RNAi agents for inhibiting complement component C3 (C3) expression, pharmaceutical compositions and methods of use thereof

Abstract

The present disclosure relates to RNAi agents, such as double-stranded RNAi agents or siRNAs, capable of inhibiting complement component C3 (C3) gene expression. Pharmaceutical compositions comprising the C3RNAi agents and methods of using the same are also disclosed. In some embodiments, the C3RNAi agents disclosed herein can be conjugated to targeting ligands, including ligands comprising N-acetylgalactosamine, to facilitate delivery to hepatocytes. Delivery of the C3RNAi agent in vivo provides inhibition of C3 gene expression. RNAi agents may be used to treat diseases, conditions, or symptoms mediated in part by C3 gene expression, including IgA nephropathy, C3 glomerulopathy, paroxysmal sleep hemoglobinuria, and / or other complement mediated nephropathy.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application Serial No. 63 / 381,200 filed on October 27, 2022, U.S. Provisional Patent Application Serial No. 63 / 486,944 filed on February 24, 2023, and U.S. Provisional Patent Application Serial No. 63 / 493,564 filed on March 31, 2023, the contents of each of which are incorporated herein by reference in their entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted in XML format and is incorporated herein by reference in its entirety. The XML copy is named 30698-WO1_SeqListing.xml, was created on October 25, 2023, and is 49kb in size. Technical Field

[0005] The present disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents or interfering RNA molecules, for inhibiting the expression of the complement component C3 (C3) gene, pharmaceutical compositions comprising C3 RNAi agents, and methods of using the same for treating C3-related diseases and disorders, including complement-mediated renal diseases (CMRDs), such as IgA nephropathy (IgAN) and C3 glomerulopathy (C3G). Background Art

[0006] The complement cascade is an important part of the innate immune system and is known to consist of three different pathways: the alternative pathway, the classical pathway, and the lectin pathway. Each of the three main pathways of complement activity can play an important role in the pathogenesis of various diseases. Some of the main functions of the complement system include orchestrating opsonization, promoting cytotoxic destruction and formation of membrane attack complexes, and releasing peptides that promote inflammatory responses. For example, in Garred et al., Pharmacol. Rev. 73: 792–827, April 2021 (see, for example, Figure 1 An overview of the complement system focusing on relevant targets for therapeutic inhibition is described in . One of the identified targets of the complement system, complement component C3, is believed to be involved in the pathogenesis of certain diseases, including but not limited to paroxysmal nocturnal hemoglobinuria (PNH) and complement-mediated renal diseases (CMRD), such as IgA nephropathy (IgAN) and C3 glomerulopathy (C3G).

[0007] Currently, there are very limited or no treatment options for various diseases associated with dysregulated complement activity. For both IgAN and C3G, there are no approved drugs available in the United States. For other complement-related diseases, such as PNH, despite commercially available treatments, there are still large unmet medical needs for many patients due to the limitations of approved therapies and their respective mechanisms of action. For example, the monoclonal antibodies eculizumab and ravulizumab are inhibitors of complement component C5, which have been approved for the treatment of PNH, but require a 2 to 3 hour intravenous infusion every 2 weeks to 2 months, and because they act more distally in the cascade (C5, not C3), they are unable to block all effector pathways of complement activation. In addition, pegcetacoplan is a therapeutic peptide designed to inhibit C3, which requires approximately 1 gram of the drug in 20 ml to be administered via a subcutaneous infusion pump, where the infusion occurs over the course of an hour and must be administered twice a week.

[0008] In recent clinical trials, both pegcetacoplan and the factor B inhibitor iptacopan were shown to be superior to the C5 inhibitor (eculizumab) alone in improving hemoglobin, clinical, and hematological outcomes in patients with PNH (Hillmen, N Engl J Med. 2021, 384(11):1028-37; Peffault de Latour, Blood 2022, 140(Suppl 2):LBA–2; Risitano, Lancet Haematol. 2021, 8(5):e344-e354). These studies, along with the growing recognition of the importance of C3 and the alternative complement pathway in conditions such as PNH, C3G, and IgAN, provide a strong rationale for targeting the proximal alternative complement pathway, and particularly C3, as a therapeutic strategy for these conditions.

