、-C(O)OR · 、-NH2、-NHR · 、-NR · 2 or -NO2, where each R · is unsubstituted or, when preceded by "halo", substituted only with one or more halogens, and is independently C 1-4Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 3- to 6-membered (eg, 3- to 5-membered, 5- to 6-membered, etc.) saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
[0053] In some embodiments, suitable substituents on the substitutable nitrogen are independently
[0054] or Each of these are independently hydrogen, C which may be substituted as defined below 1-6 an aliphatic, unsubstituted -OPh or an unsubstituted 5- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, or, notwithstanding the above definition, two independent occurrences of Together with its central atoms, it forms an unsubstituted 3-12 membered saturated, partially unsaturated or aromatic monocyclic or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0055] Suitable substituents on the aliphatic group are independently halogen, -R · 、-(halogenated R · ), -OH, -OR · 、-O(halogenated R · )、-CN、-C(O)OH、-C(O)OR · 、-NH2、-NHR · 、-NR · 2 or -NO2, where each R · is unsubstituted or, when preceded by "halo", substituted only by one or more halogens, and is independently C 1-4 Aliphatic, -CH2Ph, -O(CH2) 0-1 Ph or a 5- to 6-membered saturated, partially unsaturated or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0056] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety that includes at least one double or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as defined herein.
[0057] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage amount suitable for administration in a treatment regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition can be specifically formulated for administration in solid or liquid form, including pharmaceutical compositions suitable for: oral administration, such as dips (aqueous or non-aqueous solutions or suspensions), tablets (e.g., tablets targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes applied to the tongue; parenteral administration, such as by subcutaneous, intramuscular, intravenous, or epidural injection as a sterile solution or suspension or sustained-release formulation; topical administration, such as as a cream, ointment, or controlled-release patch or spray applied to the skin, lungs, or mouth; intravaginal or rectal, such as as a vaginal suppository, cream, or foam; sublingually; ophthalmically; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
[0058] Pharmaceutically acceptable: As used herein, the phrase "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.
[0059] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle involved in carrying or transporting the subject compound from one organ or part of the body to another organ or part of the body, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, etc. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can serve as pharmaceutically acceptable carriers include: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; powdered gum tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerol, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; pH buffered solutions; polyesters, polycarbonates, and / or polyanhydrides; and other nontoxic, compatible substances employed in pharmaceutical formulations.
[0060] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of such compounds that are suitable for use in a pharmaceutical setting, i.e., salts that are suitable for use in contact with the tissues of humans and lower animals without producing abnormal toxicity, irritation, allergic reactions, etc., and that are commensurate with a reasonable benefit / risk ratio, within the scope of sound medical judgment. Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, non-toxic acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. In some embodiments, provided compounds contain one or more acidic groups (e.g., oligonucleotides), and pharmaceutically acceptable salts are alkali metal, alkaline earth metal, or ammonium (e.g., ammonium salts of N(R)3, wherein each R is independently defined and described in the present disclosure) salts. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, pharmaceutically acceptable salts are sodium salts. In some embodiments, pharmaceutically acceptable salts are potassium salts. In some embodiments, pharmaceutically acceptable salts are calcium salts. In some embodiments, where appropriate, pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl groups with 1 to 6 carbon atoms, sulfonates, and arylsulfonates.In some embodiments, the compounds provided contain more than one acidic group, for example, an oligonucleotide can contain two or more acidic groups (e.g., in a natural phosphate bond and / or a modified internucleotide bond). In some embodiments, pharmaceutically acceptable salts or conventional salts of such compounds contain two or more cations that may be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or conventional salt), all ionizable hydrogens of the acidic group (e.g., in an aqueous solution with a pKa of not greater than about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2; in some embodiments, not greater than about 7; in some embodiments, not greater than about 6; in some embodiments, not greater than about 5; in some embodiments, not greater than about 4; in some embodiments, not greater than about 3) are replaced by cations. In some embodiments, each phosphorothioate and phosphate group is independently present in its salt form (e.g., if it is a sodium salt, it is -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively). In some embodiments, each phosphorothioate and phosphate internucleotide linkage is independently present in its salt form (e.g., if a sodium salt, -OP(O)(SNa)-O- and -OP(O)(ONa)-O-, respectively). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide. In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.) (if present) is present as a salt form (all sodium salts).
[0061] Protecting group: As used herein, the term "protecting group" is well known in the art and includes the protecting groups described in detail in Protecting Groups in Organic Synthesis, TW Greene and PGM Wuts, 3rd ed., John Wiley & Sons, 1999, the entire contents of which are incorporated herein by reference. Also included are protecting groups particularly suitable for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al., 06 / 2012, the entire contents of Chapter 2 of which are incorporated herein by reference. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylcarbamic acid methyl ester (Fmoc), 9-(2-sulfo)fluorenylcarbamic acid methyl ester, 9-(2,7-dibromo)fluorenylcarbamic acid methyl ester, 2,7-di-tert-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthenyl)]carbamic acid methyl ester (DBD-Tmoc), 4-methoxybenzoylmethylcarbamate (Phenoc) 、2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-halogenated ethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenyl)ethyl carbamate (Bpoc), 1-(3,5-di-tert-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarbamide)ethyl carbamate, tert-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (V oc), allyl carbamate (Alloc), allyl 1-isopropylcarbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolinecarbamate, N-hydroxypiperidinylcarbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), benzyl p-methoxycarbamate (Moz), benzyl p-nitrocarbamate, benzyl p-bromocarbamate, benzyl p-chlorocarbamate, 2,Benzyl 4-dichlorocarbamate, benzyl 4-methylsulfinylcarbamate (Msz), methyl 9-anthrylcarbamate, methyl diphenylcarbamate, ethyl 2-methylthiocarbamate, ethyl 2-methylsulfonylcarbamate, ethyl 2-(p-toluenesulfonyl)carbamate, methyl [2-(1,3-dithienyl)]carbamate (Dmoc), phenyl 4-methylthiocarbamate (Mtpc), phenyl 2,4-dimethylthiocarbamate (Bmpc), ethyl 2-phosphocarbamate (Peoc), isopropyl 2-triphenylphosphocarbamate (Ppoc), 1,1-dimethyl ethyl 2-cyanocarbamate, benzyl m-chloro-p-acyloxycarbamate, benzyl p-(dihydroxyboryl)carbamate, methyl 5-benzisoxazolylcarbamate, methyl 2-(trifluoromethyl)-6-chromononylcarbamate (Tcroc), phenyl m-nitrocarbamate, benzyl 3,5-dimethoxycarbamate, benzyl o-nitrocarbamate, benzyl 3,4-dimethoxy-6-nitrocarbamate, methyl phenyl (o-nitrophenyl)carbamate, phenothiazinyl-(10)-carbonyl derivatives, N'-toluenesulfonylaminocarbonyl derivatives, N'-phenylaminothiocarbonyl derivatives, tert-amylcarbamate Ester, S-benzyl thiocarbamate, benzyl p-cyanocarbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropyl methyl carbamate, benzyl p-decyloxycarbamate, 2,2-dimethoxycarbonyl vinyl carbamate, o-(N,N-dimethylformamide)carbamate, 1,1-dimethyl-3-(N,N-dimethylformamide)carbamate propyl, 1,1-dimethylcarbamate propynyl, methyl di(2-pyridyl)carbamate, methyl 2-furylcarbamate, ethyl 2-iodocarbamate, isobornyl carbamate, isobutyl carbamate, carbamic acid Isonicotinoyl esters, benzyl p-(p'-methoxyphenylazo)carbamate, cyclobutyl 1-methylcarbamate, cyclohexyl 1-methylcarbamate, methyl 1-methyl-1-cyclopropylcarbamate, ethyl 1-methyl-1-(3,5-dimethoxyphenyl)carbamate, ethyl 1-methyl-1-(p-phenylazophenyl)carbamate, ethyl 1-methyl-1-phenylcarbamate, ethyl 1-methyl-1-(4-pyridyl)carbamate, phenyl carbamate, benzyl p-(phenylazo)carbamate, phenyl 2,4,6-tri-tert-butylcarbamate, benzyl 4-(trimethylammonium)carbamate, 2,4,Benzyl 6-trimethylcarbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropionamide, picolinamide, 3-pyridylformamide, N-benzoylphenylalanyl derivatives, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propionamide, 3-(o-nitrophenyl)propionamide, 2-methyl-2-(o-nitrophenoxy)propionamide, 2-methyl-2-(o-phenylazophenoxy)propionamide, 4-chlorobutyryl Amine, 3-methyl-3-nitrobutyramide, o-nitrocinnamamide, N-acetylmethionine derivatives, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolinyl-2-one, N-phthalimide, N-dithiosuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-tetramethyldisilazide adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl -1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuccinamide, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenamine (PhF), N-2,7 -Dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-methylpyridinylamino N'-oxide, N-1,1-dimethylsulfomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivatives, N-diphenylboronic acid derivatives, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelates, N-zinc chelates, N-nitroamines, N-nitrosamines, amine N-oxides, diphenylphosphoramide (Dpp), dimethylthiophosphoramide (Mpt), diphenylthiophosphoramide (Ppt), dialkylphosphoramidates, dibenzylphosphoramidates, diphenylphosphoramidates, benzylsulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethylbenzenesulfenamide Methyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4',8'-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylmethylsulfonamide.
[0062] The carboxylic acid of suitable protection further includes but is not limited to carboxylic acid protected by silyl-, alkyl-, alkenyl-, aryl- and arylalkyl. The example of suitable silyl includes trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triisopropylsilyl etc. The example of suitable alkyl includes methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, tert-butyl, tetrahydropyran-2-yl. The example of suitable alkenyl includes allyl. The example of suitable aryl includes optionally substituted phenyl, biphenyl or naphthyl. The example of suitable arylalkyl includes optionally substituted benzyl (for example, p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl) and 2- and 4-picoline.
[0063] Suitable hydroxy protecting groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), tert-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), tert-butoxymethyl, 4-pentenyloxymethyl (POM), silyloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (T HP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanolbenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxy 1-Methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylseleno)ethyl, tert-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-methylpyridine, 4-methylpyridine, 3-methyl-2-methylpyridine N-oxide, diphenylmethyl, p,p'-dinitrodiphenylmethyl, 5-dibenzosuccinoyl, trityl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)benzyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)benzyl, 4,4',4"-tris(4,5-dichlorophthalimidephenyl)methyl, 4,4',4"-tris(levulinyloxyphenyl)methyl, 4,4',4"-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4"-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethyltert-hexylsilyl, tert-butyldimethylsilyl (TBDMS), tert-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), tert-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, Methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinic acid ester), 4,4-(ethylenedithio)pentanoate (levulinic acid dithioacetal), pivalate, adamantyl ester, crotonate, 4-methoxycrotonate, benzoate, phenyl p-terephthalate, 2,4,6-trimethylbenzoate (trimethylbenzoate), alkyl methyl carbonate, 9-fluorenyl methyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec) , 2-(triphenylphosphine)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl ethylene carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzylthiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylvalerate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxy)methyl 1,2- or 1,2-dinitrophenylsulfonate, methylsulfonate, benzylsulfonate, and toluenesulfonate.3-diol, protecting groups include methylene acetal, ethylene acetal, 1-tert-butylethylene ketal, 1-phenylethylene ketal, (4-methoxyphenyl)ethylene acetal, 2,2,2-trichloroethylene acetal, acetone, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzyl acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylene orthoester, 1-Ethoxyethylene orthoester, 1,2-dimethoxyethylene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylene derivatives, α-(N,N'-dimethylamino)benzylidene derivatives, 2-oxacyclopentylene orthoester, di-tert-butylsilylene (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxane) derivative (TIPDS), tetra-tert-butoxydisiloxane-1,3-dimethylene derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl borate, and phenyl borate.
[0064] In some embodiments, the hydroxy protecting group is acetyl, tert-butyl, tert-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, trifluoromethanesulfonate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl (DMTr) and 4,4',4"-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl, 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4 In some embodiments, the hydroxy protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4',4"-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl), or 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In some embodiments, each of the hydroxy protecting groups is independently selected from acetyl, benzyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, and 4,4'-dimethoxytrityl. In some embodiments, the hydroxy protecting group is selected from the group consisting of trityl, monomethoxytrityl, and 4,4'-dimethoxytrityl. In some embodiments, the phosphoprotecting group is a group that is attached to a phosphoprotective bond (e.g., an internucleotide bond) during oligonucleotide synthesis. In certain embodiments, the blocking group is connected to the sulfur atom of the phosphorothioate group. In certain embodiments, the blocking group is connected to the oxygen atom of the phosphorothioate bond between the nucleotides. In certain embodiments, the blocking group is connected to the oxygen atom of the phosphate bond between the nucleotides.In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylformamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.
[0065] Subject: As used herein, the term "subject" or "test subject" refers to any organism to which a compound (e.g., oligonucleotide) or composition according to the present disclosure is administered, for example, to achieve experimental, diagnostic, prophylactic, and / or therapeutic goals. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject may be suffering from and / or susceptible to a disease, disorder, and / or condition.
[0066] Sugar: The term "sugar" refers to a monosaccharide or polysaccharide in closed and / or open form. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranoses, pentopyranoses, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs used in place of traditional sugar molecules, such as ethylene glycol (whose polymers form the backbone of nucleic acid analogs), ethylene glycol nucleic acids ("GNA"), and the like. As used herein, the term "sugar" also encompasses structural analogs used in place of natural or naturally occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, the sugar is an RNA or DNA sugar (ribose or deoxyribose). In some embodiments, the sugar is a modified ribose or deoxyribose, for example, 2'-modified, 5'-modified, and the like. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, the modified sugar can provide one or more desired properties, activities, and the like. In some embodiments, the sugar is an optionally substituted ribose or deoxyribose. In some embodiments, "sugar" refers to a sugar unit in an oligonucleotide or nucleic acid.
[0067] Susceptible: An individual who is "susceptible" to a disease, disorder, and / or condition is one who has a higher risk of developing the disease, disorder, and / or condition than members of the general population. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition is predisposed to developing the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.
[0068] Therapeutic agent: As used herein, the term "therapeutic agent" generally refers to any agent that, when administered to a subject, causes a desired effect (e.g., a desired biological, clinical, or pharmacological effect). In some embodiments, an agent is considered a therapeutic agent if it exhibits a statistically significant effect across an appropriate population. In some embodiments, an appropriate population is a population of subjects suffering from and / or susceptible to a disease, disorder, or condition. In some embodiments, an appropriate population is a population of model organisms. In some embodiments, an appropriate population can be defined by one or more criteria, such as age group, gender, genetic background, pre-existing clinical condition, prior therapy exposure. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, alleviates, ameliorate, relieves, inhibits, prevents one or more symptoms or features of a disease, disorder, and / or condition of the subject, delays its onset, reduces its severity, and / or reduces its incidence. In some embodiments, a "therapeutic agent" is an agent that has been or requires approval by a governmental agency before it can be marketed for administration to humans. In some embodiments, a "therapeutic agent" is an agent that requires a medical prescription for administration to humans. In some embodiments, a therapeutic agent is a provided compound, such as a provided oligonucleotide.
[0069] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means an amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment regimen. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. As will be understood by one of ordinary skill in the art, the effective amount of a substance can vary depending on factors such as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, an effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that alleviates, ameliorate, alleviate, inhibit, prevent, delay the onset, reduce the severity, and / or reduce the incidence of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, the therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver the therapeutically effective amount.
[0070] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method for partially or completely alleviating, ameliorating, alleviating, inhibiting, preventing, delaying the onset of, reducing the severity of, and / or reducing the incidence of one or more symptoms or features of a disease, disorder, and / or condition. Treatment can be administered to a subject who does not exhibit signs of the disease, disorder, and / or condition. In some embodiments, treatment can be administered to a subject who exhibits only early signs of a disease, disorder, and / or condition, for example, for the purpose of reducing the risk of developing pathology associated with the disease, disorder, and / or condition.
[0071] Wild-type: As used herein, the term "wild-type" has its art-understood meaning, which refers to an entity of structure and / or activity as found in nature in a "normal" (as compared to mutant, diseased, altered, etc.) state or background. One of ordinary skill in the art will understand that wild-type genes and polypeptides typically exist in a variety of different forms (e.g., alleles).
[0072] As will be appreciated by those skilled in the art, the methods and compositions described herein with respect to the provided compounds (eg, oligonucleotides) are generally also applicable to the pharmaceutically acceptable salts of such compounds.
[0073] As used in this disclosure, in some embodiments, "one or more" is 1-200, 1-150, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60. In some embodiments, "one or more" is one. In some embodiments, "one or more" is two. In some embodiments, "one or more" is three. In some embodiments, "one or more" is four. In some embodiments, "one or more" is five. In some embodiments, "one or more" is six. In some embodiments, "one or more" is seven. In some embodiments, "one or more" is eight. In some embodiments, "one or more" is nine. In some embodiments, "one or more" is ten. In some embodiments, "one or more" is at least one. In some embodiments, "one or more" is at least two. In some embodiments, "one or more" is at least three. In some embodiments, "one or more" is at least four. In some embodiments, "one or more" is at least five. In some embodiments, "one or more" is at least six. In some embodiments, "one or more" is at least seven. In some embodiments, "one or more" is at least eight. In some embodiments, "one or more" is at least nine. In some embodiments, "one or more" is at least ten.
[0074] As used in this disclosure, in some embodiments, "at least one" is "one or more," as described herein.
[0075] General Description of Certain Embodiments
[0076] Among other things, the present disclosure also provides various oligonucleotides and compositions thereof. In some embodiments, the oligonucleotides of the present disclosure target SARM1 and can hybridize with SARM1 transcripts (e.g., SARM1 mRNA). In some embodiments, the provided technology (e.g., oligonucleotides, compositions, methods, etc.) reduces the level of SARM1 transcripts and / or its products. The use of naturally occurring nucleic acids is limited, for example, because they are susceptible to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to circumvent these shortcomings and / or to further improve various properties and activities. In some embodiments, the oligonucleotides provided include various chemical modifications, such as core base modifications, sugar modifications, internucleotide bond modifications, etc., which, among other things, make these molecules less susceptible to degradation and improve other properties and / or activities. In some embodiments, the oligonucleotides include one or more features described herein, for example, base sequence, length, wings, core, activity, etc. In some embodiments, the oligonucleotides have base sequences described herein and / or wing-core-wing structures described herein.
[0077] base sequence
[0078] The base sequence of each oligonucleotide has a sufficient length so that the base sequence can form a double strand with a complementary sequence in the target nucleic acid for one or more biological functions. In some embodiments, the oligonucleotide specifically targets its target nucleic acid. In some embodiments, the base sequence of the oligonucleotide provided is or comprises a sequence complementary to a portion of the target nucleic acid ("target portion"), for example, the SARM1 gene or its transcript. In some embodiments, the target portion comprises a portion of an exon and / or intron. In some embodiments, the target portion comprises a portion of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, or exon 9 of SARM1. In some embodiments, the target portion comprises a portion of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, or intron 8 of SARM1. In some embodiments, the target portion comprises a portion of exon 1 of SARM1. In some embodiments, the target portion comprises a portion of exon 2 of SARM1. In some embodiments, the target portion comprises a portion of exon 3 of SARM1. In some embodiments, the target portion comprises a portion of exon 4 of SARM1. In some embodiments, the target portion comprises a portion of exon 5 of SARM1. In some embodiments, the target portion comprises a portion of exon 7 of SARM1. In some embodiments, the target portion comprises a portion of exon 8 of SARM1. In some embodiments, the target portion comprises a portion of exon 9 of SARM1. In some embodiments, the target portion comprises a portion of intron 1 of SARM1. In some embodiments, the target portion comprises a portion of intron 2 of SARM1. In some embodiments, the target portion comprises a portion of intron 3 of SARM1. In some embodiments, the target portion comprises a portion of intron 4 of SARM1. In some embodiments, the target portion comprises a portion of intron 5 of SARM1. In some embodiments, the target portion comprises a portion of intron 6 of SARM1. In some embodiments, the target portion comprises a portion of intron 7 of SARM1. In some embodiments, the target portion comprises a portion of intron 8 of SARM1. Exons and introns alternate, for example, intron 1 is between exon 1 and exon 2; intron 2 is between exon 2 and exon 3; and so on. In some embodiments, the target portion is located within an exon. In some embodiments, the target portion is located within an intron. In some embodiments, the target portion comprises a portion of an exon and a portion of an exon. In some embodiments, the length of such a sequence complementary to the target portion is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases.
[0079] In some embodiments, the target portion is or comprises a characteristic portion of a nucleic acid sequence (e.g., a nucleic acid sequence of a SARM1 gene or its transcript), which characteristic portion defines the nucleic acid sequence in related organisms but not other nucleic acid sequences; for example, the characteristic portion is not present in other genomic nucleic acid sequences (e.g., genes) or transcripts thereof of related organisms (e.g., for human SARM1, the characteristic portion is not present in other human nucleic acid sequences or transcripts thereof). In some embodiments, the characteristic portion of a transcript defines the transcript in related organisms but not other transcripts; for example, in some embodiments, the characteristic portion is not present in transcripts transcribed from different nucleic acid sequences (e.g., different genes). In some embodiments, transcript variants from a nucleic acid sequence (e.g., mRNA variants of a gene) may share a common characteristic portion, which characteristic portion defines the transcript variant but not transcripts of other nucleic acids (e.g., transcripts of other genes). In some embodiments, the characteristic portion of a transcript defines the transcript but not one or more other transcripts of the same nucleic acid sequence (e.g., gene) and / or other alleles of the nucleic acid sequence. In some embodiments, a characteristic portion defines a particular allele (and / or its transcript) but not one or more other alleles (and / or its transcripts). In some embodiments, a characteristic portion comprises a sequence isolated in a nucleic acid. In some embodiments, a characteristic portion is a continuous stretch of nucleobases in a nucleic acid (a "signature sequence"). A characteristic portion or sequence can have various numbers of nucleobases. In some embodiments, there are about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases in a characteristic portion or sequence; in some embodiments, about 10; in some embodiments, about 11; in some embodiments, about 12; in some embodiments, about 13; in some embodiments, about 14; in some embodiments, about 15; in some embodiments, about 16; in some embodiments, about 17; in some embodiments, about 18; in some embodiments, about 19; in some embodiments, about 20; in some embodiments, about 21; in some embodiments, about 22; in some embodiments, about 23; in some embodiments, about 24; in some embodiments, about 25; in some embodiments, about 25 or more.