[0009] Therefore, there remains a need for highly active, durable, and safe therapeutic agents that can inhibit C3 and the complement cascade more proximally. Although multiple publications have proposed interfering RNA molecules targeting C3, none, prior to the present disclosure, have demonstrated the difficult-to-achieve combination of sufficient gene expression inhibition activity to provide therapeutic benefit; a suitable safety profile to enable its use as a therapeutic agent in humans; and suitable durability to enable its use with infrequent administration to address compliance issues for some patients who have difficulty with any currently approved therapy. Summary of the Invention

[0010] Disclosed herein is an RNAi agent for inhibiting C3 gene expression, comprising:

[0011] an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of one of the antisense strand sequences of Table 2, and

[0012] a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand,

[0013] wherein all or substantially all nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and wherein the RNAi agent is linked to a targeting ligand comprising N-acetylgalactosamine.

[0014] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides that differ by 0 or 1 nucleotide from the 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5C, Table 7B, or Table 8, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand over the 15 contiguous nucleotides.

[0015] In some embodiments, at least one nucleotide of the RNAi agent includes a modified internucleoside linkage.

[0016] In some embodiments, the modified nucleotides of the C3 RNAi agents disclosed herein are selected from the group consisting of 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′,3′-open ring nucleotide mimics, locked nucleotides, 2′-F-arabino nucleotides, 2′-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2′-O-methyl nucleotides, inverted 2′-deoxy nucleotides, 2′-amino modified nucleotides, 2′-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3′-O-methyl nucleotides.

[0017] In other embodiments, all or substantially all modified nucleotides of the RNAi agents disclosed herein are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0018] In some embodiments, the antisense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified antisense strand sequences in Table 3.

[0019] In some embodiments, the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified sense strand sequences of Table 4.

[0020] In some embodiments, the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4.

[0021] The RNAi agents disclosed herein are linked to a targeting ligand comprising N-acetylgalactosamine. In further embodiments, the targeting ligand is linked to the sense strand. In some embodiments, the targeting ligand is linked to the 5′ end of the sense strand.

[0022] In some embodiments, the sense strand is between 15 and 30 nucleotides in length, and the antisense strand is between 21 and 30 nucleotides in length. In other embodiments, the sense strand and antisense strand are each between 21 and 27 nucleotides in length. In other embodiments, the sense strand and antisense strand are each between 21 and 24 nucleotides in length. In yet other embodiments, the sense strand and antisense strand are each 21 nucleotides in length.

[0023] In some embodiments, the RNAi agent has two blunt ends.

[0024] In some embodiments, the sense strand comprises one or two terminal caps. In other embodiments, the sense strand comprises one or two inverted abasic residues.

[0025] In some embodiments, the RNAi agent comprises the sense and antisense strands of a duplex sequence that forms a duplex structure shown in Tables 5A, 5B, 5C, or 8.

[0026] In some embodiments, the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

[0027] In further embodiments, the targeting ligand comprises or consists of:

[0028]

[0029]

[0030] Also disclosed herein are compositions comprising the disclosed RNAi agents, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0031] Furthermore, provided herein are methods of inhibiting C3 gene expression in hepatocytes of a human subject in vivo, the methods comprising introducing into the subject an effective amount of a disclosed C3 RNAi agent or a disclosed composition.

[0032] Further provided herein are methods of treating a C3-related disease, disorder, or symptom comprising administering to a human subject in need thereof a therapeutically effective amount of the disclosed compositions.

[0033] In some embodiments, the disease is IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria.

[0034] In some embodiments, the RNAi agent is administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight. In some embodiments, the C3 RNAi agent disclosed herein is administered as a fixed dose in a single injection comprising about 25 mg, 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg of a C3 RNAi agent drug substance as described in Table 8.

[0035] Also provided herein are uses of the disclosed RNAi agents or disclosed compositions for treating a disease, disorder, or symptom associated with complement dysregulation.

[0036] Further provided herein is the use of a disclosed RNAi agent or a disclosed composition for the preparation of a pharmaceutical composition for treating a disease, disorder, or symptom mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 . Graph showing serum cynomolgus monkey C3 protein levels normalized to pre-dose levels, according to the studies described in Example 2.

[0038] Figure 2 Graph showing the percentage of pre-dose hemolytic activity in cynomolgus monkeys based on the studies described in Example 2.

[0039] Figure 3 Preliminary clinical trial study design and dose escalation schedule for the normal healthy volunteer portion (Part 1) of the Phase I / II clinical study described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0040] Figure 4 Preliminary clinical trial study design and dose escalation schedule for the patient cohort (Part 2) of the Phase I / II clinical study described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0041] Figure 5 Graph showing absolute levels of serum cynomolgus monkey C3a protein, based on the studies described in Example 2.

[0042] Figure 6 Graph showing the percentage of pre-dose C3a protein levels in cynomolgus monkeys, according to the studies described in Example 2.

[0043] Figure 7Updated clinical trial study design and dose escalation schedule for the single ascending dose (SAD) normal healthy volunteer (NHV) portion (Part 1) of the Phase I / II clinical study described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0044] Figure 8 Updated clinical trial study design and dose escalation schedule for the multiple ascending dose (MAD) NHV portion (Part 1) of the Phase I / II clinical study described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0045] Figure 9 Updated clinical trial study design and dose escalation schedule for the PNH patient cohort (Part 2) of the Phase I / II clinical study described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0046] Figure 10 Updated clinical trial study design and dose escalation schedule for the C3G and IgAN patient cohorts (Part 2) of the Phase I / II clinical study (Part 2) described in Example 3. "ARO-C3" refers to the formulated C3 RNAi drug substance.

[0047] Figure 9 Graph showing serum human C3 protein levels in normal human volunteers (NHV) from subjects in the single ascending dose (SAD) portion of the Phase I / II clinical study described in Example 3.

[0048] Figure 11 Graph showing serum human C3 protein levels in normal human volunteers (NHV) from subjects in the multiple ascending dose (MAD) portion of the Phase I / II clinical study described in Example 3.

[0049] Figure 12 Graph showing serum human C3 protein levels in normal human volunteers (NHV) from subjects in the multiple ascending dose (MAD) portion of the Phase I / II clinical study described in Example 3.

[0050] Figure 13 Graph showing AH50 (U / mL) in individual subjects who received 400 mg of formulated C3 RNAi drug substance or placebo on Day 1 and Day 29 from the multiple ascending dose (MAD) portion of the Phase I / II clinical study described in Example 3 in normal human volunteers (NHV).

[0051] Figure 14. Shows the single ascending dose (SAD) portion of the Phase I / II clinical study described in Example 3 in normal human volunteers (NHV) Graph of AP assay results. Results were calculated according to the manufacturer's protocol using negative and positive control samples.

[0052] Figure 15 . Shows the normal human volunteers (NHV), from the multiple ascending dose (MAD) part of the Phase I / II clinical study described in Example 3 Graph of AP assay results. Results were calculated according to the manufacturer's protocol using negative and positive control samples.

[0053] Figures 16A to 16D Chemical structure of the C3 RNAi drug substance shown in free acid form (see, e.g., Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)).

[0054] Figures 17A to 17D Chemical structure of the C3 RNAi drug substance shown in sodium salt form (see, e.g., Table 8; RNAi agent AD09546 (SEQ ID NO: 14 / 13)).

[0055] Figure 18 Schematic diagram of the modified sense and antisense strands of a C3 RNAi agent having the structure of AD09546 (see, e.g., Tables 3, 4A, and 5C), wherein AD09546 has a tridentate N-acetylgalactosamine targeting group at the 5′ end of the sense strand. The following abbreviations are used in FIG16 : a, c, g, and u are 2′-O-methyl modified nucleotides; Af, Cf, Gf, and Uf are 2′-fluoro modified nucleotides; o is a phosphodiester linkage; s is a phosphorothioate linkage; invAb is an inverted abasic residue (see, e.g., Table 6), and NAG37s is a tridentate N-acetylgalactosamine targeting ligand having the following chemical structure:

[0056]

[0057] (shown as sodium salt),

[0058]

[0059] (Shown as free acid form).