[0080] In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a SARM1 transcript. In some embodiments, the oligonucleotide comprises a sequence that is complementary to a characteristic portion of a SARM1 transcript. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the base sequence of the oligonucleotide is identical or complementary to a characteristic portion of a SARM1 transcript. In some embodiments, the base sequence of the oligonucleotide is complementary to a characteristic portion of a SARM1 transcript. In some embodiments, the characteristic portion is a signature sequence.
[0081] In some embodiments, the signature sequence of the SARM1 transcript is or comprises the complement of the sequence of the oligonucleotide in Table 1. In some embodiments, the signature sequence is or comprises UUUGCUCCCAGGGCUAGUGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCUCUAUGGAUGGAGAUGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCCAAGCCCACAGCUCUCCU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UCUGCUGGGAGGCAUGGGUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGAGAGUGAGUACAGCCAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CAGGACCAAGGACAGAGCAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GUAGGCUGCAUGAGAAUGGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UCAAGGAGCCUAGGUCACAG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GACCCACAGCCUCUCAGACC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCACAGAAGAACUGGGAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGUCACCUGUGGAGGACAUC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGGUCAGUAAGGCAGGAAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGUCAGGGACAAAGGAGAG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GAGUGAGGAAAAGGCAAGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GAGAGGGUUAGUGACCAGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGGCAAGACCAAGGUGGGUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGGACAGGACAUCAGUGUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGCCAAGACCCAGAGGUGUG, wherein each U can be independently replaced by T.In some embodiments, the signature sequence is or comprises AACUGGGAGUGAUGGGCAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGGCCAGGGCAGAUGGAGAG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGAGACAAGGAGAGGGACUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCCAGGAGCAGCAGGUGGAU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCACCCACAAGACACAAGGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CAACAGGAAAAUCCUAGGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGGAGGCAGGAGUUGAGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGGCUGAUACCCAGGUGUCU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGGAAAUAGGGAAGAAGGA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UACCUGACAGUGAGUGAUGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GACAAGGCUGUGGCACUGAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGGUGCAUAAGGUAGGUGCC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGGCUGAGGGAUGCAGUAGU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGAGACAGGAUGAGACAAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AAGCAGUCAGCUCAGAGACA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGAGUGUGGAGUCAAGCCC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGAAGCUGAGAUGCCAUGCC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCAGCUAGGUGAUCCUGAA, wherein each U can be independently replaced by T.In some embodiments, the signature sequence is or comprises CCCAGCAGAUGGCAAAGAGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCACAAGUGAACUGCACUC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGACAGGCAGAGUGUGGGCA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CUGACUAGCAGCUCCCUCUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCCUGCAUCACCUUUGCCAA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGUCUUCCAACUGGUGGAGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GAUCCUGGUGGCUGAGAACC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGCAGGCAUCUUGGAGCAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCCAUCAAGAGCCUGCAAGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UCCUACUCUACCAAUGGCAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGGUUCUUUAGGGAGCUCAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCCUGUACUGGUGGCAAACC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AUUGAUGUGGAGAAGCUGGA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AUCUGGAAGCAGGCAAGUUC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GACAAACUCAUCCAGAGUGU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCAGAGUGUCAUGGGUGCCC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCUGGAGCACUGGACAAGU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCAUGACUGCAAGGAUUGGG, wherein each U can be independently replaced by T.In some embodiments, the signature sequence is or comprises GAGGACAUGCAGGCUGUGCU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CAGGCUCUGACACCAGUUUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCAGUUUGGAGGGUGCUGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCAUGGGUCCAACCUAACCA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGGGCUGAGACAACCUGGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCUCAGUAUCUGGAGAGGGA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCUGCCAUUGGGUUGUCUGU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCCUGCUCAGUUCUGGAGAC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCCUCAGACAGGAAUUAAGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGCCUGGGCACUGUAUUCUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AUUCUGAGCAAGGGCCUGGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises AGCCAGCCAGGGAUGAGUGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UGUGGCCUUGCCCUGUAAUC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UCUUUUGCCACAUCCAGGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCCCUCCCUCUGACUUCCUU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GAGCCUCCUGUUUGGGCCUG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UUGGGCCUGGGUCUGGGCAU, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GCCUUGGUGCUGUGCCUCAG, wherein each U can be independently replaced by T.In some embodiments, the signature sequence is or comprises AGGCUCCUUCCUGGUCUGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGAAAGAGGCAAAGUCCUGA, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGGUAGCAAAUCUCUAAAGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GAAUCAUUCUGAGGCUGGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises UCCUCCACUGGGUUCAGAGG, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises ACCCUCCAAUAAACCCAGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises CCACUCUUGGCUGUGCUGGC, wherein each U can be independently replaced by T. In some embodiments, the signature sequence is or comprises GGCUCCUUCCUUCCACUCCC, wherein each U can be independently replaced by T.
[0082] In certain embodiments, oligonucleotide can be with the district hybridization of nucleic acid.In certain embodiments, compared with the oligonucleotide with one or more reference district specific hybridization (for example, by sequence complementarity) of nucleic acid, the oligonucleotide that can be with the specific one or more district specific hybridization (for example, by sequence complementarity) of nucleic acid can more effectively reduce the level of nucleic acid.In certain embodiments, the length in district is about 20-200 (for example, about 20-150, 20-100, 30-200, 30-150, 40-200, 40-150, 50-100 or about 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200) core base.In certain embodiments, the length in district is about 30 core bases.In certain embodiments, the length in district is about 40 core bases. In some embodiments, the length of the region is about 50 nucleobases. In some embodiments, the length of the region is about 60 nucleobases. In some embodiments, the length of the region is about 70 nucleobases. In some embodiments, the length of the region is about 80 nucleobases. In some embodiments, the length of the region is about 90 nucleobases. In some embodiments, the length of the region is about 100 nucleobases. In some embodiments, the length of the region is about 120 nucleobases. In some embodiments, the length of the region is about 150 nucleobases. In some embodiments, the length of the region is about 200 nucleobases. In some embodiments, the region comprises a complementary sequence to the base sequence of the oligonucleotides in Table 1, and in some embodiments, the complementary sequence is located in the middle of the region. For example, in some embodiments, the region is or comprises UUUGCUCCCAGGGCUAGUGG. In some embodiments, the region is or comprises GCUCUAUGGAUGGAGAUGGC. In some embodiments, the region is or comprises CCCAAGCCCACAGCUCUCCU. In some embodiments, the region is or comprises UCUGCUGGGAGGCAUGGGUG. In some embodiments, the region is or comprises GGAGAGUGAGUACAGCCAGC. In some embodiments, the region is or comprises CAGGACCAAGGACAGAGCAC. In some embodiments, the region is or comprises GUAGGCUGCAUGAGAAUGGG. In some embodiments, the region is or comprises UCAAGGAGCCUAGGUCACAG. In some embodiments, the region is or comprises GACCCACAGCCUCUCAGACC. In some embodiments, the region is or comprises ACCACAGAAGAACUGGGAGC. In some embodiments, the region is or comprises UGUCACCUGUGGAGGACAUC. In some embodiments, the region is or comprises AGGUCAGUAAGGCAGGAAGC.In some embodiments, the region is or comprises UGGUCAGGGACAAAGGAGAG. In some embodiments, the region is or comprises GAGUGAGGAAAAGGCAAGGC. In some embodiments, the region is or comprises GAGAGGGUUAGUGACCAGGC. In some embodiments, the region is or comprises AGGCAAGACCAAGGUGGGUG. In some embodiments, the region is or comprises UGGGACAGGACAUCAGUGUG. In some embodiments, the region is or comprises GGCCAAGACCCAGAGGUGUG. In some embodiments, the region is or comprises AACUGGGAGUGAUGGGCAGC. In some embodiments, the region is or comprises GGGCCAGGGCAGAUGGAGAG. In some embodiments, the region is or comprises AGAGACAAGGAGAGGGACUG. In some embodiments, the region is or comprises CCCAGGAGCAGCAGGUGGAU. In some embodiments, the region is or comprises GCACCCACAAGACACAAGGG. In some embodiments, the region is or comprises CAACAGGAAAAUCCUAGGGC. In some embodiments, the region is or comprises UGGGAGGCAGGAGUUGAGGC. In some embodiments, the region is or comprises AGGCUGAUACCCAGGUGUCU. In some embodiments, the region is or comprises UGGGAAAUAGGGAAGAAGGA. In some embodiments, the region is or comprises UACCUGACAGUGAGUGAUGC. In some embodiments, the region is or comprises GACAAGGCUGUGGCACUGAC. In some embodiments, the region is or comprises GGGUGCAUAAGGUAGGUGCC. In some embodiments, the region is or comprises GGGCUGAGGGAUGCAGUAGU. In some embodiments, the region is or comprises AGAGACAGGAUGAGACAAGC. In some embodiments, the region is or comprises AAGCAGUCAGCUCAGAGACA. In some embodiments, the region is or comprises UGGAGUGUGGAGUCAAGCCC. In some embodiments, the region is or comprises UGAAGCUGAGAUGCCAUGCC. In some embodiments, the region is or comprises ACCAGCUAGGUGAUCCUGAA. In some embodiments, the region is or comprises CCCAGCAGAUGGCAAAGAGG. In some embodiments, the region is or comprises ACCACAAGUGAACUGCACUC. In some embodiments, the region is or comprises UGACAGGCAGAGUGUGGGCA. In some embodiments, the region is or comprises CUGACUAGCAGCUCCCUCUG. In some embodiments, the region is or comprises GCCUGCAUCACCUUUGCCAA.In some embodiments, the region is or comprises GGUCUUCCAACUGGUGGAGG. In some embodiments, the region is or comprises GAUCCUGGUGGCUGAGAACC. In some embodiments, the region is or comprises UGGCAGGCAUCUUGGAGCAC. In some embodiments, the region is or comprises GCCAUCAAGAGCCUGCAAGG. In some embodiments, the region is or comprises UCCUACUCUACCAAUGGCAC. In some embodiments, the region is or comprises AGGUUCUUUAGGGAGCUCAC. In some embodiments, the region is or comprises CCCUGUACUGGUGGCAAACC. In some embodiments, the region is or comprises AUUGAUGUGGAGAAGCUGGA. In some embodiments, the region is or comprises AGCUGGAAGCAGGCAAGUUC. In some embodiments, the region is or comprises GACAAACUCAUCCAGAGUGU. In some embodiments, the region is or comprises CCAGAGUGUCAUGGGUGCCC. In some embodiments, the region is or comprises ACCUGGAGCACUGGACAAGU. In some embodiments, the region is or comprises CCAUGACUGCAAGGAUUGGG. In some embodiments, the region is or comprises GAGGACAUGCAGGCUGUGCU. In some embodiments, the region is or comprises CAGGCUCUGACACCAGUUUG. In some embodiments, the region is or comprises ACCAGUUUGGAGGGUGCUGC. In some embodiments, the region is or comprises CCAUGGGUCCAACCUAACCA. In some embodiments, the region is or comprises UGGGCUGAGACAACCUGGGC. In some embodiments, the region is or comprises CCUCAGUAUCUGGAGAGGGA. In some embodiments, the region is or comprises CCUGCCAUUGGGUUGUCUGU. In some embodiments, the region is or comprises CCCUGCUCAGUUCUGGAGAC. In some embodiments, the region is or comprises GCCUCAGACAGGAAUUAAGG. In some embodiments, the region is or comprises GGCCUGGGCACUGUAUUCUG. In some embodiments, the region is or comprises AUUCUGAGCAAGGGCCUGGG. In some embodiments, the region is or comprises AGCCAGCCAGGGAUGAGUGC. In some embodiments, the region is or comprises UGUGGCCUUGCCCUGUAAUC. In some embodiments, the region is or comprises UCUUUUGCCACAUCCAGGGC. In some embodiments, the region is or comprises GCCCUCCCUCUGACUUCCUU. In some embodiments, the region is or comprises GAGCCUCCUGUUUGGGCCUG.In some embodiments, the region is or comprises UUGGGCCUGGGUCUGGGCAU. In some embodiments, the region is or comprises GCCUUGGUGCUGUGCCUCAG. In some embodiments, the region is or comprises AGGCUCCUUCCUGGUCUGGC. In some embodiments, the region is or comprises GGAAAGAGGCAAAGUCCUGA. In some embodiments, the region is or comprises GGGUAGCAAAUCUCUAAAGC. In some embodiments, the region is or comprises GAAUCAUUCUGAGGCUGGGC. In some embodiments, the region is or comprises UCCUCCACUGGGUUCAGAGG. In some embodiments, the region is or comprises ACCCUCCAAUAAACCCAGGC. In some embodiments, the region is or comprises CCACUCUUGGCUGUGCUGGC. In some embodiments, the region is or comprises GGCUCCUUCCUUCCACUCCC.
[0083] In some embodiments, the base sequence of the oligonucleotide comprises or consists of about 10-50 (e.g., about 15-50, 16-50, 17-50, 18-50, 19-50, 20-50, 15-30, 20-30, 15-25 or 20-25 or at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 In some embodiments, the consecutive bases are complementary to a sequence of bases of equal length in a SARM1 transcript.
[0084] In certain embodiments, the base sequence of the oligonucleotide is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or 100% complementary to the target sequence in the SARM1 transcript. In some embodiments, the base sequence of the oligonucleotide is completely complementary to the target sequence in the SARM1 transcript.
[0085] In some embodiments, the base sequence of the oligonucleotide has about 80% or greater identity to the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 85% or greater identity to the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 90% or greater identity to the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide has about 95% or greater identity to the base sequence of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa.
[0086] In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 15 or more bases of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 16 or more bases of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 17 or more bases of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 18 or more bases of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a continuous span of about 19 or more bases of the oligonucleotide disclosed in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide comprises a contiguous span of about 20 or more bases of the oligonucleotides disclosed in Table 1, wherein each T can be independently replaced by a U, and vice versa.
[0087] In some embodiments, the base sequence of the oligonucleotide comprises the base sequence of the oligonucleotide in Table 1, wherein each T can be independently replaced by U, and vice versa. In some embodiments, the base sequence of the oligonucleotide is the base sequence of the oligonucleotide in Table 1, wherein each T can be independently replaced by U, and vice versa. For example, in some embodiments, the base sequence of the oligonucleotide comprises CCACTAGCCCTGGGAGCAAA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCATCTCCATCCATAGAGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises AGGAGAGCTGTGGGCTTGGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CACCCATGCCTCCCAGCAGA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTGGCTGTACTCACTCTCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTGCTCTGTCCTTGGTCCTG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCCATTCTCATGCAGCCTAC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CTGTGACCTAGGCTCCTTGA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGTCTGAGAGGCTGTGGGTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTCCCAGTTCTTCTGTGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GATGTCCTCCACAGGTGACA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTTCCTGCCTTACTGACCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CTCTCCTTTGTCCCTGACCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCTTGCCTTTTCCTCACTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCTGGTCACTAACCCTCTC, wherein each T can be independently replaced by U.In some embodiments, the base sequence of the oligonucleotide comprises CACCCACCTTGGTCTTGCCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CACACTGATGTCCTGTCCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CACACCTCTGGGTCTTGGCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTGCCCATCACTCCCAGTT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CTCTCCATCTGCCCTGGCCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CAGTCCCTCTCCTTGTCTCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ATCCACCTGCTGCTCCTGGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCCTTGTGTCTTGTGGGTGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCCTAGGATTTTCCTGTTG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCTCAACTCCTGCCTCCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises AGACACCTGGGTATCAGCCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TCCTTCTTCCCTATTTCCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCATCACTCACTGTCAGGTA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTCAGTGCCACAGCCTTGTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGCACCTACCTTATGCACCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ACTACTGCATCCCTCAGCCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTTGTCTCATCCTGTCTCT, wherein each T can be independently replaced by U.In some embodiments, the base sequence of the oligonucleotide comprises TGTCTCTGAGCTGACTGCTT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGGCTTGACTCCACACTCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGCATGGCATCTCAGCTTCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TTCAGGATCACCTAGCTGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCTCTTTGCCATCTGCTGGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GAGTGCAGTTCACTTGTGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TGCCCACACTCTGCCTGTCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CAGGGGAGCTGCTAGTCAG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TTGGCAAAGGTGATGCAGGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCTCCACCAGTTGGAAGACC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGTTCTCAGCCACCAGGATC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTGCTCCAAGATGCCTGCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCTTGCAGGCTCTTGATGGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTGCCATTGGTAGAGTAGGA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTGAGCTCCCTAAAGAACCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGTTTGCCACCAGTACAGGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TCCAGCTTCTCCACATCAAT, wherein each T can be independently replaced by U.In some embodiments, the base sequence of the oligonucleotide comprises GAACTTGCCTGCTTCCAGCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ACACTCTGGATGAGTTTGTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGGCACCCATGACACTCTGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ACTTGTCCAGTGCTCCAGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCCAATCCTTGCAGTCATGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises AGCACAGCCTGCATGTCCTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CAAACTGGTGTCAGAGCCTG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCAGCACCCTCCAAACTGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TGGTTAGGTTGGACCCATGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCCAGGTTGTCTCAGCCCA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TCCTCTCCAGATACTGAGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ACAGACAACCCAATGGCAGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GTCTCCAGAACTGAGCAGGG, wherein each T can be independently replaced by U. In some embodiments, as demonstrated in the Examples, such oligonucleotides (e.g., oligonucleotide 62) can provide a high and sustained reduction in SARM1 mRNA and polypeptide levels. In some embodiments, the base sequence of the oligonucleotide comprises CCTTAATTCCTGTCTGAGGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CAGAATACAGTGCCCAGGCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCCAGGCCCTTGCTCAGAAT, wherein each T can be independently replaced by U.In some embodiments, the base sequence of the oligonucleotide comprises GCACTCATCCCTGGCTGGCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GATTACAGGGCAAGGCCACA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCCTGGATGTGGCAAAAGA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises AAGGAAGTCAGAGGGAGGGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CAGGCCCAAACAGGAGGCTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises ATGCCCAGACCCAGGCCCAA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CTGAGGCACAGCACCAAGGC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCAGACCAGGAAGGAGCCT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises TCAGGACTTTGCCTCTTTCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCTTTAGAGATTTGCTACCC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCCAGCCTCAGAATGATTC, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises CCTCTGAACCCAGTGGAGGA, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCTGGGTTTATTGGAGGGT, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GCCAGCACAGAGCCAGTGG, wherein each T can be independently replaced by U. In some embodiments, the base sequence of the oligonucleotide comprises GGGAGTGGAAGGAAGGAGCC, wherein each T can be independently replaced by U.
[0088] In some embodiments, the base sequence of the oligonucleotide comprises CCACTAGCCCTGGGAGCAAA. In some embodiments, the base sequence of the oligonucleotide comprises GCCATCTCCATCCATAGAGC. In some embodiments, the base sequence of the oligonucleotide comprises AGGAGAGCTGTGGGCTTGGG. In some embodiments, the base sequence of the oligonucleotide comprises CACCCATGCCTCCCAGCAGA. In some embodiments, the base sequence of the oligonucleotide comprises GCTGGCTGTACTCACTCTCC. In some embodiments, the base sequence of the oligonucleotide comprises GTGCTCTGTCCTTGGTCCTG. In some embodiments, the base sequence of the oligonucleotide comprises CCCATTCTCATGCAGCCTAC. In some embodiments, the base sequence of the oligonucleotide comprises CTGTGACCTAGGCTCCTTGA. In some embodiments, the base sequence of the oligonucleotide comprises GGTCTGAGAGGCTGTGGGTC. In some embodiments, the base sequence of the oligonucleotide comprises GCTCCCAGTTCTTCTGTGGT. In some embodiments, the base sequence of the oligonucleotide comprises GATGTCCTCCACAGGTGACA. In some embodiments, the base sequence of the oligonucleotide comprises GCTTCCTGCCTTACTGACCT. In some embodiments, the base sequence of the oligonucleotide comprises CTCTCCTTTGTCCCTGACCA. In some embodiments, the base sequence of the oligonucleotide comprises GCCTTGCCTTTTCCTCACTC. In some embodiments, the base sequence of the oligonucleotide comprises GCCTGGTCACTAACCCTCTC. In some embodiments, the base sequence of the oligonucleotide comprises CACCCACCTTGGTCTTGCCT. In some embodiments, the base sequence of the oligonucleotide comprises CACACTGATGTCCTGTCCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0089] CACACCTCTGGGTCTTGGCC. In some embodiments, the base sequence of the oligonucleotide comprises
[0090] GCTGCCCATCACTCCCAGTT. In some embodiments, the base sequence of the oligonucleotide comprises
[0091] In some embodiments, the base sequence of the oligonucleotide comprises
[0092] CAGTCCCTCTCCTTGTCTCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0093] ATCCACCTGCTGCTCCTGGG. In some embodiments, the base sequence of the oligonucleotide comprises
[0094] In some embodiments, the base sequence of the oligonucleotide comprises
[0095] GCCCTAGGATTTTCCTGTTG. In some embodiments, the base sequence of the oligonucleotide comprises
[0096] GCCTCAACTCCTGCCTCCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0097] AGACACCTGGGTATCAGCCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0098] TCCTTCTTCCCTATTTCCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0099] GCATCACTCACTGTCAGGTA. In some embodiments, the base sequence of the oligonucleotide comprises
[0100] GTCAGTGCCACAGCCTTGTC. In some embodiments, the base sequence of the oligonucleotide comprises
[0101] In some embodiments, the base sequence of the oligonucleotide comprises
[0102] ACTACTGCATCCCTCAGCCC. In some embodiments, the base sequence of the oligonucleotide comprises
[0103] GCTTGTCTCATCCTGTCTCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0104] TGTCTCTGAGCTGACTGCTT. In some embodiments, the base sequence of the oligonucleotide comprises
[0105] GGGCTTGACTCCACACTCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0106] In some embodiments, the base sequence of the oligonucleotide comprises
[0107] TTCAGGATCACCTAGCTGGT. In some embodiments, the base sequence of the oligonucleotide comprises
[0108] In some embodiments, the base sequence of the oligonucleotide comprises
[0109] GAGTGCAGTTCACTTGTGGT. In some embodiments, the base sequence of the oligonucleotide comprises
[0110] TGCCCACACTCTGCCTGTCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0111] CAGAGGGAGCTGCTAGTCAG. In some embodiments, the base sequence of the oligonucleotide comprises
[0112] TTGGCAAAGGTGATGCAGGC. In some embodiments, the base sequence of the oligonucleotide comprises
[0113] In some embodiments, the base sequence of the oligonucleotide comprises
[0114] In some embodiments, the base sequence of the oligonucleotide comprises
[0115] GTGCTCCAAGATGCCTGCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0116] CCTTGCAGGCTCTTGATGGC. In some embodiments, the base sequence of the oligonucleotide comprises
[0117] GTGCCATTGGTAGAGTAGGA. In some embodiments, the base sequence of the oligonucleotide comprises
[0118] In some embodiments, the base sequence of the oligonucleotide comprises
[0119] In some embodiments, the base sequence of the oligonucleotide comprises
[0120] TCCAGCTTCTCCACATCAAT. In some embodiments, the base sequence of the oligonucleotide comprises
[0121] GAACTTGCCTGCTTCCAGCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0122] ACACTCTGGATGAGTTTGTC. In some embodiments, the base sequence of the oligonucleotide comprises
[0123] In some embodiments, the base sequence of the oligonucleotide comprises
[0124] ACTTGTCCAGTGCTCCAGGT. In some embodiments, the base sequence of the oligonucleotide comprises
[0125] CCCAATCCTTGCAGTCATGG. In some embodiments, the base sequence of the oligonucleotide comprises
[0126] AGCACAGCCTGCATGTCCTC. In some embodiments, the base sequence of the oligonucleotide comprises
[0127] CAAACTGGTGTCAGAGCCTG. In some embodiments, the base sequence of the oligonucleotide comprises
[0128] GCAGCACCCTCCAAACTGGT. In some embodiments, the base sequence of the oligonucleotide comprises
[0129] TGGTTAGGTTGGACCCATGG. In some embodiments, the base sequence of the oligonucleotide comprises
[0130] GCCCAGGTTGTCTCAGCCCA. In some embodiments, the base sequence of the oligonucleotide comprises
[0131] TCCCTCTCCAGATACTGAGG. In some embodiments, the base sequence of the oligonucleotide comprises
[0132] ACAGACAACCCAATGGCAGG. In some embodiments, the base sequence of the oligonucleotide comprises
[0133] In some embodiments, the base sequence of the oligonucleotide comprises
[0134] In some embodiments, the base sequence of the oligonucleotide comprises
[0135] CAGAATACAGTGCCCAGGCC. In some embodiments, the base sequence of the oligonucleotide comprises
[0136] In some embodiments, the base sequence of the oligonucleotide comprises
[0137] GCACTCATCCCTGGCTGGCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0138] GATTACAGGGCAAGGCCACA. In some embodiments, the base sequence of the oligonucleotide comprises
[0139] GCCCTGGATGTGGCAAAAGA. In some embodiments, the base sequence of the oligonucleotide comprises
[0140] AAGGAAGTCAGAGGGAGGGC. In some embodiments, the base sequence of the oligonucleotide comprises
[0141] CAGGCCCAAACAGGAGGCTC. In some embodiments, the base sequence of the oligonucleotide comprises
[0142] ATGCCCAGACCCAGGCCCAA. In some embodiments, the base sequence of the oligonucleotide comprises
[0143] In some embodiments, the base sequence of the oligonucleotide comprises
[0144] GCCAGACCAGGAAGGAGCCT. In some embodiments, the base sequence of the oligonucleotide comprises
[0145] TCAGGACTTTGCCTCTTTCC. In some embodiments, the base sequence of the oligonucleotide comprises
[0146] GCTTTAGAGATTTGCTACCC. In some embodiments, the base sequence of the oligonucleotide comprises
[0147] GCCCAGCCTCAGAATGATTC. In some embodiments, the base sequence of the oligonucleotide comprises
[0148] In some embodiments, the base sequence of the oligonucleotide comprises
[0149] GCCTGGGTTTATTGGAGGGT. In some embodiments, the base sequence of the oligonucleotide comprises
[0150] GCCAGCACAGCCAAGAGTGG. In some embodiments, the base sequence of the oligonucleotide comprises GGGAGTGGAAGGAAGGAGCC.
[0151] length
[0152] As will be appreciated by those skilled in the art, oligonucleotides can have various lengths to provide the properties and / or activity required for various uses. Many techniques for evaluating, selecting and / or optimizing oligonucleotide lengths are available in the art and can be utilized in accordance with the present disclosure. As shown herein, in many embodiments, the oligonucleotides provided have a suitable length to hybridize with their target and reduce the level of their target and / or its product. In some embodiments, the oligonucleotides are long enough to recognize the target nucleic acid (e.g., SARM1 mRNA). In some embodiments, the oligonucleotides are long enough to distinguish between the target nucleic acid and other nucleic acids (e.g., nucleic acids having a base sequence other than the SARM1 sequence) to reduce off-target effects. In some embodiments, the oligonucleotides are short enough to reduce the complexity of preparation or production and to reduce product costs.
[0153] In some embodiments, the length of the base sequence of the oligonucleotide is about 10-100 nucleobases. In some embodiments, the length of the base sequence is about 10-50 nucleobases. In some embodiments, the length of the base sequence is about 15-50 nucleobases. In some embodiments, the length of the base sequence is about 15-30 nucleobases. In some embodiments, the length of the base sequence is about 15-25 nucleobases. In some embodiments, the length of the base sequence is about 15-22 nucleobases. In some embodiments, the length of the base sequence is about 18-22 nucleobases. In some embodiments, the length of the base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases. In some embodiments, the length of the base sequence is at least about 12 nucleobases. In some embodiments, the length of the base sequence is at least about 13 nucleobases. In some embodiments, the length of the base sequence is at least about 14 nucleobases. In some embodiments, the base sequence is at least about 15 nucleobases in length. In some embodiments, the base sequence is at least about 16 nucleobases in length. In some embodiments, the base sequence is at least about 17 nucleobases in length. In some embodiments, the base sequence is at least about 18 nucleobases in length. In some embodiments, the base sequence is at least about 19 nucleobases in length. In some embodiments, the base sequence is at least about 20 nucleobases in length. In some embodiments, the base sequence is at least about 21 nucleobases in length. In some embodiments, the base sequence is at least about 22 nucleobases in length. In some embodiments, the base sequence is at least about 23 nucleobases in length. In some embodiments, the base sequence is at least about 24 nucleobases in length. In some embodiments, the base sequence is at least about 25 nucleobases in length. In some embodiments, the base sequence is about 15 nucleobases in length. In some embodiments, the base sequence is about 16 nucleobases in length. In some embodiments, the base sequence is about 17 nucleobases in length. In some embodiments, the base sequence is about 18 nucleobases in length. In some embodiments, the length of the base sequence is about 19 nucleobases. In some embodiments, the length of the base sequence is about 20 nucleobases. In some embodiments, the length of the base sequence is about 21 nucleobases. In some embodiments, the length of the base sequence is about 22 nucleobases. In some embodiments, the length of the base sequence is about 23 nucleobases. In some embodiments, the length of the base sequence is about 24 nucleobases. In some embodiments, the length of the base sequence is about 25 nucleobases. In some other embodiments, the length of the base sequence is about at least about 30 nucleobases. In some embodiments, each nucleobase independently comprises an optionally substituted monocycle, bicycle, or polycycle, wherein at least one ring atom is nitrogen.In some embodiments, each nucleobase is independently an optionally substituted adenine, cytosine, guanosine, thymine, or uracil, or an optionally substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.
[0154] Nucleobases
[0155] According to the present disclosure, various nucleobases can be used in the provided oligonucleotides. In some embodiments, the nucleobase is a natural nucleobase, most commonly A, T, C, G, and U. In some embodiments, the nucleobase is a modified nucleobase, because the nucleobase is not A, T, C, G, or U. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U or a substituted tautomer of A, T, C, G, or U. In some embodiments, the nucleobase is an optionally substituted A, T, C, G, or U, for example, 5mC, 5-hydroxymethyl C, etc. In some embodiments, the nucleobase is an alkyl-substituted A, T, C, G, or U. In some embodiments, the nucleobase is A. In some embodiments, the nucleobase is T. In some embodiments, the nucleobase is C. In some embodiments, the nucleobase is G. In some embodiments, the nucleobase is U. In some embodiments, the nucleobase is 5mC. In some embodiments, the nucleobase is a substituted A, T, C, G, or U. In certain embodiments, the core base is a substituted tautomer of A, T, C, G or U. In certain embodiments, certain functional groups in the core base are substituted to minimize the unwanted reaction in the oligonucleotide synthesis process. Suitable techniques for protecting the core base in the oligonucleotide synthesis are well known in the art and can be utilized according to the present disclosure. In certain embodiments, modified core base improves the characteristic and / or activity of the oligonucleotide. For example, in many cases, 5mC can be used to replace C to regulate some undesirable biological effects, for example, immune response. In certain embodiments, when determining sequence identity, the core base substituted with identical hydrogen bonding pattern is considered to be identical with unsubstituted core base, for example, 5mC can be considered to be identical with C [for example, replacing the oligonucleotide of C with 5mC (for example, AT5mCG) is considered to have identical base sequence with the oligonucleotide having C (for example, ATCG) at corresponding one or more positions].
[0156] In some embodiments, the oligonucleotide comprises one or more A, T, C, G or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G or U. In some embodiments, the oligonucleotide comprises one or more 5-methylcytosine (5mC), 5-hydroxymethylcytosine, 5-formylcytosine or 5-carboxylcytosine. In some embodiments, the oligonucleotide comprises one or more 5mC. In some embodiments, each core base in the oligonucleotide is independently selected from optionally substituted A, T, C, G and U and optionally substituted tautomers of A, T, C, G and U. In some embodiments, each core base in the oligonucleotide is independently optionally protected A, T, C, 5mC, G and U. In some embodiments, each core base in the oligonucleotide is optionally substituted A, T, C, G or U. In some embodiments, each core base in the oligonucleotide is selected from the group consisting of: A, T, C, G, U and 5mC.
[0157] In some embodiments, the nucleobase is an optionally substituted 2AP or DAP. In some embodiments, the nucleobase is an optionally substituted 2AP. In some embodiments, the nucleobase is an optionally substituted DAP. In some embodiments, the nucleobase is 2AP. In some embodiments, the nucleobase is DAP.
[0158] In some embodiments, the nucleobase is a natural nucleobase or a modified nucleobase derived from a natural nucleobase. Examples include uracil, thymine, adenine, cytosine and guanine, optionally with the corresponding amino group protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azocytosine, pyrimidine analogs (such as pseudoisocytosine and pseudouracil) and other modified nucleobases (such as 8-substituted purines, xanthine or hypoxanthine) (the latter two are natural degradation products). Certain examples of modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048; Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196 and Revankar and Rao, Comprehensive Natural Products Chemistry, Vol. 7, 313.
[0159] In some embodiments, the oligonucleotides provided include one or more 5-methylcytosines. In some embodiments, the present disclosure provides an oligonucleotide whose base sequence is disclosed herein, such as in Table 1, wherein each T can be independently replaced by U, and vice versa, and each cytosine is optionally and independently replaced by 5-methylcytosine, and vice versa. As will be appreciated by those skilled in the art, in some embodiments, 5mC can be regarded as a C related to the base sequence of the oligonucleotide-such oligonucleotides include a core base modification at the C position (e.g., referring to the various oligonucleotides in Table 1 or A2). When describing an oligonucleotide, unless otherwise indicated, the core base, sugar, and internucleotide bond are all unmodified.
[0160] In some embodiments, the modified nucleobase is known in the art, for example, the modified nucleobase in WO2017 / 210647. In some embodiments, the modified nucleobase is a nucleobase of enlarged size, wherein one or more aryl and / or heteroaryl rings, such as a phenyl ring, are added.
[0161] Nucleobases can be protected during oligonucleotide synthesis. Various protection techniques are available and can be utilized in accordance with the present disclosure.
[0162] In some embodiments, the modified nucleobase is a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl- or alkynyl-substituted pyrimidine, an alkyl-substituted purine, or an N-2, N-6, and O-6 substituted purine. In certain embodiments, the modified nucleobase is selected from the group consisting of 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3), uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza, and others. It includes 8-substituted purines, 5-halogeno, specifically 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 4-N-benzoyl5-methylcytosine, 4-N-benzoyl5-methyluracil, universal bases, hydrophobic bases, hybrid bases, bases of expanded size and fluorinated bases. In some embodiments, the modified nucleobase is a tricyclic pyrimidine, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenthiazine-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). In some embodiments, the modified nucleobase is a modified nucleobase in which a purine or pyrimidine base is replaced with another heterocycle, for example, 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, or 2-pyridone.
[0163] In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted such that the nucleobase contains, for example, a heteroatom, an alkyl group, or a linker moiety to a fluorescent moiety, a biotin or avidin moiety, or other protein or peptide. In some embodiments, the modified nucleobase is a "universal base," which is not a nucleobase in the most classical sense, but functions similarly to a nucleobase. An example of a universal base is 3-nitropyrrole.
[0164] In some embodiments, nucleosides useful in the provided technology comprise modified nucleobases and / or modified sugars, e.g., 4-acetylcytidine; 5-(carboxyhydroxymethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2'-O-methylpseudouridine; β,D-galactosylquinoline; 2'-O-methylguanosine; N 6 -Isopentenyl adenosine; 1-methyladenosine; 1-methylpseudouridine; 1-methylguanosine; 1-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N 7 -methylguanosine; 3-methylcytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxycytosine; N 6 -methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; β,D-mannoside quinoline; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N 6 -isopentenyladenosine; N-((9-β,D-ribofuranoyl-2-methylmercaptopurin-6-yl)carbamoyl)threonine; N-((9-β,D-ribofuranoylpurin-6-yl)-N-methylcarbamoyl)threonine; methyl uridine-5-oxoacetate; uridine-5-oxoacetic acid (v); pseudouridine; quinucleoside; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine; and 2'-O-methyluridine.
[0165] In some embodiments, the nucleobase (e.g., a modified nucleobase) comprises one or more biomolecule binding moieties, such as an antibody, antibody fragment, biotin, avidin, streptavidin, a receptor ligand, or a chelating moiety. In other embodiments, the nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase comprises a substitution with a fluorescent or biomolecule binding moiety. In some embodiments, the substituent is a fluorescent moiety. In some embodiments, the substituent is biotin or avidin.
[0166] In some embodiments, the nucleobase is US 9394333, US 9744183, US 9605019, US 9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US 2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the nucleobases of each of which are incorporated herein by reference.
[0167] sugar
[0168] In accordance with the present disclosure, various sugars, including modified sugars, can be used. In some embodiments, the present disclosure provides sugar modifications and patterns thereof, optionally used in conjunction with other structural elements (e.g., nucleobase modifications and patterns thereof, internucleotide linkage modifications and patterns thereof, etc.), that can provide improved properties and / or activity when incorporated into oligonucleotides.
[0169] The most common naturally occurring nucleosides comprise a ribose sugar (e.g., in RNA) or a deoxyribose sugar (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, the sugar, e.g., the various sugars in many of the oligonucleotides in Table 1 (unless otherwise indicated), is a natural DNA sugar (in a DNA nucleic acid or oligonucleotide, having In some embodiments, the sugar is a natural RNA sugar (in an RNA nucleic acid or oligonucleotide, having In some embodiments, the sugar is a modified sugar in that the sugar is not a native DNA sugar or a native RNA sugar. Modified sugars can provide improved stability and / or affinity, among other things. In some embodiments, modified sugars can be used to alter and / or optimize one or more hybridization properties. In some embodiments, modified sugars can be used to alter and / or optimize target recognition. In some embodiments, modified sugars can be used to optimize Tm. In some embodiments, modified sugars can be used to improve oligonucleotide activity.
[0170] Sugars can be bonded to the internucleotide linkage at various positions. As non-limiting examples, the internucleotide linkage can be bonded to the 2', 3', 4', or 5' position of the sugar. As is common in natural nucleic acids, unless otherwise indicated, the internucleotide linkage is typically linked to one sugar at the 5' position and to another sugar at the 3' position.
[0171] In some embodiments, the sugar is an optionally substituted natural DNA or RNA sugar. In some embodiments, the sugar is an optionally substituted In some embodiments, the 2' position is optionally substituted. In some embodiments, the sugar is In some embodiments, the sugar has The structure of R 1s 、R 2s 、R 3s 、R 4s and R 5swherein each of the following is independently -H, a suitable substituent or a suitable sugar modification (e.g., US 9394333, US9744183, US 9605019, US 9982257, US20170037399, US20180216108, US20180216107, US9598458, WO 2017 / 062862, WO 2018 / 067973, WO 2017 / 160741, WO 2017 / 192679, WO 2017 / 210647, WO 2018 / 098264, WO 2018 / 022473, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 032612, WO 2019 / 055951 and / or WO 2019 / 075357, the substituents, sugar modifications, R 1s 、R 2s 、R 3s 、R 4s and R 5s The descriptions of and modified sugars are independently incorporated herein by reference). In some embodiments, R 1s 、R 2s 、R 3s 、R 4s and R 5s Each of the following is independently -F, -Cl, -Br, -I, -CN, -N3, -NO, -NO2, -L s -R', -L s -OR', -L s -SR', -L s -N(R')2、-OL s -OR'、-OL s -SR' or -OL s- N(R')2, wherein each R' is independently -H or selected from C 1-10 Aliphatic, C 6-14 Aryl, C with 1-5 heteroatoms 1-10 an optionally substituted group of heteroaliphatic, 5- to 10-membered heteroaryl having 1-5 heteroatoms, and 3- to 10-membered heterocyclyl having 1-4 heteroatoms, or two or more R' groups taken together with their middle atom to form an optionally substituted 3- to 10-membered ring having 0-5 heteroatoms in addition to the middle atom. Independently as described herein, and L s is a covalent bond or an optionally substituted divalent C 1-6In some embodiments, the sugar has In some embodiments, R 4s is -H. In some embodiments, the sugar has The structure of R 2s is -H, halogen or -OR, wherein R is optionally substituted C 1-6 In some embodiments, R 2s is -H. In some embodiments, R 2s In some embodiments, R 2s In some embodiments, R 2s It is -OCH2CH2OMe.
[0172] In some embodiments, the sugar has The structure of R 2s and R 4s Together they form -L s -, where L s is a covalent bond or an optionally substituted divalent C 1-6 aliphatic or heteroaliphatic. In some embodiments, each heteroatom is independently selected from nitrogen, oxygen, or sulfur. In some embodiments, L s is optionally substituted C2-O-CH2-C4. In some embodiments, L s is C2-O-CH2-C4. In some embodiments, L s is C2-O-(R)-CH(CH2CH3)-C4. In some embodiments, L s It is C2-O-(S)-CH(CH2CH3)-C4.
[0173] In some embodiments, the modified sugar contains one or more substituents at the 2' position (usually one substituent, and typically located in an axial position or R 2s ), the substituents are independently selected from -F; -CF3, -CN, -N3, -NO, -NO2, -OR', -SR' or -N(R')2, wherein each R' is independently described in this disclosure, and in some embodiments, the optionally substituted C 1-10 Aliphatic; -O-(C1-C 10 Alkyl), -S-(C1-C 10 Alkyl), -NH-(C1-C 10 Alkyl) or -N(C1-C 10 Alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl) or -N(C2-C10 alkenyl)2;-O-(C2-C 10 Alkynyl), -S-(C2-C 10 Alkynyl), -NH-(C2-C 10 Alkynyl) or -N(C2-C 10 Alkynyl)2; or -O-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl), -O-(C1-C 10 Alkylene)-NH-(C1-C 10 Alkyl) or -O-(C1-C 10 Alkylene)-NH(C1-C 10 Alkyl)2, -NH-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl) or -N(C1-C 10 alkyl)-(C1-C 10 Alkylene)-O-(C1-C 10 alkyl), wherein each of alkyl, alkylene, alkenyl, and alkynyl is independently and optionally substituted. In some embodiments, the substituent is -O(CH2) n OCH3, -O(CH2) n NH2, MOE, DMAOE or DMAEOE, wherein n is 1 to about 10.
[0174] In some embodiments, the modified sugar is a natural RNA sugar whose 2'-OH is replaced by a group selected from: -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2, wherein each R' is independently described in this disclosure; -O-(C1-C 10 Alkyl), -S-(C1-C 10 Alkyl), -NH-(C1-C 10 Alkyl) or -N(C1-C 10 Alkyl)2;-O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl) or -N(C2-C 10 alkenyl)2;-O-(C2-C 10 Alkynyl), -S-(C2-C 10 Alkynyl), -NH-(C2-C 10 Alkynyl) or -N(C2-C 10 Alkynyl)2; or -O-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl), -O-(C1-C10 Alkylene)-NH-(C1-C 10 Alkyl) or -O-(C1-C 10 Alkylene)-NH(C1-C 10 Alkyl)2, -NH-(C1-C 10 Alkylene)-O-(C1-C 10 Alkyl) or -N(C1-C 10 alkyl)-(C1-C 10 Alkylene)-O-(C1-C 10 alkyl), wherein each of alkyl, alkylene, alkenyl, and alkynyl is independently and optionally substituted. In some embodiments, 2'-OH is replaced by -H (deoxyribose). In some embodiments, 2'-OH is replaced by -F. In some embodiments, 2'-OH is replaced by -OR'. In some embodiments, 2'-OH is replaced by -OMe. In some embodiments, 2'-OH is replaced by -OCH2CH2OMe.
[0175] In some embodiments, the sugar modification is a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s In some embodiments, R s is an optionally substituted C 1-4 In some embodiments, R s is an optionally substituted C 1-6 In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is an LNA sugar. In some embodiments, the 2'-modification is -F.
[0176] In some embodiments, the sugar modification is the replacement of a sugar moiety with another cyclic or acyclic moiety. Examples of such moieties are well known in the art, e.g., such moieties in morpholinos, glycol nucleic acids, PNAs, etc., and can be utilized in accordance with the present disclosure.
[0177] In some embodiments, one or more sugars of an oligonucleotide are independently modified. In some embodiments, each sugar of an oligonucleotide or a portion thereof (e.g., a wing) is independently modified. In some embodiments, the modified sugar comprises a 2'-modification. In some embodiments, each modified sugar independently comprises a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s , where R s is an optionally substituted C 1-6In some embodiments, the 2'-modification is a 2'-OMe modification. In some embodiments, the 2'-modification is a 2'-MOE modification. In some embodiments, the 2'-modification is an LNA sugar modification. In some embodiments, the 2'-modification is a 2'-F. In some embodiments, each sugar modification is independently a 2'-modification. In some embodiments, each sugar modification is independently a 2'-OR s In some embodiments, each sugar modification is independently 2'-OR s , where R s is an optionally substituted C 1-6 In some embodiments, each sugar modification is 2'-OMe. In some embodiments, each sugar modification is 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe or 2'-MOE. In some embodiments, each sugar modification is independently 2'-OMe, 2'-MOE, or an LNA sugar.
[0178] As will be appreciated by those skilled in the art, modifications of sugars, nucleobases, internucleotide linkages, etc. can be, and often are, used in combination in oligonucleotides, for example, see the various oligonucleotides in Table 1.
[0179] In some embodiments, the sugar is US 9394333, US 9744183, US 9605019, US 9598458, US9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US 2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the sugars of each of which are incorporated herein by reference.
[0180] A variety of additional sugars that can be used to prepare oligonucleotides or analogs thereof are known in the art and can be utilized in accordance with the present disclosure.
[0181] internucleotide bonds
[0182] In some embodiments, the oligonucleotide comprises base modifications, sugar modifications, and / or internucleotide bond modifications. Various internucleotide bonds can be utilized in accordance with the present disclosure to connect units comprising nucleobases, such as nucleosides. In some embodiments, the oligonucleotide comprises both one or more modified internucleotide bonds and one or more natural phosphate bonds. As is well known to those skilled in the art, natural phosphate bonds are widely present in natural DNA and RNA molecules; the structure of the natural phosphate bond is -OP(O)(OH)O-, which connects the sugars in the nucleosides in DNA and RNA, and can exist in various salt forms, for example, at physiological pH (about 7.4), the natural phosphate bond exists primarily in salt form, with the anion being -OP(O)(OH)O-. - )O-. A modified internucleotide bond or non-natural phosphate bond is an internucleotide bond that is not a natural phosphate bond or its salt form. A modified internucleotide bond may also exist in the form of a salt thereof, depending on its structure. For example, as is known to those skilled in the art, a phosphorothioate internucleotide bond having the structure -OP(O)(SH)O- may exist in various salt forms, for example, at physiological pH (about 7.4), the anion is -OP(O)(SH)O-. - )O-.
[0183] In some embodiments, the oligonucleotide comprises an internucleotide linkage that is a modified internucleotide linkage, e.g., phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-phosphorothioate, or 5'-phosphorothioate.
[0184] In some embodiments, the internucleotide linkage is described in US 9394333, US 9744183, US 9605019, US9598458, US 9982257, US10160969, US10479995, US2020 / 0056173, US2018 / 0216107, US2019 / 0127733, US10450568, US2019 / 0077817, US2019 / 0249173, US2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the internucleotide bonds of each of which are incorporated herein by reference.In some embodiments, internucleotide linkages are described in U.S. Pat. Nos. 3,687,808, 4,469,863, 4,476,301, 5,177,195, 5,023,243, 5,034,506, 5,166,315, 5,185,444, 5,188,897, 5,214,134, 5,216,141, 5,235,033, 5,264,423, 5,264,564, 5,276,019, 5,278,302, 5,286,717, 5,185,444, 5,188,897, 5,214,134, 5,216,141, 5,235,033, 5,264,423, 5,264,564, 5,276,019, 5,278,302, 5,286,717, 5,185,444, 5,188,897, No. 5321131, No. 5399676, No. 5405938, No. 5405939, No. 5434257, No. 5453496, No. 5455233, No. 5466677, No. 5466677, No. 5470967, No. 5476925, No. 5489677, No. 5519126, No. 5536821, No. 5541307, No. 5541316, No. 5550111, No. 5561225, No. 5563253, No. 5 No. 571799, No. 5587361, No. 5596086, No. 5602240, No. 5608046, No. 5610289, No. 5618704, No. 5623070, No. 5625050, No. 5633360, No. 564562, No. 5663312, No. 5677437, No. 5677439, No. 6160109, No. 6239265, No. 6028188, No. 6124445, No. 6169170, No. 617 No. 2209, 6277603, 6326199, 6346614, 6444423, 6531590, 6534639, 6608035, 6683167, 6858715, 6867294, 6878805, 7015315, 7041816, 7273933, 7321029, or RE39464, the internucleotide bonds of each of which are incorporated herein by reference.
[0185] In certain embodiments, the oligonucleotide comprises one or more modified internucleotide bonds. In certain embodiments, each modified internucleotide bond is independently a thiophosphate internucleotide bond. In certain embodiments, one or more of all internucleotide bonds in the oligonucleotide, for example, about 1-20, 1-15, 1-10 or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or about 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more are independently thiophosphate internucleotide bonds. In certain embodiments, about 10% or more of all internucleotide bonds are independently thiophosphate internucleotide bonds. In certain embodiments, about 25% or more of all internucleotide bonds are independently thiophosphate internucleotide bonds. In some embodiments, about 50% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 60% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 70% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 75% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 80% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 85% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 90% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, about 95% or more of all internucleotide bonds are independently phosphorothioate internucleotide bonds. In some embodiments, each internucleotide bond bonded to a natural DNA sugar is independently a phosphorothioate internucleotide bond. In some embodiments, each internucleotide bond in an oligonucleotide is independently a phosphorothioate internucleotide bond.
[0186] In some embodiments, the oligonucleotide comprises one or more natural phosphate bonds. In some embodiments, each natural phosphate bond is independently bonded to at least one modified sugar. In some embodiments, each sugar bonded to a natural phosphate bond is independently a modified sugar. In some embodiments, each sugar bonded to a natural phosphate bond is independently a modified sugar. s Modified sugars or bicyclic sugars (eg, LNA sugars). In some embodiments, each sugar bonded to a natural phosphate ester bond is independently 2'-OR s Modified Sugars. In some embodiments, each sugar bonded to a native phosphate linkage is independently a 2'-MOE modified sugar.
[0187] Wings and core
[0188] In some embodiments, the oligonucleotide comprises or consists of a 5'-Wing-Core-Wing-3' structure.
[0189] Wings and cores can independently have various suitable lengths. In certain embodiments, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more core bases are independently present in a wing or core. In certain embodiments, each core base independently comprises an optionally substituted monocycle, bicycle or polycycle having at least one nitrogen ring atom; In certain embodiments, each core base independently comprises an optionally substituted A, T, C, G or U or a substituted tautomer of A, T, C, G or U. In certain embodiments, the number of core bases in a wing is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In certain embodiments, the number for a wing is 1. In certain embodiments, the number for a wing is 2. In certain embodiments, the number for a wing is 3. In certain embodiments, the number for a wing is 4. In certain embodiments, the number for a wing is 5. In certain embodiments, the number for a wing is 6. In some embodiments, the number of wings is 7. In some embodiments, the number of wings is 8. In some embodiments, the number of wings is 9. In some embodiments, the number of wings is 10. In some embodiments, in the wings of the wing-core-wing structure, the two wings have the same length. In some embodiments, the two wings have different lengths. In some embodiments, the number of cores is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more. In some embodiments, the number of cores is about 5-15, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. In some embodiments, the number of cores is 1. In some embodiments, the number of cores is 2. In some embodiments, the number of cores is 3. In some embodiments, the number of cores is 4. In some embodiments, the number of cores is 5. In some embodiments, the number of cores is 6. In some embodiments, the number of cores is 7. In some embodiments, the number of cores is 8. In some embodiments, the number of cores is 9. In some embodiments, the number of cores is 10. In some embodiments, the number of cores is 11. In some embodiments, the number of cores is 12. In some embodiments, the number of cores is 13. In some embodiments, the number of cores is 14. In some embodiments, the number of cores is 15.
[0190] In some embodiments, wing-core-wing is described as "XYZ", wherein "X" represents the length of the 5' wing (as the number of core bases), "Y" represents the length of the core (as the number of core bases), and "Z" represents the length of the 3' wing (as the number of core bases). Example embodiments of X, Y and Z include lengths described as numbers (e.g., above) and illustrated in oligonucleotide species (e.g., Table 1). In some embodiments, the two wings have the same or different lengths and / or have the same or different modifications or modification patterns. In some embodiments, Y is 8 to 15. In some embodiments, X, Y or Z can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more. In some embodiments, each of X, Y and Z is independently 1-30. In some embodiments, XZZ is 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4, or 4-7-4.
[0191] In some embodiments, the wing comprises one or more sugar modifications. In some embodiments, each sugar in the wing is independently modified. In some embodiments, each wing sugar in the oligonucleotide is independently modified. In some embodiments, each modified sugar independently comprises a 2'-modification (e.g., a 2'-OR s In some embodiments, each wing sugar is independently 2'-OR s In some embodiments, each sugar modification in the wing is the same. In some embodiments, the wing comprises different sugar modifications, such as different 2'-OR s In some embodiments, 2'-OR s In some embodiments, 2'-OR s In some embodiments, each saccharide in the wing is a 2'-MOE modified saccharide. In some embodiments, each saccharide in the wing is a 2'-OMe modified saccharide. In some embodiments, the wing comprises one or more 2'-OMe modified saccharides and one or more 2'-MOE modified saccharides.
[0192] In some embodiments, the two wings in the wing-core-wing structure comprise different sugar modifications or patterns thereof.
[0193] In some embodiments, certain sugar modifications (eg, 2'-MOE) provide greater stability under certain conditions than other sugar modifications (eg, 2'-OMe or native DNA or RNA sugars).
[0194] In some embodiments, the wing comprises a bicyclic sugar. In some embodiments, the bicyclic sugar is an LNA, cEt, or BNA sugar.
[0195] In some embodiments, one or more internucleotide bonds bonded to the 5'-wing sugar are each independently a modified internucleotide bond. In some embodiments, the internucleotide bonds are each independently a phosphorothioate internucleotide bond. In some embodiments, each internucleotide bond bonded to the 5'-wing sugar is independently a modified internucleotide bond. In some embodiments, each such internucleotide bond is independently a phosphorothioate internucleotide bond.
[0196] In some embodiments, one or more internucleotide bonds bonded to the 3'-wing sugar are each independently a modified internucleotide bond. In some embodiments, the internucleotide bonds are each independently a phosphorothioate internucleotide bond. In some embodiments, each internucleotide bond bonded to the 3'-wing sugar is independently a modified internucleotide bond. In some embodiments, each such internucleotide bond is independently a phosphorothioate internucleotide bond.
[0197] In some embodiments, the core comprises one or more, e.g., about 1-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, or 5-15, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, natural DNA sugars. In some embodiments, the core comprises 2 or more natural DNA sugars. In some embodiments, the core comprises 3 or more natural DNA sugars. In some embodiments, the core comprises 4 or more natural DNA sugars. In some embodiments, the core comprises 5 or more natural DNA sugars. In some embodiments, the core comprises 6 or more natural DNA sugars. In some embodiments, the core comprises 7 or more natural DNA sugars. In some embodiments, the core comprises 8 or more natural DNA sugars. In some embodiments, the core comprises 9 or more natural DNA sugars. In some embodiments, the core comprises 10 or more natural DNA sugars. In some embodiments, the core comprises 11 or more natural DNA sugars. In some embodiments, the core comprises 12 or more natural DNA sugars. In some embodiments, the core comprises 13 or more natural DNA sugars. In some embodiments, the core comprises 14 or more natural DNA sugars. In some embodiments, the core comprises 15 or more natural DNA sugars. In some embodiments, such DNA sugars are continuous. In some embodiments, each sugar in the core is independently a natural DNA sugar.
[0198] In certain embodiments, the bond between one or more nucleotides bonded to the ribose is each independently a modified bond between the nucleotides. In certain embodiments, the bond between the nucleotides is each independently a bond between phosphorothioate nucleotides. In certain embodiments, the bond between each nucleotide bonded to the ribose is independently a modified bond between the nucleotides. In certain embodiments, the bond between each such nucleotide is independently a bond between phosphorothioate nucleotides.
[0199] In some embodiments, the core is capable of hybridizing to a target mRNA, thereby forming a duplex structure that can be recognized by RNase H, allowing the RNase H to cleave the mRNA.
[0200] Oligonucleotides
[0201] Among other things, the present disclosure also provides various oligonucleotides. As described herein, oligonucleotides can include various core base modifications, sugar modifications, internucleotide bonds and patterns thereof. In certain embodiments, the present disclosure provides the oligonucleotides in Table 1 as examples.
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208] Note: unless otherwise indicated, oligonucleotides are described from 5' to 3'. As will be appreciated by those skilled in the art, the 5' and 3' positions of the internucleotide bond linking sugars. Unless otherwise indicated (e.g., by "*" indicating a phosphorothioate internucleotide bond), the internucleotide bond is a natural phosphate bond. Unless otherwise indicated, each of A, T, C, and G is independently deoxyadenosine, thymidine, deoxycytidine, and deoxyguanosine (e.g., as commonly found in natural DNA). "2MOEr" indicates a 2'-MOE modification to sugar; "5" indicates that the nucleoside has a 5'-OH group (e.g., when located at the 5'-end of the oligonucleotide); "3" indicates that the nucleoside has a 3'-OH group (e.g., when located at the 3'-end of the oligonucleotide); "i" indicates that the nucleoside is located in the middle of the oligonucleotide, and its 5'- and 3'-positions are bonded to the indicated internucleotide bond; "Me-dC" indicates 5-methyl-2'-deoxycytidine nucleoside. As will be appreciated by those skilled in the art, oligonucleotides may exist in various forms including various salt forms.
[0209] / 52MOErA / is
[0210] / 52MOErT / is
[0211] / 52MOErC / is
[0212] / 52MOErG / is
[0213] * is -OP(O)(SH)-O-;
[0214] / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is
[0215] / 32MOErA / is
[0216] / 32MOErT / is
[0217] / 32MOErC / is and
[0218] / 32MOErG / is
[0219] In some embodiments, the oligonucleotides provided are capable of hybridizing to a SARM1 transcript. In some embodiments, the oligonucleotides provided can reduce the level of a SARM1 transcript or its product. In some embodiments, the oligonucleotides provided can reduce the level of SARM1 mRNA. In some embodiments, the oligonucleotides provided can reduce the level of a SARM1 polypeptide. In some embodiments, the oligonucleotides provided can reduce the activity level of a SARM1 polypeptide observed in a system (e.g., a sample, a subject, etc.). In some embodiments, the oligonucleotides are selected from Table 1. In some embodiments, the oligonucleotides are pharmaceutically acceptable salts of the oligonucleotides selected from Table 1.
[0220] In some embodiments, the present disclosure provides oligonucleotides that are particularly effective in reducing the level of SARM1 transcript, polypeptide and / or activity.
[0221] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / or a salt thereof.
[0222] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0223] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0224] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / or a salt thereof.
[0225] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0226] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / or a salt thereof.
[0227] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / or a salt thereof.
[0228] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / or a salt thereof.
[0229] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0230] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0231] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0232] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0233] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0234] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0235] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0236] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0237] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0238] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0239] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / or a salt thereof.
[0240] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0241] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0242] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0243] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0244] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / or a salt thereof.
[0245] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0246] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0247] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0248] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / or a salt thereof.
[0249] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0250] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0251] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0252] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0253] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / or a salt thereof.
[0254] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0255] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0256] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0257] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0258] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / iMe-dC / *A* / iMe-dC / *T*T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0259] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0260] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / or a salt thereof.
[0261] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0262] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0263] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0264] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0265] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0266] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / or a salt thereof.
[0267] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0268] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0269] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / or a salt thereof.
[0270] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0271] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0272] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0273] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0274] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0275] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *A*T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0276] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / iMe-dC / *A*G*A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / or a salt thereof.
[0277] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*A*A* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0278] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0279] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / iMe-dC / *T* / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0280] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*G*A*T*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0281] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*A*T*G* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0282] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0283] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / iMe-dC / * / iMe-dC / *T*G*T* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0284] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / iMe-dC / *A*G*T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0285] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / or a salt thereof.
[0286] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0287] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / iMe-dC / *A*A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / or a salt thereof.
[0288] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / iMe-dC / *A* / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOErA / or a salt thereof.
[0289] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / iMe-dC / *A*G*A*G*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0290] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*A*A* / iMe-dC / *A*G*G*A* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0291] In some embodiments, the oligonucleotide has the structure of / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / or a salt thereof.
[0292] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / *A* / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / or a salt thereof.
[0293] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0294] In some embodiments, the oligonucleotide has the structure of / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0295] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0296] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / or a salt thereof.
[0297] In some embodiments, the oligonucleotide has the structure of / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / or a salt thereof.
[0298] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0299] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / or a salt thereof.
[0300] In some embodiments, the oligonucleotide has the structure of / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0301] In some embodiments, the present disclosure provides compositions comprising the provided oligonucleotides. In some embodiments, the oligonucleotide compositions comprise the provided oligonucleotides or their salts, and various diastereomers and their salts. In some embodiments, the oligonucleotide compositions comprise the provided oligonucleotides or their salts, and various diastereomers and their salts relative to the chiral bond phosphorus. In some embodiments, the oligonucleotides may exist in one or more forms. In some embodiments, the oligonucleotides in the composition exist in salt form. In some embodiments, the oligonucleotides in the composition exist in one or more salt forms. In some embodiments, the salt form is a pharmaceutically acceptable salt form. In some embodiments, the salt form is a metal salt. In some embodiments, the salt form is an alkali metal salt. In some embodiments, the salt form is a sodium salt. In some embodiments, the salt form is a potassium salt. In some embodiments, the salt form is a calcium salt. In some embodiments, the salt form is an ammonium salt form (e.g., an ammonium salt form of N(R')3, wherein R' is as described herein; in some embodiments, each R' is independently -H or an optionally substituted C 1-6 In some embodiments, the oligonucleotide composition is a liquid composition wherein the oligonucleotide is dissolved in a solution. In some embodiments, the solution is a buffer. In some embodiments, the solution is a buffered saline. In some embodiments, in the composition, acidic internucleotide bonds (e.g., natural phosphate bonds, phosphorothioate internucleotide bonds, etc.) exist independently as anions, and the composition comprises one or more types of cations, e.g., Na + , K + wait.
[0302] Additional chemistry section
[0303] In certain embodiments, oligonucleotide comprises one or more other chemical moieties.Various other chemical moieties (for example, targeting moiety, carbohydrate moiety, lipid moiety etc.) are known in the art, and can be used to regulate characteristic and / or the activity of oligonucleotide according to present disclosure, for example, stability, half-life, activity, sending, pharmacodynamic properties, pharmacokinetic properties etc. In certain embodiments, some other chemical moiety helps oligonucleotide to be delivered to required cell, tissue and / or organ, includes but not limited to the cell of central nervous system. In certain embodiments, some other chemical moiety helps the internalization of oligonucleotide. In certain embodiments, some other chemical moiety increases oligonucleotide stability. In certain embodiments, present disclosure provides the technology for various other chemical moieties to be incorporated into oligonucleotide.
[0304] Some useful additional chemical moieties are described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO 2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 and / or WO 2019 / 032612, the additional chemical portions of each of which are incorporated herein by reference.
[0305] preparation
[0306] The various technologies of the oligonucleotide provided by preparation are available in this area and can be utilized according to the present disclosure.For example, in certain embodiments, oligonucleotide uses phosphoramidite to prepare on a solid support.In certain embodiments, oligonucleotide is prepared in solution.In certain embodiments, the preparation of oligonucleotide comprises multiple circulations, and in each in the circulation, adds one or more nucleoside units, is typically a nucleoside unit.In certain embodiments, circulation comprises the coupling of phosphoramidite, blocks unreacted 5'-OH group, modifies (for example, sulfurization) and / or goes to block the protected 5'-OH group in the new coupling nucleoside.In certain embodiments, when oligonucleotide reaches certain length, can modify at the end of circulation.
[0307] Certain techniques for preparing oligonucleotides are described in US 3687808, US 4469863, US 4476301, US5177195, US 5023243, US 5034506, US 5166315, US 5185444, US 5188897, US 5214134, US5216141, US 5235033, US 5264423, US 5264564, US 5276019, US 5278302, US 5286717, US5321131, US 5399676, US 5405938, US 5405939, US 5434257, US 5453496, US 5455233, US5466677, US 5466677, US 5470967, US 5476925, US 5489677, US 5519126, US 5536821, US5541307, US 5541316, US 5550111, US 5561225, US 5563253, US 5571799, US 5587361, US5596086, US 5602240, US 5608046, US 5610289, US 5618704, US 5623070, US 5625050, US5633360, US 564562, US 5663312, US 5677437, US 5677439, US 6160109, US 6239265, US6028188, US 6124445, US 6169170, US 6172209, US 6277603, US 6326199, US 6346614, US6444423, US 6531590, US 6534639, US 6608035, US 6683167, US 6858715, US 6867294, US6878805, US 7015315, US 7041816, US 7273933, US 7321029, US RE39464, US 9394333, US9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020 / 0056173, US 2018 / 0216107, US 2019 / 0127733, US 10450568, US 2019 / 0077817, US 2019 / 0249173, US 2019 / 0375774, WO 2018 / 223056, WO2018 / 223073, WO 2018 / 223081, WO 2018 / 237194, WO 2019 / 032607, WO 2019 / 055951, WO 2019 / 075357, WO 2019 / 200185, WO 2019 / 217784 or WO 2019 / 032612.
[0308] In some embodiments, the oligonucleotides and / or compositions are provided as stereorandom compositions relative to the chiral bond phosphorus. For example, when oligonucleotide synthesis is performed using conventional phosphoramidites containing N,N-diisopropylamino and 2-cyanoethyloxy groups, chiral bonds may be formed that are nonstereoselective or have low stereoselectivity. In some embodiments, the oligonucleotides are provided as mixtures of various diastereomers and / or their salts. In some embodiments, the composition comprises one or more, or all, of the oligonucleotides and / or their diastereomers relative to the chiral bond phosphorus. In some embodiments, the oligonucleotides and / or their diastereomers are independently present in one or more forms. In some embodiments, the oligonucleotides and / or their diastereomers are independently present in one or more salt forms, e.g., one or more pharmaceutically acceptable salt forms. In some embodiments, for each chiral bond phosphorus, both the Rp and Sp configurations are present in the composition. In some embodiments, for each chiral bond phosphorus, the percentage of both the Rp and Sp configurations is at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 45%. In some embodiments, for the bond between chiral nucleotides, the percentage of both Rp and Sp configurations is about 50%. In some embodiments, for the bond between each chiral nucleotide, the percentage of both Rp and Sp configurations is about 50%. In some embodiments, for the bond between each chiral nucleotide, the percentage of both Rp and Sp configurations is about 20-80%. In some embodiments, for the bond between each chiral nucleotide, the percentage of both Rp and Sp configurations is about 30-70%. In some embodiments, for the bond between each chiral nucleotide, the percentage of both Rp and Sp configurations is about 40-60%. In some embodiments, for the bond between each chiral nucleotide, the percentage of both Rp and Sp configurations is about 45-55%. In some embodiments, for each bond phosphorus, the percentage of Rp configuration is independently about 20-80%, 30-70%, 40-60% or 45-55% or about 20%, 30%, 40%, 50%, 60%, 70% or 80%.
[0309] The amount, concentration, etc. of the oligonucleotides provided can be estimated using various techniques according to the present disclosure, for example, by UV (e.g., at 260 nm), weight, etc. In some embodiments, the amount, concentration, etc. of all oligonucleotides present in the composition are estimated. In some embodiments, the amount, concentration, etc. include all oligonucleotides having the same structure (e.g., diastereomers with respect to the chiral bond phosphorus), including all forms thereof, including pharmaceutically acceptable salt forms.
[0310] SARM1
[0311] In some embodiments, SARM1 refers to a gene or its gene product (e.g., nucleic acid (e.g., DNA, RNA, etc.), transcript (e.g., SARM1 mRNA), protein encoded thereby (e.g., SARM1 polypeptide), etc.) from a species, which may be referred to as SARM2, NAD(+) hydrolase SARM1, NADP(+) hydrolase SARM1, NADase SARM1, sterile alpha and armadillo repeat protein, sterile alpha and TIR motif-containing protein 1, SAMD2, MyD88-5, SAM domain-containing protein 2, sterile alpha motif domain-containing protein 2, HsTIR, etc. Various SARM1 sequences, including variants thereof, are readily available to those skilled in the art. Various techniques (e.g., assays, cells, animal models, etc.) have also been reported and can be used to characterize and / or evaluate the technology (e.g., oligonucleotides, compositions, methods, etc.) provided in accordance with the present disclosure.
[0312] The SARM1 gene is reported to encode the SARM1 protein, which, depending on the isoform, comprises either 724 or 690 amino acids (depending on the isoform) and is primarily localized in the cytoplasm and mitochondria. Some studies have also suggested that SARM1 may be localized in the axons, dendrites, and / or synapses of neuronal cells. It has been reported that, in some embodiments, SARM1 comprises multiple domains from the N-terminal to the C-terminal regions, including the following: (i) a mitochondrial targeting region; (ii) an armadillo repeat (ARM) domain; (iii) a first sterile alpha motif (SAM) domain; (iv) a second sterile alpha motif (SAM) domain; and (v) a toll / interleukin-1 (IL-1) receptor (TIR) domain. SARM1 from other species (e.g., monkey, rat, and mouse) has been reported to contain various conserved domains similar to those of human SAR1.
[0313] SARM1 protein is reported to be a nicotinamide adenine dinucleotide (NAD +) into nicotinamide (NAM) and adenosine diphosphate ribose (ADPR) and cyclic adenosine diphosphate ribose (cADPR) (Essuman et al., Neuron, 2017). In addition, homodimerization of SARM1 has been reported to enhance this enzymatic activity (Gerdts et al., J Neurosci., 2013; Summer et al., Proc Natl Acad Sci USA, 2016). Some studies suggest that neuronal stress or injury may upregulate SARM1 activity by allowing this dimerization to occur by disengaging from the inhibition exerted by the ARM domain (Loring and Thompson, Cell Chem Biol., 2020). SARM1 has been reported to be associated with the presence and function of nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2), an enzyme that has been described as neuroprotective and reported to function to maintain low levels of nicotinamide mononucleotide (NMN) and relatively high levels of NAD + (Figley et al., Neuron, 2021).
[0314] The putative NADase activity of SARM1 is thought to be mediated by depletion of NAD + This can lead to cell death and / or axonal degeneration and / or trigger signaling cascades by increasing ADPR and cADPR (Loring and Thompson, Cell Chemical Biol, 2020). SARM1 knockdown and / or deletion has been reported to be neuroprotective by preventing axonal degeneration and / or inhibiting Wallerian degeneration induced by NMNAT2 depletion or deficiency (Gilley et al., Cell Rep., 2015; Gilley et al., Cell Reports, 2017). Several studies have also detailed in vivo prevention of peripheral neuropathy or retinal degeneration by SARM1 knockout, further confirming the potential neuroprotective role of SARM1 downregulation (Geisler et al., Brain, 2016; Finnegan et al., Int J Mol Sci, 2022).
[0315] In some embodiments, the SARM1 gene, transcript (e.g., mRNA before or after splicing), or protein variant or isoform comprises a mutation (in some embodiments, the mutation may be referred to or reported as a SNP). SARM1 mutations have been reported to be enriched in subjects with ALS (Bloom et al., Mol Neurodegener, 2022). Among these mutations, some have been reported to produce constitutively active SARM1 proteins. In some embodiments, the mutation is rs782325355, rs71373646, rs71373646, rs11652384, rs1555585331, rs781854217, rs782421919, rs782331635, rs1032963037, rs1449836804, rs1555585243, rs376587698, rs369186722, rs373458416, rs782706244, rs1555585662, rs1555585331 5804, rs377210302, rs1555585809, rs782228906, rs782106973, rs571724138, rs539229444, rs782196205, rs782398426, rs782321764, rs782753946, rs1451417529, rs782676389, rs782225125, rs782774927, rs782256561, rs372946020, and / or rs781850558. In some embodiments, the mutations are Δ226-232, Δ249-252, V184G, G206S, L223P, R267W, V331E, E340K, C482Y, T385A, T502P, E693D, V112I, A240E, R244S, A250T, A275V, R310H, A341V, R403 In some embodiments, the oligonucleotides target wild-type and mutant SARM1. ...In some embodiments, the base sequence of the oligonucleotide is complementary to a characteristic portion shared by various forms of SARM1 transcripts, for example, in some embodiments, all forms of SARM1 transcripts in a subject. In some embodiments, the provided technology can selectively reduce the level of SARM1 transcripts associated with a condition, disorder, or disease. In some embodiments, the provided technology can selectively reduce the level of mutant SARM1 transcripts and / or products encoded therefrom (e.g., polypeptides). Among other things, the present disclosure also encompasses the recognition that the overall level of SARM1 transcripts (e.g., both wild-type and mutant) and / or products encoded therefrom (e.g., polypeptides) is reduced in various conditions, disorders, or diseases, and provides technologies for reducing the overall level of SARM1 transcripts and / or products encoded therefrom (e.g., polypeptides).
[0316] Conditions, disorders or diseases associated with SARM1
[0317] Various conditions, disorders or diseases have been reported to be associated with SARM1 and can be prevented or treated using the present disclosure. Generally, if the presence, level, activity and / or form of SARM1 and / or its products (e.g., transcripts, encoded proteins, etc.) are correlated with the incidence and / or susceptibility of the disease, disorder or condition (e.g., in a relevant population), then the disease, disorder or condition is associated with SARM1. In some embodiments, conditions, disorders or diseases associated with SARM1 can be treated and / or prevented by reducing the expression, level and / or activity of SARM1 transcripts and / or proteins.
[0318] Among other things, the present disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases. In some embodiments, the condition, disorder, or disease is a neurodegenerative disease. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is traumatic brain injury (TBI). In some embodiments, the condition, disorder, or disease is Alzheimer's disease (AD). In some embodiments, the condition, disorder, or disease is Parkinson's disease (PD). In some embodiments, the condition, disorder, or disease is frontotemporal dementia (FTD). In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy (PSP). In some embodiments, the condition, disorder, or disease is corticobasal degeneration (CBD). In some embodiments, the condition, disorder, or disease is Wolfram syndrome (WS). In some embodiments, the condition, disorder, or disease is Friedreich's ataxia (FRDA). In some embodiments, the condition, disorder, or disease is multiple system atrophy (MSA). In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia (SCA). In some embodiments, the condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder or disease is Pick's disease (PD). In some embodiments, the condition, disorder or disease is progressive motor atrophy. In some embodiments, the condition, disorder or disease is concussion. In some embodiments, the condition, disorder or disease is spinal cord injury (SCI). In some embodiments, the condition, disorder or disease is chronic traumatic encephalopathy (CTE). In some embodiments, the condition, disorder or disease is epileptic seizure. In some embodiments, the condition, disorder or disease is stroke. In some embodiments, the condition, disorder or disease is intracerebral hemorrhage. In some embodiments, the condition, disorder or disease is tauopathy. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is acute glaucoma. In some embodiments, the condition, disorder or disease is cancer. In some embodiments, the condition, disorder or disease is diabetes. In some embodiments, the condition, disorder or disease is chemotherapy-induced peripheral neuropathy.
[0319] Characterization and evaluation
[0320] In some embodiments, the properties and / or activities of the oligonucleotides and compositions thereof provided can be characterized and / or evaluated using various techniques available to those skilled in the art, such as biochemical assays (e.g., RNase H assays), cell-based assays, animal models, clinical trials, and the like. Certain useful techniques are described in the examples. Those skilled in the art who read this disclosure will readily appreciate that other techniques, such as in vitro models (e.g., cell lines) for various conditions, disorders, or diseases, animal models for various conditions, disorders, or diseases, clinical trials, and the like can be designed and / or utilized to evaluate the techniques (e.g., oligonucleotides, compositions, methods, etc.) provided herein.
[0321] Biological application
[0322] As is known to those skilled in the art, oligonucleotides can be used for a variety of purposes. In some embodiments, the provided technologies (e.g., oligonucleotides, compositions, methods, etc.) help reduce the level and / or activity of various SARM1 transcripts (e.g., RNA) and / or products encoded therefrom (e.g., proteins). In some embodiments, the provided technologies reduce the level and / or activity of SARM1 RNA transcripts. In some embodiments, the provided oligonucleotides and compositions provide for knockdown of SARM1 mRNA. In some embodiments, the provided technologies reduce the level of SARM1 polypeptides. In some embodiments, the provided technologies reduce the level of SARM1 activity.
[0323] In some embodiments, the present disclosure provides a method for reducing the level of SARM1 mRNA in a system, the method comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the present disclosure provides a method for reducing the level of a SARM1 polypeptide in a system, the method comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system. In some embodiments, the present disclosure provides a method for reducing the level of SARM1 activity in a system, the method comprising administering or delivering an effective amount of an oligonucleotide or oligonucleotide composition to the system.
[0324] In some embodiments, the system comprises SARM1 mRNA. In some embodiments, the system comprises wild-type SARM1 mRNA. In some embodiments, the system comprises a SARM1 mRNA that comprises a mutation. In some embodiments, the system comprises a wild-type mRNA and a SARM1 mRNA that comprises a mutation. In some embodiments, the system expresses SARM1 mRNA. In some embodiments, the system expresses wild-type SARM1 mRNA. In some embodiments, the system expresses a SARM1 mRNA that comprises a mutation. In some embodiments, the system expresses wild-type SARM1 and a SARM1 mRNA that comprises a mutation. In some embodiments, the system expresses a SARM1 polypeptide. In some embodiments, the system expresses a wild-type SARM1 polypeptide. In some embodiments, the system expresses a SARM1 polypeptide that comprises a mutation. In some embodiments, the system expresses a wild-type SARM1 polypeptide and a SARM1 polypeptide that comprises a mutation.
[0325] In some embodiments, the system is an in vitro system. In some embodiments, the system is an in vivo system.
[0326] In some embodiments, the system comprises a cell. In some embodiments, the system is a cell. In some embodiments, the system comprises a cell population. In some embodiments, the system is a cell population. In some embodiments, the cell is a neuronal cell. In some embodiments, the cell is a cell in a neuronal system. In some embodiments, the cell is a cell in the CNS. In some embodiments, the cell has one or more characteristics, properties, and / or activities of a neuronal cell.
[0327] In some embodiments, the system is a tissue. In some embodiments, the system comprises a tissue. In some embodiments, the system is an organ. In some embodiments, the system comprises an organ. In some embodiments, the system is the brain or a portion thereof. In some embodiments, the system comprises the brain or a portion thereof. In some embodiments, the system is an organism. In some embodiments, the system comprises an organism. In some embodiments, the system is a subject. In some embodiments, the system is a mammal, e.g., a mouse, rat, monkey, etc. In some embodiments, the system is a human.
[0328] In some embodiments, the level is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% compared to the absence of the provided oligonucleotide or composition and / or the presence of a reference oligonucleotide or composition. In some embodiments, such reduction is achieved at a specific oligonucleotide concentration (e.g., 1 nM, 5 nM, 10 nM, 100 nM, 500 nM, 1 uM, 5 uM, etc.) or dosage. In some embodiments, such reduction is achieved in a system, e.g., various suitable assays (e.g., in vitro cell-based assays, assays described in the Examples, etc.). In some embodiments, the reference composition does not comprise an oligonucleotide targeting SARM1. In some embodiments, the reference oligonucleotide targets a different nucleic acid than SARM1. In some embodiments, the level is mRNA, e.g., the level of SARM1 mRNA. In some embodiments, the level is a polypeptide, e.g., the level of SARM1 protein. In some embodiments, the level is reduced by at least about 10%. In some embodiments, the level is reduced by at least about 20%. In some embodiments, the level is reduced by at least about 30%. In some embodiments, the level is reduced by at least about 40%. In some embodiments, the level is reduced by at least about 50%. In some embodiments, the level is reduced by at least about 60%. In some embodiments, the level is reduced by at least about 70%. In some embodiments, the level is reduced by at least about 75%. In some embodiments, the level is reduced by at least about 80%.
[0329] In some embodiments, the levels are reduced by at least about 85%. In some embodiments, the levels are reduced by at least about 90%.
[0330] In some embodiments, the level is reduced by at least about 95%. In some embodiments, when assessed, for example, using an assay in the Examples, the level of SARM1 mRNA is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of about 0.01-50 uM, for example, about 0.01-30, about 1-30, about 5-30, about 1, about 5, about 10, about 15, about 20, about 25, about 30 uM, etc.; in some embodiments, the level is reduced by about or at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of about 30 uM. in some embodiments, the levels are reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of about 20 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of about 19 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of about 19 uM oligonucleotide; In some embodiments, the levels are reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of about 16 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of about 10 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80% or 85% of about 3.33 uM oligonucleotide; In some embodiments, the levels are reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of about 1.11 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% of about 0.37 uM oligonucleotide; in some embodiments, the levels are reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% or 50% of about 0.12 uM oligonucleotide;In some embodiments, the level is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35% or 40% of about 0.04uM oligonucleotide; and in some embodiments, the level is reduced by about or at least about 10%, 15%, 20%, 25% or 30% of about 0.01uM oligonucleotide. In some embodiments, the reduction is about or at least about 50%. In some embodiments, the reduction is about or at least about 55%. In some embodiments, the reduction is about or at least about 60%. In some embodiments, the reduction is about or at least about 65%. In some embodiments, the reduction is about or at least about 70%. In some embodiments, the reduction is about or at least about 75%. In some embodiments, the reduction is about or at least about 80%. In some embodiments, the reduction is about or at least about 85%. In some embodiments, the reduction is about or at least about 90%. In some embodiments, the reduction is about or at least about 95%. In certain embodiments, the reduction is assessed at about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days or about 1, 2, 3 or 4 weeks after the oligonucleotide or compositions provided is administered or delivered. In certain embodiments, the reduction is assessed at about or at least about 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days or about 1, 2, 3 or 4 weeks after the oligonucleotide or compositions provided is removed or rinsed. In certain embodiments, the reduction is assessed at day 0. In certain embodiments, the reduction is assessed at day 3. In certain embodiments, the reduction is assessed at day 10. In certain embodiments, the reduction is assessed at day 14. In some embodiments, the reduction is assessed at about day 21. In some embodiments, the reduction in one or more assessments (e.g., one or more assessments of SARM1 mRNA levels) is independently about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%; in some embodiments, the reduction is independently about or at least about 60%; in some embodiments, the reduction is about or at least about 65%; in some embodiments, the reduction is about or at least about 70%; in some embodiments, the reduction is about or at least about 75%;In some embodiments, the reduction is independently about or at least about 80%. In some embodiments, the reduction is assessed at about day 21. In some embodiments, the reduction in one or more assessments (e.g., one or more assessments of SARM1 protein levels or its activity) is independently about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%; in some embodiments, the reduction is independently about or at least about 10%; in some embodiments, the reduction is about or at least about 15%; in some embodiments, the reduction is about or at least about 20%; In some embodiments, the reduction is about or at least about 25%; in some embodiments, the reduction is independently about or at least about 30%; in some embodiments, the reduction is independently about or at least about 35%; in some embodiments, the reduction is independently about or at least about 40%; in some embodiments, the reduction is independently about or at least about 45%; in some embodiments, the reduction is independently about or at least about 50%; in some embodiments, the reduction is independently about or at least about 55%; in some embodiments, the reduction is independently about or at least about 60%. In some embodiments, the reduction is about or at least about 40% on day 7 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 10 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 14 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40% on day 21 after removal of the provided oligonucleotide or composition. In some embodiments, the reduction is about or at least about 40%-50% at or after about or at least about 7, 10, 14 and / or 21 days after the removal of the provided oligonucleotide or composition. Certain results are described in the figures and examples as examples. Those skilled in the art who read this disclosure understand that various techniques can be used to evaluate the provided technology, including mRNA and / or polypeptide levels reduced by the provided oligonucleotides and compositions. Some useful techniques are described in the examples. In some embodiments, the reduction is a reduction relative to the presence of a reference oligonucleotide or composition (e.g., a scrambled oligonucleotide as described herein). In some embodiments, the reduction is a reduction relative to the absence of an oligonucleotide or composition. In some embodiments, according to the methods described in the examples, for example, in some embodiments, in the case of naked delivery, iPSC-derived motor neurons are evaluated using oligonucleotides at a concentration of about 16, 19, or 20 uM. ;
[0331] In some embodiments, the activity of the oligonucleotides or oligonucleotide compositions provided can be assessed by IC50, which is the concentration that reduces the level of SARM1 mRNA, polypeptide, activity, etc. by 50% under appropriate conditions (e.g., cell-based in vitro assays, tests described in the Examples, etc.). In some embodiments, the IC50 of the oligonucleotides or compositions provided is about or not greater than about 0.001, 0.01, 0.1, 0.5, 1, 2, 5, 10, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 nM. In some embodiments, the IC50 of the oligonucleotides is about or not greater than about 10000 nM. In some embodiments, the IC50 of the oligonucleotides is about or not greater than about 5000 nM. In some embodiments, the IC50 of the oligonucleotides is about or not greater than about 2000 nM. In some embodiments, the IC50 of the oligonucleotides is about or not greater than about 1000 nM. In some embodiments, the IC50 of the oligonucleotides is about or not greater than about 500 nM. In some embodiments, the IC50 is about or not greater than about 200 nM. In some embodiments, the IC50 is about or not greater than about 100 nM. In some embodiments, the IC50 is about or not greater than about 50 nM. In some embodiments, the IC50 is about or not greater than about 20 nM. In some embodiments, the IC50 is about or not greater than about 10 nM. In some embodiments, the IC50 is about or not greater than about 5 nM. In some embodiments, the IC50 is about or not greater than about 2 nM. In some embodiments, the IC50 is about or not greater than about 1 nM.
[0332] In some embodiments, provided oligonucleotides and compositions can be used to treat various conditions, disorders, or diseases by reducing the level and / or activity of SARM1 transcripts and / or products encoded thereby that are associated with the condition, disorder, or disease.
[0333] In some embodiments, the present disclosure provides a method for preventing a condition, disorder, or disease, comprising administering or delivering an effective amount of an oligonucleotide or composition of the present disclosure to a subject susceptible to the condition, disorder, or disease. In some embodiments, the present disclosure provides a method for treating a condition, disorder, or disease, comprising administering or delivering an effective amount of an oligonucleotide or composition of the present disclosure to a subject suffering from the condition, disorder, or disease.
[0334] Various conditions, disorders or diseases associated with SARM1 can be prevented or treated using the provided technology. In some embodiments, a subject benefits from a reduction in the level of SARM1 transcript, polypeptide and / or activity in certain cells, tissues and / or organs.
[0335] In some embodiments, the condition, disorder, or disease is a neurodegenerative condition, disorder, or disease. In some embodiments, the condition, disorder, or disease is or comprises Wallerian degeneration. In some embodiments, the condition, disorder, or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is a neuropathy. In some embodiments, the condition, disorder, or disease is peripheral neuropathy. In some embodiments, the condition, disorder, or disease is chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder, or disease is Parkinson's disease. In some embodiments, the condition, disorder, or disease is Huntington's disease. In some embodiments, the condition, disorder, or disease is Alzheimer's disease. In some embodiments, the condition, disorder, or disease is frontotemporal dementia. In some embodiments, the condition, disorder, or disease is brain injury. In some embodiments, the condition, disorder, or disease is traumatic brain injury. In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder, or disease is corticobasal degeneration. In some embodiments, the condition, disorder, or disease is Wolfram syndrome. In some embodiments, the condition, disorder or disease is Friedrich's ataxia. In some embodiments, the condition, disorder or disease is multiple system atrophy. In some embodiments, the condition, disorder or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder or disease is Pick's disease. In some embodiments, the condition, disorder or disease is progressive motor atrophy. In some embodiments, the condition, disorder or disease is associated with neuronal damage. In some embodiments, the condition, disorder or disease is associated with neuronal cell damage. In some embodiments, the condition, disorder or disease is associated with neuronal cell death.
[0336] In some embodiments, conditions, disorders, or diseases that may be prevented and / or treated according to the present disclosure are described in WO 2022 / 031736, WO 2021 / 108602, or WO 2022 / 125377.
[0337] Various technologies can be utilized to apply or deliver the oligonucleotide or composition provided. In certain embodiments, the oligonucleotide or composition are administered orally or delivered. In certain embodiments, the oligonucleotide or composition are administered or delivered by a parenteral route. In certain embodiments, the parenteral route includes intravenous, intraarterial, intramuscular, intradermal, subcutaneous, intranasal and intraperitoneal approaches. In certain embodiments, the oligonucleotide or composition are administered or delivered by an intraocular, intraorbital, subconjunctival, intravitreal, subretinal, scleral or cochlear approach. In certain embodiments, the oligonucleotide or composition are administered or delivered by a parenteral route. In certain embodiments, the oligonucleotide or composition are administered or delivered intrathecally. In certain embodiments, the oligonucleotide or composition are administered or delivered intravenously. In certain embodiments, the oligonucleotide is administered or delivered as a liquid composition. In certain embodiments, the oligonucleotide is dissolved in a liquid, for example, in a buffered saline solution (such as aCSF) for use in administering or delivering.
[0338] In some embodiments, the oligonucleotide or composition can be used in combination with another therapy (eg, another therapeutic agent).
[0339] In some embodiments, the technology provided (e.g., oligonucleotides, compositions, methods, etc.) delays or prevents the occurrence of one or more symptoms of disease, illness, or disease and / or features. In some embodiments, the technology provided delays, slows down, or prevents the progression of a disease, illness, or disease. In some embodiments, the technology provided alleviates, improves, alleviates, suppresses, prevents one or more symptoms or features of a disease, illness, and / or disease, delays its onset, reduces its severity, and / or reduces its incidence. In some embodiments, the technology provided improves the performance of a subject in one or more assessments. In some embodiments, the technology provided improves the performance of a subject in one or more clinical assessments. In some embodiments, the technology provided independently improves one or more clinical assessment results of a subject.
[0340] Pharmaceutical composition
[0341] In some embodiments, the present disclosure provides pharmaceutical compositions comprising provided compounds, such as oligonucleotides or pharmaceutically acceptable salts thereof, and a pharmaceutical carrier. In some embodiments, for example, for therapeutic and clinical purposes, the oligonucleotides of the present disclosure are provided as pharmaceutical compositions.
[0342] As will be appreciated by those skilled in the art, oligonucleotides can be provided in various forms. In some embodiments, the oligonucleotides can be in acid form, for example, in the form of -OP(O)(OH)O- for natural phosphate bonds; in the form of -OP(O)(SH)O- for phosphorothioate internucleotide bonds; and so on. In some embodiments, the oligonucleotides provided can be in salt form, for example, in the form of -OP(O)(ONa)O- in a sodium salt for natural phosphate bonds; in the form of -OP(O)(SNa)O- in a sodium salt for phosphorothioate internucleotide bonds; and so on. Unless otherwise indicated, the oligonucleotides of the present disclosure can exist in acid, base and / or salt form. In some embodiments, the composition comprises one or more forms of the oligonucleotide. In some embodiments, the composition comprises one or more salt forms of the oligonucleotide. In some embodiments, the composition comprises one or more pharmaceutically acceptable salt forms of the oligonucleotide.
[0343] When used as treatment, the oligonucleotide or composition provided are usually used as pharmaceutical composition.In certain embodiments, pharmaceutical composition is suitable for oligonucleotide administration or delivery to the region or part of the body affected by symptom, disease or disease.In certain embodiments, pharmaceutical composition comprises the oligonucleotide provided or its pharmaceutically acceptable salt and pharmaceutically acceptable carrier of therapeutically effective amount.In certain embodiments, pharmaceutical composition comprises the oligonucleotide of therapeutically effective amount, and described oligonucleotide is diastereomer each other, and wherein oligonucleotide exists with one or more forms.In certain embodiments, pharmaceutical composition comprises the oligonucleotide of therapeutically effective amount, and these oligonucleotide are diastereomer each other relative to chiral bond phosphorus, and wherein oligonucleotide exists with one or more forms.
[0344] In some embodiments, the pharmaceutically acceptable carrier is a buffer. In some embodiments, the pharmaceutically acceptable carrier is a buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid. In some embodiments, the composition is a liquid composition comprising the dissolved oligonucleotide.
[0345] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, ocular administration, or otic administration. In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, liquid, inhalant, nasal spray solution, suppository, suspension, gel, colloid, dispersion, suspension, solution, emulsion, ointment, lotion, eye drops, or ear drops. In some embodiments, the pharmaceutical composition is formulated for intrathecal administration.
[0346] As will be appreciated by those skilled in the art, oligonucleotides may exist in various salt forms. In some embodiments, the salt is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (optionally in its salt form) and a sodium salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (optionally in its salt form) and sodium chloride. In some embodiments, each hydrogen ion that may be donated to the base in the oligonucleotide (e.g., under conditions of an aqueous solution, pharmaceutical composition, etc.) is replaced by a non-H + Cation replacement. For example, in some embodiments, the pharmaceutically acceptable salt of the oligonucleotide is a full metal ion salt, wherein each hydrogen ion (e.g., each hydrogen ion of -OH, -SH, etc.) of each internucleotide bond (e.g., natural phosphate bond, phosphorothioate internucleotide bond, etc.) is replaced by a metal ion. Various suitable metal salts for pharmaceutical compositions are well known in the art and can be utilized in accordance with the present disclosure. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt (cation N(R')4 + In some embodiments, the pharmaceutically acceptable salt comprises one and no more than one type of cation. In some embodiments, the pharmaceutically acceptable salt comprises two or more cations. In some embodiments, the cation is Li + 、Na + , K + Mg 2+ or Ca 2+ In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt. In some embodiments, the pharmaceutically acceptable salt is an all-sodium salt, wherein each internucleotide bond that is a natural phosphate ester bond (acid form -OP(O)(OH)-O-), if any, is present in its sodium salt form (-OP(O)(ONa)-O-), and each internucleotide bond that is a phosphorothioate internucleotide bond (acid form -OP(O)(SH)-O-), if any, is present in its sodium salt form (-OP(O)(SNa)-O-).
[0347] In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is provided as a solid. In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is lyophilized.
[0348] In some embodiments, the oligonucleotide or composition (eg, pharmaceutical composition) is stored at a temperature below ambient temperature (eg, about or no greater than about -78, -20, 0, 4, or 10°C).
[0349] Various techniques for delivering nucleic acids and / or oligonucleotides are known in the art and can be utilized in accordance with the present disclosure. For example, various supramolecular nanocarriers can be used to deliver nucleic acids. Example nanocarriers include liposomes, cationic polymer complexes, and various polymer compounds. Complexation of nucleic acids with various polycations is another approach for intracellular delivery; such approaches include the use of PEGylated polycations, polyvinylamine (PEI) complexes, cationic block copolymers, and dendrimers. Several cationic nanocarriers, including PEI and polyamidoamine dendrimers, can facilitate release of contents from endosomes. Other approaches may include the use of polymeric nanoparticles, microspheres, liposomes, dendrimers, biodegradable polymers, conjugates, prodrugs, inorganic colloids (such as sulfur or iron), antibodies, implants, biodegradable implants, biodegradable microspheres, osmotic control implants, lipid nanoparticles, emulsions, oily solutions, aqueous solutions, biodegradable polymers, poly(lactide-co-glycolic acid), poly(lactic acid), liquid reservoirs, polymer micelles, quantum dots, and liposomes. In some embodiments, the oligonucleotide is conjugated to another molecule.
[0350] In some embodiments, the oligonucleotide is administered or delivered by naked uptake.
[0351] In some embodiments, the oligonucleotide or composition is formulated for various modes of administration, including systemic and local or site-directed administration. Techniques and formulations generally can be found in Remington, The Science and Practice of Pharmacy (20th ed. 2000).
[0352] In certain embodiments, oligonucleotide or composition are delivered to CNS. In certain embodiments, oligonucleotide and composition are delivered to cerebrospinal fluid. In certain embodiments, oligonucleotide and composition are administered to brain parenchyma. In certain embodiments, oligonucleotide and composition are delivered to animal / experimenter by intrathecal administration or intraventricular administration. Extensive distribution of oligonucleotide and composition can be realized by administration methods described herein and / or known in the art.
[0353] In certain embodiments, parenteral administration is by injection using, for example, a syringe, a pump, or the like. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is directly administered into a tissue or site, such as the cerebrospinal fluid, striatum, caudate, cortex, hippocampus, and / or cerebellum.
[0354] The oligonucleotides and compositions thereof provided are effective in a wide dosage range. In certain embodiments, the dosage is from about 0.01 to about 1000 mg, from about 0.5 to about 100 mg, from about 1 to about 50 mg or from about 5 to about 100 mg. The exact dosage may depend on the route of administration, the form of the oligonucleotide, the subject (e.g., body weight, age, body surface area, etc.), the condition, illness or disease and / or the doctor's preference and experience. In certain embodiments, a fixed dose is used. In certain embodiments, the oligonucleotides or compositions provided are, for example, administered or delivered by injection or infusion weekly, every two weeks, monthly, every two months, every 90 days, every 3 months, every 6 months, every 9 months once or once a year. In certain embodiments, two or more dosages have approximately the same amount. In certain embodiments, one or more dosages are independently more than one or more other dosages. For example, in certain embodiments, before one or more maintenance doses of a lower amount each independently, one or more loading doses of a higher amount each independently are administered. In certain embodiments, two or more or all loading doses have approximately the same amount. In certain embodiments, the amount of a loading dose is higher than another loading dose. In certain embodiments, two or more or all maintenance doses have approximately the same amount. In some embodiments, the maintenance dose is an amount greater than another maintenance dose.
[0355] Example Embodiments
[0356] Among other things, this disclosure provides the following example embodiments:
[0357] 1. An oligonucleotide, wherein:
[0358] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTCTCCAGAACTGAGCAGGG, wherein each T is optionally and independently replaced by U; and
[0359] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0360] 2. The oligonucleotide according to embodiment 1, wherein the base sequence of the oligonucleotide is GTCTCCAGAACTGAGCAGGG.
[0361] 3. An oligonucleotide, wherein:
[0362] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTTGCAGGCTCTTGATGGC, wherein each T is optionally and independently replaced by U; and
[0363] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0364] 4. The oligonucleotide of embodiment 3, wherein the base sequence of the oligonucleotide is CCTTGCAGGCTCTTGATGGC.
[0365] 5. An oligonucleotide, wherein:
[0366] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTGGCTGTACTCACTCTCC, wherein each T is optionally and independently replaced by U; and
[0367] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0368] 6. The oligonucleotide of embodiment 5, wherein the base sequence of the oligonucleotide is GCTGGCTGTACTCACTCTCC.
[0369] 7. An oligonucleotide, wherein:
[0370] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TCAGGACTTTGCCTCTTTCC, wherein each T is optionally and independently replaced by U; and
[0371] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0372] 8. The oligonucleotide of embodiment 7, wherein the base sequence of the oligonucleotide is TCAGGACTTTGCCTCTTTCC.
[0373] 9. An oligonucleotide, wherein:
[0374] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGGAGTGGAAGGAAGGAGCC, wherein each T is optionally and independently replaced by U; and
[0375] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0376] 10. The oligonucleotide of embodiment 9, wherein the base sequence of the oligonucleotide is GGGAGTGGAAGGAAGGAGCC.
[0377] 11. An oligonucleotide, wherein:
[0378] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTTTTAGAGATTTGCTACCC, wherein each T is optionally and independently replaced by U; and
[0379] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0380] 12. The oligonucleotide of embodiment 11, wherein the base sequence of the oligonucleotide is GCTTTAGAGATTTGCTACCC.
[0381] 13. An oligonucleotide, wherein:
[0382] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCATCACTCACTGTCAGGTA, wherein each T is optionally and independently replaced by U; and
[0383] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0384] 14. The oligonucleotide of embodiment 13, wherein the base sequence of the oligonucleotide is GCATCACTCACTGTCAGGTA.
[0385] 15. An oligonucleotide, wherein:
[0386] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCCTAGGATTTTCCTGTTG, wherein each T is optionally and independently replaced by U; and
[0387] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0388] 16. The oligonucleotide of embodiment 15, wherein the base sequence of the oligonucleotide is GCCCTAGGATTTTCCTGTTG.
[0389] 17. An oligonucleotide, wherein:
[0390] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTGCCATTGGTAGAGTAGGA, wherein each T is optionally and independently replaced by U; and
[0391] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0392] 18. The oligonucleotide of embodiment 17, wherein the base sequence of the oligonucleotide is GTGCCATTGGTAGAGTAGGA.
[0393] 19. An oligonucleotide, wherein:
[0394] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CTGTGACCTAGGCTCCTTGA, wherein each T is optionally and independently replaced by U; and
[0395] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0396] 20. The oligonucleotide of embodiment 19, wherein the base sequence of the oligonucleotide is CTGTGACCTAGGCTCCTTGA.
[0397] 21. An oligonucleotide, wherein:
[0398] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of AGACACCTGGGTATCAGCCT, wherein each T is optionally and independently replaced by U; and
[0399] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0400] 22. The oligonucleotide of embodiment 21, wherein the base sequence of the oligonucleotide is AGACACCTGGGTATCAGCCT.
[0401] 23. An oligonucleotide, wherein:
[0402] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCCAGGTTGTCTCAGCCCA, wherein each T is optionally and independently replaced by U; and
[0403] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0404] 24. The oligonucleotide of embodiment 23, wherein the base sequence of the oligonucleotide is GCCCAGGTTGTCTCAGCCCA.
[0405] 25. An oligonucleotide, wherein:
[0406] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTTGTCTCATCCTGTCTCT, wherein each T is optionally and independently replaced by U; and
[0407] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0408] 26. The oligonucleotide of embodiment 25, wherein the base sequence of the oligonucleotide is GCTTGTCTCATCCTGTCTCT.
[0409] 27. An oligonucleotide, wherein:
[0410] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGTTCTCAGCCACCAGGATC, wherein each T is optionally and independently replaced by U; and
[0411] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0412] 28. The oligonucleotide of embodiment 27, wherein the base sequence of the oligonucleotide is GGTTCTCAGCCACCAGGATC.
[0413] 29. An oligonucleotide, wherein:
[0414] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAAACTGGTGTCAGAGCCTG, wherein each T is optionally and independently replaced by U; and
[0415] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0416] 30. The oligonucleotide of embodiment 29, wherein the base sequence of the oligonucleotide is CAAACTGGTGTCAGAGCCTG.
[0417] 31. An oligonucleotide, wherein:
[0418] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCAGCACCCTCCAAACTGGT, wherein each T is optionally and independently replaced by U; and
[0419] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0420] 32. The oligonucleotide of embodiment 31, wherein the base sequence of the oligonucleotide is GCAGCACCCTCCAAACTGGT.
[0421] 33. An oligonucleotide, wherein:
[0422] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TGTCTCTGAGCTGACTGCTT, wherein each T is optionally and independently replaced by U; and
[0423] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0424] 34. The oligonucleotide of embodiment 33, wherein the base sequence of the oligonucleotide is TGTCTCTGAGCTGACTGCTT.
[0425] 35. An oligonucleotide, wherein:
[0426] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCACTAGCCCTGGGAGCAAA, wherein each T is optionally and independently replaced by U; and
[0427] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0428] 36. The oligonucleotide of embodiment 35, wherein the base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA.
[0429] 37. An oligonucleotide, wherein:
[0430] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCATCTCCATCCATAGAGC, wherein each T is optionally and independently replaced by U; and
[0431] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0432] 38. The oligonucleotide of embodiment 37, wherein the base sequence of the oligonucleotide is GCCATCTCCATCCATAGAGC.
[0433] 39. An oligonucleotide, wherein:
[0434] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of AGGAGAGCTGTGGGCTTGGG, wherein each T is optionally and independently replaced by U; and
[0435] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0436] 40. The oligonucleotide of embodiment 39, wherein the base sequence of the oligonucleotide is AGGAGAGCTGTGGGCTTGGG.
[0437] 41. An oligonucleotide, wherein:
[0438] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CACCCATGCCTCCCAGCAGA, wherein each T is optionally and independently replaced by U; and
[0439] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0440] 42. The oligonucleotide of embodiment 41, wherein the base sequence of the oligonucleotide is CACCCATGCCTCCCAGCAGA.
[0441] 43. An oligonucleotide, wherein:
[0442] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTGCTCTGTCCTTGGTCCTG, wherein each T is optionally and independently replaced by U; and
[0443] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0444] 44. The oligonucleotide of embodiment 43, wherein the base sequence of the oligonucleotide is GTGCTCTGTCCTTGGTCCTG.
[0445] 45. An oligonucleotide, wherein:
[0446] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCATTCTCATGCAGCCTAC, wherein each T is optionally and independently replaced by U; and
[0447] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0448] 46. The oligonucleotide of embodiment 45, wherein the base sequence of the oligonucleotide is CCCATTCTCATGCAGCCTAC.
[0449] 47. An oligonucleotide, wherein:
[0450] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGTCTGAGAGGCTGTGGGTC, wherein each T is optionally and independently replaced by U; and
[0451] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0452] 48. The oligonucleotide of embodiment 47, wherein the base sequence of the oligonucleotide is GGTCTGAGAGGCTGTGGGTC.
[0453] 49. An oligonucleotide, wherein:
[0454] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTCCCAGTTCTTCTGTGGT, wherein each T is optionally and independently replaced by U; and
[0455] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0456] 50. The oligonucleotide of embodiment 49, wherein the base sequence of the oligonucleotide is GCTCCCAGTTCTTCTGTGGT.
[0457] 51. An oligonucleotide, wherein:
[0458] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GATGTCCTCCACAGGTGACA, wherein each T is optionally and independently replaced by U; and
[0459] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0460] 52. The oligonucleotide of embodiment 51, wherein the base sequence of the oligonucleotide is GATGTCCTCCACAGGTGACA.
[0461] 53. An oligonucleotide, wherein:
[0462] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTTCCTGCCTTACTGACCT, wherein each T is optionally and independently replaced by U; and
[0463] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0464] 54. The oligonucleotide of embodiment 53, wherein the base sequence of the oligonucleotide is GCTTCCTGCCTTACTGACCT.
[0465] 55. An oligonucleotide, wherein:
[0466] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CTCTCCTTTGTCCCTGACCA, wherein each T is optionally and independently replaced by U; and
[0467] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0468] 56. The oligonucleotide of embodiment 55, wherein the base sequence of the oligonucleotide is CTCTCCTTTGTCCCTGACCA.
[0469] 57. An oligonucleotide, wherein:
[0470] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCTTGCCTTTTCCTCACTC, wherein each T is optionally and independently replaced by U; and
[0471] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0472] 58. The oligonucleotide of embodiment 57, wherein the base sequence of the oligonucleotide is GCCTTGCCTTTTCCTCACTC.
[0473] 59. An oligonucleotide, wherein:
[0474] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCTGGTCACTAACCCTCTC, wherein each T is optionally and independently replaced by U; and
[0475] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0476] 60. The oligonucleotide of embodiment 59, wherein the base sequence of the oligonucleotide is GCCTGGTCACTAACCCTCTC.
[0477] 61. An oligonucleotide, wherein:
[0478] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CACCCACCTTGGTCTTGCCT, wherein each T is optionally and independently replaced by U; and
[0479] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0480] 62. The oligonucleotide of embodiment 61, wherein the base sequence of the oligonucleotide is CACCCACCTTGGTCTTGCCT.
[0481] 63. An oligonucleotide, wherein:
[0482] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CACACTGATGTCCTGTCCCA, wherein each T is optionally and independently replaced by U; and
[0483] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0484] 64. The oligonucleotide of embodiment 63, wherein the base sequence of the oligonucleotide is CACACTGATGTCCTGTCCCA.
[0485] 65. An oligonucleotide, wherein:
[0486] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CACACCTCTGGGTCTTGGCC, wherein each T is optionally and independently replaced by U; and
[0487] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0488] 66. The oligonucleotide of embodiment 65, wherein the base sequence of the oligonucleotide is CACACCTCTGGGTCTTGGCC.
[0489] 67. An oligonucleotide, wherein:
[0490] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCTGCCCATCACTCCCAGTT, wherein each T is optionally and independently replaced by U; and
[0491] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0492] 68. The oligonucleotide of embodiment 67, wherein the base sequence of the oligonucleotide is GCTGCCCATCACTCCCAGTT.
[0493] 69. An oligonucleotide, wherein:
[0494] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CTCTCCATCTGCCCTGGCCC, wherein each T is optionally and independently replaced by U; and
[0495] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0496] 70. The oligonucleotide of embodiment 69, wherein the base sequence of the oligonucleotide is CTCTCCATCTGCCCTGGCCC.
[0497] 71. An oligonucleotide, wherein:
[0498] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAGTCCCTCTCCTTGTCTCT, wherein each T is optionally and independently replaced by U; and
[0499] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0500] 72. The oligonucleotide of embodiment 71, wherein the base sequence of the oligonucleotide is CAGTCCCTCTCCTTGTCTCT.
[0501] 73. An oligonucleotide, wherein:
[0502] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ATCCACCTGCTGCTCCTGGG, wherein each T is optionally and independently replaced by U; and
[0503] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0504] 74. The oligonucleotide of embodiment 73, wherein the base sequence of the oligonucleotide is ATCCACCTGCTGCTCCTGGG.
[0505] 75. An oligonucleotide, wherein:
[0506] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCTTGTGTCTTGTGGGTGC, wherein each T is optionally and independently replaced by U; and
[0507] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0508] 76. The oligonucleotide of embodiment 75, wherein the base sequence of the oligonucleotide is CCCTTGTGTCTTGTGGGTGC.
[0509] 77. An oligonucleotide, wherein:
[0510] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCTCAACTCCTGCCTCCCA, wherein each T is optionally and independently replaced by U; and
[0511] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0512] 78. The oligonucleotide of embodiment 77, wherein the base sequence of the oligonucleotide is GCCTCAACTCCTGCCTCCCA.
[0513] 79. An oligonucleotide, wherein:
[0514] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TCCTTCTTCCCTATTTCCCA, wherein each T is optionally and independently replaced by U; and
[0515] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0516] 80. The oligonucleotide of embodiment 79, wherein the base sequence of the oligonucleotide is TCCTTCTTCCCTATTTCCCA.
[0517] 81. An oligonucleotide, wherein:
[0518] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTCAGTGCCACAGCCTTGTC, wherein each T is optionally and independently replaced by U; and
[0519] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0520] 82. The oligonucleotide of embodiment 81, wherein the base sequence of the oligonucleotide is GTCAGTGCCACAGCCTTGTC.
[0521] 83. An oligonucleotide, wherein:
[0522] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGCACCTACCTTATGCACCC, wherein each T is optionally and independently replaced by U; and
[0523] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0524] 84. The oligonucleotide of embodiment 83, wherein the base sequence of the oligonucleotide is GGCACCTACCTTATGCACCC.
[0525] 85. An oligonucleotide, wherein:
[0526] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACTACTGCATCCCTCAGCCC, wherein each T is optionally and independently replaced by U; and
[0527] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0528] 86. The oligonucleotide of embodiment 85, wherein the base sequence of the oligonucleotide is ACTACTGCATCCCTCAGCCC.
[0529] 87. An oligonucleotide, wherein:
[0530] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGGCTTGACTCCACACTCCA, wherein each T is optionally and independently replaced by U; and
[0531] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0532] 88. The oligonucleotide of embodiment 87, wherein the base sequence of the oligonucleotide is GGGCTTGACTCCACACTCCA.
[0533] 89. An oligonucleotide, wherein:
[0534] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGCATGGCATCTCAGCTTCA, wherein each T is optionally and independently replaced by U; and
[0535] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0536] 90. The oligonucleotide of embodiment 89, wherein the base sequence of the oligonucleotide is GGCATGGCATCTCAGCTTCA.
[0537] 91. An oligonucleotide, wherein:
[0538] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TTCAGGATCACCTAGCTGGT, wherein each T is optionally and independently replaced by U; and
[0539] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0540] 92. The oligonucleotide of embodiment 91, wherein the base sequence of the oligonucleotide is TTCAGGATCACCTAGCTGGT.
[0541] 93. An oligonucleotide, wherein:
[0542] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTCTTTGCCATCTGCTGGG, wherein each T is optionally and independently replaced by U; and
[0543] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0544] 94. The oligonucleotide of embodiment 93, wherein the base sequence of the oligonucleotide is CCTCTTTGCCATCTGCTGGG.
[0545] 95. An oligonucleotide, wherein:
[0546] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GAGTGCAGTTCACTTGTGGT, wherein each T is optionally and independently replaced by U; and
[0547] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0548] 96. The oligonucleotide of embodiment 95, wherein the base sequence of the oligonucleotide is GAGTGCAGTTCACTTGTGGT.
[0549] 97. An oligonucleotide, wherein:
[0550] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TGCCCACACTCTGCCTGTCA, wherein each T is optionally and independently replaced by U; and
[0551] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0552] 98. The oligonucleotide of embodiment 97, wherein the base sequence of the oligonucleotide is TGCCCACACTCTGCCTGTCA.
[0553] 99. An oligonucleotide, wherein:
[0554] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAGAGGGAGCTGCTAGTCAG, wherein each T is optionally and independently replaced by U; and
[0555] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0556] 100. The oligonucleotide of embodiment 99, wherein the base sequence of the oligonucleotide is CAGAGGGAGCTGCTAGTCAG.
[0557] 101. An oligonucleotide, wherein:
[0558] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TTGGCAAAGGTGATGCAGGC, wherein each T is optionally and independently replaced by U; and
[0559] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0560] 102. The oligonucleotide of embodiment 101, wherein the base sequence of the oligonucleotide is TTGGCAAAGGTGATGCAGGC.
[0561] 103. An oligonucleotide, wherein:
[0562] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTCCACCAGTTGGAAGACC, wherein each T is optionally and independently replaced by U; and
[0563] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0564] 104. The oligonucleotide of embodiment 103, wherein the base sequence of the oligonucleotide is CCTCCACCAGTTGGAAGACC.
[0565] 105. An oligonucleotide, wherein:
[0566] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTGCTCCAAGATGCCTGCCA, wherein each T is optionally and independently replaced by U; and
[0567] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0568] 106. The oligonucleotide of embodiment 105, wherein the base sequence of the oligonucleotide is GTGCTCCAAGATGCCTGCCA.
[0569] 107. An oligonucleotide, wherein:
[0570] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTGAGCTCCCTAAAGAACCT, wherein each T is optionally and independently replaced by U; and
[0571] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0572] 108. The oligonucleotide of embodiment 107, wherein the base sequence of the oligonucleotide is GTGAGCTCCCTAAAGAACCT.
[0573] 109. An oligonucleotide, wherein:
[0574] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGTTTGCCACCAGTACAGGG, wherein each T is optionally and independently replaced by U; and
[0575] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0576] 110. The oligonucleotide of embodiment 109, wherein the base sequence of the oligonucleotide is GGTTTGCCACCAGTACAGGG.
[0577] 111. An oligonucleotide, wherein:
[0578] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TCCAGCTTCTCCACATCAAT, wherein each T is optionally and independently replaced by U; and
[0579] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0580] 112. The oligonucleotide of embodiment 111, wherein the base sequence of the oligonucleotide is TCCAGCTTCTCCACATCAAT.
[0581] 113. An oligonucleotide, wherein:
[0582] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GAACTTGCCTGCTTCCAGCT, wherein each T is optionally and independently replaced by U; and
[0583] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0584] 114. The oligonucleotide of embodiment 113, wherein the base sequence of the oligonucleotide is GAACTTGCCTGCTTCCAGCT.
[0585] 115. An oligonucleotide, wherein:
[0586] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACACTCTGGATGAGTTTGTC, wherein each T is optionally and independently replaced by U; and
[0587] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0588] 116. The oligonucleotide of embodiment 115, wherein the base sequence of the oligonucleotide is ACACTCTGGATGAGTTTGTC.
[0589] 117. An oligonucleotide, wherein:
[0590] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GGGCACCCATGACACTCTGG, wherein each T is optionally and independently replaced by U; and
[0591] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0592] 118. The oligonucleotide of embodiment 117, wherein the base sequence of the oligonucleotide is GGGCACCCATGACACTCTGG.
[0593] 119. An oligonucleotide, wherein:
[0594] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACTTGTCCAGTGCTCCAGGT, wherein each T is optionally and independently replaced by U; and
[0595] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0596] 120. The oligonucleotide of embodiment 119, wherein the base sequence of the oligonucleotide is ACTTGTCCAGTGCTCCAGGT.
[0597] 121. An oligonucleotide, wherein:
[0598] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCAATCCTTGCAGTCATGG, wherein each T is optionally and independently replaced by U; and
[0599] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0600] 122. The oligonucleotide of embodiment 121, wherein the base sequence of the oligonucleotide is CCCAATCCTTGCAGTCATGG.
[0601] 123. An oligonucleotide, wherein:
[0602] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of AGCACAGCCTGCATGTCCTC, wherein each T is optionally and independently replaced by U; and
[0603] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0604] 124. The oligonucleotide of embodiment 123, wherein the base sequence of the oligonucleotide is AGCACAGCCTGCATGTCCTC.
[0605] 125. An oligonucleotide, wherein:
[0606] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TGGTTAGGTTGGACCCATGG, wherein each T is optionally and independently replaced by U; and
[0607] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0608] 126. The oligonucleotide of embodiment 125, wherein the base sequence of the oligonucleotide is TGGTTAGGTTGGACCCATGG.
[0609] 127. An oligonucleotide, wherein:
[0610] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of TCCTCTCCAGATACTGAGG, wherein each T is optionally and independently replaced by U; and
[0611] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0612] 128. The oligonucleotide of embodiment 127, wherein the base sequence of the oligonucleotide is TCCTCTCTCCAGATACTGAGG.
[0613] 129. An oligonucleotide, wherein:
[0614] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ACAGACAACCCAATGGCAGG, wherein each T is optionally and independently replaced by U; and
[0615] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0616] 130. The oligonucleotide of embodiment 129, wherein the base sequence of the oligonucleotide is ACAGACAACCCAATGGCAGG.
[0617] 131. An oligonucleotide, wherein:
[0618] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTTAATTCCTGTCTGAGGC, wherein each T is optionally and independently replaced by U; and
[0619] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0620] 132. The oligonucleotide of embodiment 131, wherein the base sequence of the oligonucleotide is CCTTAATTCCTGTCTGAGGC.
[0621] 133. An oligonucleotide, wherein:
[0622] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAGAATACAGTGCCCAGGCC, wherein each T is optionally and independently replaced by U; and
[0623] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0624] 134. The oligonucleotide of embodiment 133, wherein the base sequence of the oligonucleotide is CAGAATACAGTGCCCAGGCC.
[0625] 135. An oligonucleotide, wherein:
[0626] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCCAGGCCCTTGCTCAGAAT, wherein each T is optionally and independently replaced by U; and
[0627] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0628] 136. The oligonucleotide of embodiment 135, wherein the base sequence of the oligonucleotide is CCCAGGCCCTTGCTCAGAAT.
[0629] 137. An oligonucleotide, wherein:
[0630] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCACTCATCCCTGGCTGGCT, wherein each T is optionally and independently replaced by U; and
[0631] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0632] 138. The oligonucleotide of embodiment 137, wherein the base sequence of the oligonucleotide is GCACTCATCCCTGGCTGGCT.
[0633] 139. An oligonucleotide, wherein:
[0634] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GATTACAGGGCAAGGCCACA, wherein each T is optionally and independently replaced by U; and
[0635] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0636] 140. The oligonucleotide of embodiment 139, wherein the base sequence of the oligonucleotide is GATTACAGGGCAAGGCCACA.
[0637] 141. An oligonucleotide, wherein:
[0638] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCCTGGATGTGGCAAAAGA, wherein each T is optionally and independently replaced by U; and
[0639] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0640] 142. The oligonucleotide of embodiment 141, wherein the base sequence of the oligonucleotide is GCCCTGGATGTGGCAAAAGA.
[0641] 143. An oligonucleotide, wherein:
[0642] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of AAGGAAGTCAGAGGGAGGGC, wherein each T is optionally and independently replaced by U; and
[0643] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0644] 144. The oligonucleotide of embodiment 143, wherein the base sequence of the oligonucleotide is AAGGAAGTCAGAGGGAGGGC.
[0645] 145. An oligonucleotide, wherein:
[0646] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CAGGCCCAAACAGGAGGCTC, wherein each T is optionally and independently replaced by U; and
[0647] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0648] 146. The oligonucleotide of embodiment 145, wherein the base sequence of the oligonucleotide is CAGGCCCAAACAGGAGGCTC.
[0649] 147. An oligonucleotide, wherein:
[0650] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of ATGCCCAGACCCAGGCCCAA, wherein each T is optionally and independently replaced by U; and
[0651] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0652] 148. The oligonucleotide of embodiment 147, wherein the base sequence of the oligonucleotide is ATGCCCAGACCCAGGCCCAA.
[0653] 149. An oligonucleotide, wherein:
[0654] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CTGAGGCACAGCACCAAGGC, wherein each T is optionally and independently replaced by U; and
[0655] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0656] 150. The oligonucleotide of embodiment 149, wherein the base sequence of the oligonucleotide is CTGAGGCACAGCACCAAGGC.
[0657] 151. An oligonucleotide, wherein:
[0658] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCAGACCAGGAAGGAGCCT, wherein each T is optionally and independently replaced by U; and
[0659] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0660] 152. The oligonucleotide of embodiment 151, wherein the base sequence of the oligonucleotide is GCCAGACCAGGAAGGAGCCT.
[0661] 153. An oligonucleotide, wherein:
[0662] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCCAGCCTCAGAATGATTC, wherein each T is optionally and independently replaced by U; and
[0663] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0664] 154. The oligonucleotide of embodiment 153, wherein the base sequence of the oligonucleotide is GCCCAGCCTCAGAATGATTC.
[0665] 155. An oligonucleotide, wherein:
[0666] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTCTGAACCCAGTGGAGGA, wherein each T is optionally and independently replaced by U; and
[0667] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0668] 156. The oligonucleotide of embodiment 155, wherein the base sequence of the oligonucleotide is CCTCTGAACCCAGTGGAGGA.
[0669] 157. An oligonucleotide, wherein:
[0670] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCTGGGTTTATTGGAGGGT, wherein each T is optionally and independently replaced by U; and
[0671] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0672] 158. The oligonucleotide of embodiment 157, wherein the base sequence of the oligonucleotide is GCCTGGGTTTATTGGAGGGT.
[0673] 159. An oligonucleotide, wherein:
[0674] The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GCCAGCACAGACCAAGAGTGG, wherein each T is optionally and independently replaced by U; and
[0675] The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
[0676] 160. The oligonucleotide of embodiment 159, wherein the base sequence of the oligonucleotide is GCCAGCACAGACCAAGAGTGG.
[0677] 161. The oligonucleotide of any preceding embodiment, wherein the oligonucleotide comprises a 5'-wing-core-wing-3' structure.
[0678] 162. The oligonucleotide of any preceding embodiment, wherein there are about 3-10 nucleosides in the 5'-wing.
[0679] 163. The oligonucleotide of any preceding embodiment, wherein there are 5 nucleosides in the 5'-wing.
[0680] 164. The oligonucleotide of any preceding embodiment, wherein each sugar in the 5'-wing is independently a modified sugar.
[0681] 165. The oligonucleotide of any one of the preceding embodiments, wherein the sugar in the 5'-wing is s Modified sugars, where R s It is C 1-6 Fatty.
[0682] 166. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a 2'-MOE modified sugar.
[0683] 167. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a 2'-OMe modified sugar.
[0684] 168. The oligonucleotide of any preceding embodiment, wherein the sugar in the 5'-wing is a bicyclic sugar.
[0685] 169. The oligonucleotide of embodiment 168, wherein the bicyclic sugar is an LNA sugar.
[0686] 170. The oligonucleotide of embodiment 168, wherein the bicyclic sugar is a cEt sugar.
[0687] 171. The oligonucleotide of any one of embodiments 1 to 165, wherein each sugar in the 5'-wing is independently 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.
[0688] 172. The oligonucleotide of any one of embodiments 1 to 165, wherein each sugar in the 5'-wing is independently a 2'-MOE modified sugar.
[0689] 173. The oligonucleotide of any preceding embodiment, wherein the oligonucleotide has about 8-15 nucleosides in the core.
[0690] 174. The oligonucleotide of any preceding embodiment, wherein the oligonucleotide has 10 nucleosides in the core.
[0691] 175. The oligonucleotide of any preceding embodiment, wherein each sugar in the core is independently a natural DNA sugar.
[0692] 176. The oligonucleotide of any preceding embodiment, wherein the core is free of cytosine.
[0693] 177. The oligonucleotide of any preceding embodiment, wherein the core comprises one or more 5-methylcytosines.
[0694] 178. The oligonucleotide of any preceding embodiment, wherein there are about 3-10 nucleosides in the 3'-wing.
[0695] 179. The oligonucleotide of any preceding embodiment, wherein there are 5 nucleosides in the 3'-wing.
[0696] 180. The oligonucleotide of any preceding embodiment, wherein each sugar in the 3'-wing is independently a modified sugar.
[0697] 181. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is s Modified sugars, where R s It is C 1-6 Fatty.
[0698] 182. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a 2'-MOE modified sugar.
[0699] 183. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a 2'-OMe modified sugar.
[0700] 184. The oligonucleotide of any preceding embodiment, wherein the sugar in the 3'-wing is a bicyclic sugar.
[0701] 185. The oligonucleotide of embodiment 184, wherein the bicyclic sugar is an LNA sugar.
[0702] 186. The oligonucleotide of embodiment 184, wherein the bicyclic sugar is a cEt sugar.
[0703] 187. The oligonucleotide of any one of embodiments 1 to 181, wherein each sugar in the 3'-wing is independently ligated via a 2'-OR s Modified sugars, where R s It is C 1-6 Fatty.
[0704] 188. The oligonucleotide of any one of embodiments 1 to 181, wherein each sugar in the 3'-wing is independently a 2'-MOE modified sugar.
[0705] 189. The oligonucleotide of any preceding embodiment, wherein the oligonucleotide comprises a modified internucleotide linkage.
[0706] 190. The oligonucleotide of embodiment 189, wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.
[0707] 191. The oligonucleotide of any preceding embodiment, wherein each internucleotide linkage is independently a modified internucleotide linkage.
[0708] 192. The oligonucleotide of any preceding embodiment, wherein each internucleotide linkage is independently a phosphorothioate internucleotide linkage.
[0709] 193. An oligonucleotide having a structure selected from the group consisting of:
[0710] / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / ,
[0711] / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / ,
[0712] / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / ,
[0713] / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / ,
[0714] / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G*T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / ,
[0715] / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / ,
[0716] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / ,
[0717] / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / ,
[0718] / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / ,
[0719] / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / ,
[0720] / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / ,
[0721] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / ,
[0722] / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / ,
[0723] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / ,
[0724] / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0725] / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / ,
[0726] / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / ,
[0727] / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / ,
[0728] / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0729] / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / ,
[0730] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / ,
[0731] / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / ,
[0732] / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / ,
[0733] / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / ,
[0734] / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / ,
[0735] / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / ,
[0736] / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0737] / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / ,
[0738] / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0739] / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / ,
[0740] / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / ,
[0741] / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / ,
[0742] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / ,
[0743] / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / ,
[0744] / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / ,
[0745] / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0746] / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / ,
[0747] / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / ,
[0748] / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / ,
[0749] / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / iMe-dC / *A* / iMe-dC / *T*T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / ,
[0750] / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / ,
[0751] / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / ,
[0752] / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / ,
[0753] / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / ,
[0754] / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / ,
[0755] / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / ,
[0756] / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / ,
[0757] / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / ,
[0758] / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / ,
[0759] / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / ,
[0760] / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / ,
[0761] / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / ,
[0762] / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / ,
[0763] / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / ,
[0764] / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG...
Claims
1. An oligonucleotide having the following structure: / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iM e-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / or its salt, where: * is -OP(O)(SH)-O-; / 52MOErG / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErG / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
2. An oligonucleotide having the following structure: / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / or its salt, where: * is -OP(O)(SH)-O-; / 52MOErC / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErC / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
3. An oligonucleotide having a structure selected from the group consisting of: / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / , / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G* T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe-dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / iMe-dC / *A* / iMe-dC / *T*T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / , / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *A*T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / iMe-dC / *A*G*A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*A*A* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / iMe-dC / *T* / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*G*A*T*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*A*T*G* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / iMe-dC / * / iMe-dC / *T*G*T* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / iMe-dC / *A*G*T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / iMe-dC / *A*A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / iMe-dC / *A* / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOEr / , / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / iMe-dC / *A*G*A*G*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*A*A* / iMe-dC / *A*G*G*A* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / *A* / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / , or / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / or its salt, where: * is -OP(O)(SH)-O-; / 52MOErA / is / 52MOErT / is / 52MOErC / is / 52MOErG / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErA / is / 32MOErT / is / 32MOErC / is / 32MOErG / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
4. An oligonucleotide, wherein: The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of GTCTCCAGAACTGAGCAGGG, wherein each T is optionally and independently replaced by U; and The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages. The oligonucleotide according to claim 4 , wherein the base sequence of the oligonucleotide is GTCTCCAGAACTGAGCAGGG.
6. An oligonucleotide, wherein: The base sequence of the oligonucleotide comprises 10 or more consecutive nucleobases of CCTTGCAGGCTCTTGATGGC, wherein each T is optionally and independently replaced by U; and The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages. The oligonucleotide according to claim 6 , wherein the base sequence of the oligonucleotide is CCTTGCAGGCTCTTGATGGC.
8. An oligonucleotide, wherein: The base sequence of the oligonucleotide contains 10 or more consecutive nucleobases as follows: CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA, GCTGGCTGTACTCACTCTCC, GTGCTCTGTCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCTTGA, GGTCTGAGAGGCTGTGGGTC, GCTCCCAGTTCTTCTGTGGT, GATGTCCTCCACAGGTGACA, GCTTCCTGCCTTACTGACCT, CTCTCCTTTGTCCCTGACCA, GCCTTGCCTTTTCCTCACTC, GCCTGGTCACTAACCCTCTC, CACCCACCTTGGTCTTGCCT, CACACTGATGTCCTGTCCCA, CACACCTCTGGGTCTTGGCC, GCTGCCCATCACTCCCAGTT, CTCTCCATCTGCCCTGGCCC, CAGTCCCTCTCCTTGTCTCT, ATCCACCTGCTGCTCCTGGG, CCCTTGTGTCTTGTGGGTGC, GCCCTAGGATTTTCCTGTTG, GCCTCAACTCCTGCCTCCCA, AGACACCTGGGTATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCACTGTCAGGTA, GTCAGTGCCACAGCCTTGTC, GGCACCTACCTTATGCACCC, ACTACTGCATCCCTCAGCCC, GCTTGTCTCATCCTGTCTCT, TGTCTCTGAGCTGACTGCTT,GGGCTTGACTCCACACTCCA, GGCATGGCATCTCAGCTTCA, TTCAGGATCACCTAGCTGGT, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTCACTTGTGGT, TGCCCACACTCTGCCTGTCA, CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCAGTTGGAAGACC, GGTTCTCAGCCACCAGGATC, GTGCTCCAAGATGCCTGCCA, CCTTGCAGGCTCTTGATGGC, GTGCCATTGGTAGAGTAGGA,GTGAGCTCCCTAAAGAACCT, GGTTTGCCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTC, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAACCTTGCAGTCATGG, AGCACAGCCTGCATGTCCTC, CAAACTGGTGTCAGAGCCTG, GCAGCACCCTCCAAACTGGT, TGGTTAGGTTGGACCCATGG, GCCCAGGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCCCTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGGAGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG or GGGAGTGGAAGGAAGGAGCC, where each T is optionally and independently replaced by U; and, The oligonucleotides comprise modified nucleobases, modified sugars or modified internucleotide linkages.
9. The oligonucleotide according to claim 8, wherein the base sequence of the oligonucleotide is CCACTAGCCCTGGGAGCAAA, GCCATCTCCATCCATAGAGC, AGGAGAGCTGTGGGCTTGGG, CACCCATGCCTCCCAGCAGA, GCTGGCTGTACTCACTCTCC, GTGCTCTGTCCTTGGTCCTG, CCCATTCTCATGCAGCCTAC, CTGTGACCTAGGCTCCTTGA, GGTCTGAGAGGCTGTGGGTC, GCTCCCAGTTCTTCTGTGGT, GATGTCCTCCACAGGTGACA, GCTTCCTGCCTTACTGACCT, CTCTCCTTTGTCCCTGACCA, GCCTTGCCTTTTCCTCACTC, GCCTGGTCACTAACCCTCTC, CACCCACCTTGGTCTTGCCT, CACACTGATGTCCTGTCCCA, CACACCTCTGGGTCTTGGCC, GCTGCCCATCACTCCCAGTT, CTCTCCATCTGCCCTGGCCC, CAGTCCCTCTCCTTGTCTCT, ATCCACCTGCTGCTCCTGGG, CCCTTGTGTCTTGTGGGTGC, GCCCTAGGATTTTCCTGTTG, GCCTCAACTCCTGCCTCCCA, AGACACCTGGGTATCAGCCT, TCCTTCTTCCCTATTTCCCA, GCATCACTCACTGTCAGGTA, GTCAGTGCCACAGCCTTGTC, GGCACCTACCTTATGCACCC, ACTACTGCATCCCTCAGCCC, GCTTGTCTCATCCTGTCTCT, TGTCTCTGAGCTGACTGCTT, GGGCTTGACTCCACACTCCA, GGCATGGCATCTCAGCTTCA, TTCAGGATCACCTAGCTGGT, CCTCTTTGCCATCTGCTGGG, GAGTGCAGTTCACTTGTGGT, TGCCCACACTCTGCCTGTCA, CAGAGGGAGCTGCTAGTCAG, TTGGCAAAGGTGATGCAGGC, CCTCCACCAGTTGGAAGACC, GGTTCTCAGCCACCAGGATC, GTGCTCCAAGATGCCTGCCA, CCTTGCAGGCTCTTGATGGC, GTGCCATTGGTAGAGTAGGA,GTGAGCTCCCTAAAGAACCT, GGTTTGCCACCAGTACAGGG, TCCAGCTTCTCCACATCAAT, GAACTTGCCTGCTTCCAGCT, ACACTCTGGATGAGTTTGTC, GGGCACCCATGACACTCTGG, ACTTGTCCAGTGCTCCAGGT, CCCAACTCCTTGCAGTCATGG, AGCACAGCCTGCATGTCCTC, CAAACTGGTGTCAGAGCCTG, GCAGCACCCTCCAAACTGGT, TGGTTAGGTTGGACCCATGG, GCCCAGGTTGTCTCAGCCCA, TCCCTCTCCAGATACTGAGG, ACAGACAACCCAATGGCAGG, GTCTCCAGAACTGAGCAGGG, CCTTAATTCCTGTCTGAGGC, CAGAATACAGTGCCCAGGCC, CCCAGGCCCTTGCTCAGAAT, GCACTCATCCCTGGCTGGCT, GATTACAGGGCAAGGCCACA, GCCCTGGATGTGGCAAAAGA, AAGGAAGTCAGAGGGAGGGC, CAGGCCCAAACAGGAGGCTC, ATGCCCAGACCCAGGCCCAA, CTGAGGCACAGCACCAAGGC, GCCAGACCAGGAAGGAGCCT, TCAGGACTTTGCCTCTTTCC, GCTTTAGAGATTTGCTACCC, GCCCAGCCTCAGAATGATTC, CCTCTGAACCCAGTGGAGGA, GCCTGGGTTTATTGGAGGGT, GCCAGCACAGCCAAGAGTGG or GGGAGTGGAAGGAAGGAGCC., 10. The oligonucleotide according to any one of claims 4 to 9, wherein the oligonucleotide comprises a 5'-wing-core-wing-3' structure.
11. The oligonucleotide of claim 10, wherein there are about 3-10 nucleosides in the 5'-wing, optionally wherein there are 5 nucleosides in the 5'-wing.
12. The oligonucleotide of claim 10 or 11, wherein each sugar in the 5'-wing is independently a modified sugar.
13. The oligonucleotide according to any one of claims 10 to 12, wherein the sugar in the 5'-wing is s Modified sugars, where R s It is C 1-6 aliphatic; wherein the sugar in the 5'-wing is a sugar modified with 2'-MOE; wherein the sugar in the 5'-wing is a sugar modified with 2'-OMe; wherein the sugar in the 5'-wing is a bicyclic sugar, optionally wherein the bicyclic sugar is an LNA sugar or a cEt sugar.
14. The oligonucleotide according to any one of claims 10 to 13, wherein each sugar in the 5'-wing is independently ligated via a 2'-OR s Modified sugars, where R s It is C 1-6 aliphatic, or wherein each sugar in the 5'-wing is independently a 2'-MOE modified sugar.
15. The oligonucleotide of any one of claims 10 to 14, wherein there are about 8-15 nucleosides in the core, optionally wherein there are 10 nucleosides in the core.
16. The oligonucleotide of any one of claims 10 to 15, wherein each sugar in the core is independently a natural DNA sugar.
17. The oligonucleotide according to any one of claims 10 to 16, wherein the core is free of cytosine and / or wherein the core comprises one or more 5-methylcytosines.
18. The oligonucleotide of any one of claims 10 to 17, wherein there are about 3-10 nucleosides in the 3'-wing, optionally wherein there are 5 nucleosides in the 3'-wing.
19. The oligonucleotide of any one of claims 10 to 18, wherein each sugar in the 3'-wing is independently a modified sugar.
20. The oligonucleotide according to any one of claims 10 to 19, wherein the sugar in the 3'-wing is s Modified sugars, where R s It is C 1-6 aliphatic; The sugar in the 3'-wing is a 2'-MOE-modified sugar; wherein the sugar in the 3'-wing is a sugar modified with 2'-OMe; wherein the sugar in the 3'-wing is a bicyclic sugar, optionally wherein the bicyclic sugar is an LNA sugar or a cEt sugar.
21. The oligonucleotide according to any one of claims 10 to 20, wherein each sugar in the 3'-wing is independently ligated via a 2'-OR s Modified sugars, where R s It is C 1-6 aliphatic, or wherein each sugar in the 3'-wing is independently a 2'-MOE modified sugar.
22. The oligonucleotide according to any one of claims 10 to 21, wherein the oligonucleotide comprises a modified internucleotide linkage, optionally wherein the modified internucleotide linkage is a phosphorothioate internucleotide linkage.
23. The oligonucleotide according to any one of claims 4 to 22, wherein each internucleotide bond is independently a modified internucleotide bond, and / or wherein each internucleotide linkage is independently a phosphorothioate internucleotide linkage.
24. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is a pharmaceutically acceptable salt, optionally wherein the oligonucleotide is a sodium salt.
25. A composition comprising an oligonucleotide according to any one of the preceding claims and one or more diastereomers of the oligonucleotide relative to the chiral bond phosphorus.
26. A composition comprising: oligonucleotide or a salt thereof, and one or more diastereomers of said oligonucleotide with respect to the chiral bond phosphorus, or one or more salts of said diastereomers, The oligonucleotide is / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , wherein: * is -OP(O)(SH)-O-; / 52MOErG / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErG / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
27. A composition comprising: oligonucleotide or a salt thereof, and one or more diastereomers of said oligonucleotide with respect to the chiral bond phosphorus, or one or more salts of said diastereomers, The oligonucleotide is / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , wherein: * is -OP(O)(SH)-O-; / 52MOErC / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErC / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
28. A composition comprising: oligonucleotide or a salt thereof, and one or more diastereomers of said oligonucleotide with respect to the chiral bond phosphorus, or one or more salts of said diastereomers, wherein the oligonucleotide is / 52MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / *A*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G*G*A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *A*T* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErC / , / 52MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *A*G* / iMe-dC / *T*G* T*G*G*G* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / iMe-dC / *T*G*T*A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*T* / iMe- dC / * / iMe-dC / *T*T*G*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErT / *T* / iMe-dC / *T* / iMe-dC / *A*T*G* / iMe-dC / *A*G* / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / 32MOErC / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *T*A*G*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*G*A*G*G* / iMe-dC / *T*G*T* / i2MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*T*T* / iMe-dC / *T*T* / iMe-dC / *T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G*G* / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / *T*T*A* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *T*T*T*G*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *T*T*T*T* / iMe-dC / * / iMe-dC / *T* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*T* / iMe-dC / *A* / iMe-dC / *T*A*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *T*T*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / *T*G*A*T*G*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T* / iMe-dC / *T*G*G*G*T* / iMe-dC / *T* / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / * A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / 32MOErT / , / 52MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / *G*T*G*T* / iMe-dC / *T*T*G*T*G* / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *A*G*G*A*T*T*T*T* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / *A*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / *T*G*G*G*T*A*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*T*T* / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErC / *A* / iMe-dC / *T* / iMe-dC / *A* / iMe-dC / *T*G*T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *T*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / iMe-dC / *T*A* / iMe-dC / * / iMe-dC / *T*T*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErC / *T*G* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / *T* / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / *T*G* / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*A*G* / iMe-dC / *T*G*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / *T*G*A* / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / *G*G* / iMe-dC / *A*T* / iMe-dC / *T* / iMe-dC / *A*G* / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G*A*T* / iMe-dC / *A* / iMe-dC / * / iMe-dC / *T*A*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *T*T*G* / iMe-dC / * / iMe-dC / *A*T* / iMe-dC / *T*G* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*T*T* / iMe-dC / *A* / iMe-dC / *T*T* / i2MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / *A* / iMe-dC / *T* / iMe-dC / *T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G*G*A*G* / iMe-dC / *T*G* / iMe-dC / *T*A* / i2MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / 32MOErG / , / 52MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / *A*A*A*G*G*T*G*A*T*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / *A*G*T*T*G*G*A* / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / *T* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A* / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / iMe-dC / * / iMe-dC / *A*A*G*A*T*G* / iMe-dC / * / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / iMe-dC / *A*G*G* / iMe-dC / *T* / iMe-dC / *T*T*G* / i2MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / *A*T*T*G*G*T*A*G*A*G* / i2MOErT / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*A*A*A*G* / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErT / *G* / iMe-dC / * / iMe-dC / *A* / iMe-dC / * / iMe-dC / *A*G*T*A* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *T*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *A* / iMe-dC / *A* / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErC / * / i2MOErT / *T*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *T*T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T*G*G*A*T*G*A*G*T* / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErT / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / iMe-dC / * / iMe-dC / * / iMe-dC / *A*T*G*A* / iMe-dC / *A* / iMe-dC / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErG / *T* / iMe-dC / * / iMe-dC / *A*G*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErA / *T* / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *A*G*T* / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / *A*G* / iMe-dC / * / iMe-dC / *T*G* / iMe-dC / *A*T*G* / i2MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErA / * / i2MOErA / * / i2MOErC / *T*G*G*T*G*T* / iMe-dC / *A*G*A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErC / *A* / iMe-dC / * / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*A*A* / i2MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / i2MOErT / *A*G*G*T*T*G*G*A* / iMe-dC / * / iMe-dC / * / i2MOErC / * / i2MOErA / * / i2MOErT / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G*G*T*T*G*T* / iMe-dC / *T* / iMe-dC / *A* / i2MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / 32MOErA / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / iMe-dC / *T* / iMe-dC / * / iMe-dC / *A*G*A*T*A* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErA / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / iMe-dC / *A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*A*T*G* / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / 32MOErG / , / 52MOErG / * / i2MOErT / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / iMe-dC / *A*G*A*A* / iMe-dC / *T*G*A*G* / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErG / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErA / *A*T*T* / iMe-dC / * / iMe-dC / *T*G*T* / iMe-dC / *T* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / *T*A* / iMe-dC / *A*G*T*G* / iMe-dC / * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*T*G* / iMe-dC / *T* / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / i2MOErT / * / iMe-dC / *A*T* / iMe-dC / * / iMe-dC / * / iMe-dC / *T*G*G* / iMe-dC / * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / i2MOErA / * / iMe-dC / *A*G*G*G* / iMe-dC / *A*A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErC / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErT / *G*G*A*T*G*T*G*G* / iMe-dC / *A* / i2MOErA / * / i2MOErA / * / i2MOErG / * / 32MOEr / , / 52MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / *A*G*T* / iMe-dC / *A*G*A*G*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErC / * / iMe-dC / * / iMe-dC / *A*A*A* / iMe-dC / *A*G*G*A* / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErC / , / 52MOErA / * / i2MOErT / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / iMe-dC / *A*G*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*G* / i2MOErC / * / i2MOErC / * / i2MOErA / * / 32MOErA / , / 52MOErC / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / i2MOErG / *G* / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / *A* / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / *A* / iMe-dC / * / iMe-dC / *A*G*G*A*A*G*G* / i2MOErA / * / i2MOErG / * / i2MOErC / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / i2MOErG / *A* / iMe-dC / *T*T*T*G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErT / *A*G*A*G*A*T*T*T*G* / iMe-dC / * / i2MOErT / * / i2MOErA / * / i2MOErC / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErC / * / i2MOErA / *G* / iMe-dC / * / iMe-dC / *T* / iMe-dC / *A*G*A*A*T* / i2MOErG / * / i2MOErA / * / i2MOErT / * / i2MOErT / * / 32MOErC / , / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErT / *G*A*A* / iMe-dC / * / iMe-dC / * / iMe-dC / *A*G*T*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / 32MOErA / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErG / *G*G*T*T*T*A*T*T*G*G* / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / *A* / iMe-dC / *A*G* / iMe-dC / * / iMe-dC / *A*A*G* / i2MOErA / * / i2MOErG / * / i2MOErT / * / i2MOErG / * / 32MOErG / , or / 52MOErG / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErG / *T*G*G*A*A*G*G*A*A*G* / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErC / , where: * is -OP(O)(SH)-O-; / 52MOErA / is / 52MOErT / is / 52MOErC / is / 52MOErG / is / i2MOErA / is / i2MOErT / is / i2MOErC / is / i2MOErG / is / iMe-dC / is / 32MOErA / is / 32MOErT / is / 32MOErC / is / 32MOErG / is and Each of A, T and G is independently deoxyadenosine, thymidine and deoxyguanosine, respectively.
29. The composition of any one of claims 25 to 28, wherein for each chiral bond phosphorus, the percentage of the Rp configuration is independently about 20%-80%, about 30%-70%, about 40%-60%, about 45%-55%, or about 50%.
30. The composition of any one of claims 25 to 29, wherein the composition comprises a salt of the oligonucleotide and one or more salts of one or more diastereomers.
31. The composition of any one of claims 25 to 30, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier.
32. The composition of any one of claims 25 to 31, wherein the composition comprises a pharmaceutically acceptable salt of the oligonucleotide, one or more pharmaceutically acceptable salts of one or more diastereomers, and a pharmaceutically acceptable carrier.
33. A pharmaceutical composition comprising the oligonucleotide or composition according to any one of the preceding claims and a pharmaceutically acceptable carrier.
34. The composition of claim 33, wherein the composition comprises one or more pharmaceutically acceptable salts of the oligonucleotide.
35. The composition of any one of claims 25 to 34, wherein the composition is a liquid composition.
36. The composition of any one of claims 31 to 35, wherein the pharmaceutically acceptable carrier is a buffer, buffered saline or artificial cerebrospinal fluid.
37. A method for reducing the level of SARM1 mRNA in a system, the method comprising administering or delivering to the system an effective amount of the oligonucleotide or composition according to any one of the preceding claims.
38. A method for reducing the level of a SARM1 polypeptide in a system, the method comprising administering or delivering to the system an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.
39. A method for reducing the level of SARM1 activity in a system, said method comprising administering or delivering to said system an effective amount of the oligonucleotide or composition according to any one of claims 1 to 36.
40. The method of any one of claims 37 to 39, wherein the system expresses SARM1 mRNA.
41. The method of any one of claims 37 to 40, wherein the system is or comprises a cell, a population of neuronal cells, a tissue, an organ, a brain or a part thereof, an organism, a subject, or a human.
42. The method of any one of claims 37 to 41, wherein the level of SARM1 mRNA in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90% compared to the absence of the oligonucleotide or the composition.
43. The method of any one of claims 37 to 42, wherein the level of SARM1 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60% compared to the absence of the oligonucleotide or the composition.
44. The method of any one of claims 37 to 43, wherein the level of SARM1 activity in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to the absence of the oligonucleotide or the composition.
45. The method of any one of claims 37 to 44, wherein the level of SARM1 mRNA in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90% compared to administration or delivery of a reference oligonucleotide or composition.
46. The method of any one of claims 37 to 45, wherein the level of SARM1 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60% compared to administration or delivery of a reference oligonucleotide or composition.
47. The method of any one of claims 37 to 46, wherein the level of SARM1 activity in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% compared to administration or delivery of a reference oligonucleotide or composition.
48. The method of any one of claims 45 to 47, wherein the reference oligonucleotide does not target SARM1, or the reference composition does not comprise an oligonucleotide targeting SARM1.
49. The method of any one of claims 45 to 48, wherein the reference oligonucleotide is or comprises a scrambled oligonucleotide, or the reference composition comprises a scrambled oligonucleotide.
50. The method of any one of claims 37 to 49, wherein the reduction is assessed at or after about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks after administration or delivery of the oligonucleotide or the composition.
51. The method of any one of claims 37 to 49, wherein the reduction is assessed at or after about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks after removing or washing the oligonucleotide or the composition.
52. The method of any one of claims 37 to 51, wherein the reduction is assessed in iPSC-derived motor neurons using an oligonucleotide at a concentration of about 20 uM in the case of naked delivery or as described in Example 5.
53. A method for preventing or treating a condition, disorder or disease, the method comprising administering or delivering an effective amount of the oligonucleotide or composition of any one of claims 1 to 36 to a subject susceptible to the condition, disorder or disease.
54. The method of claim 53, wherein the onset of the condition, disorder or disease is delayed or prevented.
55. A method for treating a condition, disorder or disease, the method comprising administering or delivering to a subject suffering from the condition, disorder or disease an effective amount of the oligonucleotide or composition of any one of claims 1 to 36.
56. The method of claim 55, wherein the severity of the symptoms of the condition, disorder or disease is reduced.
57. The method of any one of claims 55 to 56, wherein one or more clinical assessments of the subject independently improve.
58. The method of any one of claims 53 to 57, wherein the condition, disorder or disease is a neurodegenerative condition, disorder or disease, Wallerian degeneration, amyotrophic lateral sclerosis, peripheral neuropathy, chemotherapy-induced peripheral neuropathy, Parkinson's disease, Huntington's disease, Alzheimer's disease, frontotemporal dementia, traumatic brain injury, progressive supranuclear palsy, corticobasal degeneration, Wolfram Syndrome, Friedreich's Ataxia, multiple system atrophy, spinocerebellar ataxia, spinal muscular atrophy, Pick's disease, progressive motor atrophy, stroke, concussion, intracerebral hemorrhage, acute glaucoma, seizure and / or spinal cord injury.
59. The method of any one of claims 53 to 58, wherein the oligonucleotide or the composition is administered or delivered intrathecally and / or intravenously.
60. An oligonucleotide or composition according to any one of claims 1 to 36 for use in a method according to any one of claims 37 to 59 or for the preparation of a medicament for use in a method according to any one of claims 37 to 59.
61. An oligonucleotide, composition, or method according to any one of example embodiments 1 to 517.
Citation Information
Patent Citations
Chiral design
US10160969B2
Oligonucleotide compositions and methods thereof
US10450568B2
Oligonucleotide compositions and methods thereof
US10479995B2
Chiral design
US20170037399A1
Oligonucleotide compositions and methods thereof
US20180216107A1