[0060] 17A to 17D

[0061] Figure 18 A to Figure 18 D DETAILED DESCRIPTION

[0062] The disclosed RNAi agents, compositions and methods of use thereof may be more readily understood with reference to the following detailed description (which constitutes a part of the present disclosure). It should be understood that the present disclosure is not limited to what is specifically described and / or shown herein, and that the terms used herein are intended only to illustrate specific embodiments and are not intended to be limiting.

[0063] It should be understood that although certain features of the present disclosure contained herein are described herein in the context of separate embodiments for the sake of clarity, they may also be provided in combination in a single embodiment. Conversely, various features of the disclosed methods that are described in the context of a single embodiment for the sake of brevity may also be provided separately or in any subcombination.

[0064] definition

[0065] As used herein, "RNAi agent" refers to a composition containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules that can degrade or inhibit (e.g., degrade or inhibit under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. RNAi agents as used herein can act through an RNA interference mechanism (i.e., by inducing RNA interference by interacting with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells) or through any alternative mechanism or pathway. Although it is believed that the term RNAi agent as used herein plays a role primarily through an RNA interference mechanism, the disclosed RNAi agents are not constrained or limited by any particular pathway or mechanism of action. RNAi agents disclosed herein include sense and antisense strands, and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., C3 mRNA). The RNAi agent can comprise one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0066] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown" when referring to the expression of a given gene mean that when a cell, cell population, tissue, organ, or subject is treated with a RNAi agent described herein, the expression of the gene is reduced as measured by the level of RNA transcribed from the gene or the level of a polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, compared to a second cell, cell population, tissue, organ, or subject that has not been so treated.

[0067] As used herein, the terms "sequence" and "nucleotide sequence" refer to a continuous sequence or order of nucleobases or nucleotides, which are described as a continuous sequence of letters using standard nomenclature. A nucleic acid molecule may comprise unmodified and / or modified nucleotides. A nucleotide sequence may comprise unmodified and / or modified nucleotides.

[0068] As used herein, "base," "nucleotide base," or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide and includes the major purine bases adenine and guanine, and the major pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified, including but not limited to universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases, including phosphoramidite compounds comprising modified nucleobases, is known in the art.

[0069] As used herein, the term "nucleotide" has the same meaning as that generally understood in the art. Therefore, as used herein, the term "nucleotide" refers to a glycoside comprising a sugar moiety, a base moiety, and a covalent linking group (linking group) such as a phosphate or thiophosphate internucleoside linking group, and encompasses both naturally occurring nucleotides (such as DNA or RNA) and non-naturally occurring nucleotides (also referred to herein as nucleotide analogs) comprising modified sugar and / or base moieties. Herein, a single nucleotide may be referred to as a monomer or unit.

[0070] As used herein, and unless otherwise indicated, the term "complementary" when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or a targeted mRNA) relative to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or a single-stranded antisense oligonucleotide) refers to the ability of an oligonucleotide or polynucleotide comprising a first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a duplex or double helical structure with an oligonucleotide comprising a second nucleotide sequence under certain standard conditions. One of ordinary skill in the art will be able to select the set of conditions that best suits the hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics to at least the extent that they meet the above hybridization requirements. Sequence identity or complementarity is independent of modification. For example, for the purpose of determining identity or complementarity, a and Af as defined herein are complementary to U (or T) and identical to A.

[0071] As used herein, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in the contiguous sequence of the first oligonucleotide will hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0072] As used herein, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70% (but not all) of the bases in the contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0073] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85% (but not all) of the bases in the contiguous sequence of a first oligonucleotide will hybridize to the same number of bases in the contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0074] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used with respect to matched nucleobases or nucleotides between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the MUC5AC mRNA sequence.

[0075] As used herein, the terms "substantially identical" or "substantial identity" when applied to nucleic acid sequences refer to a nucleotide sequence (or a portion of a nucleotide sequence) that has at least about 85% sequence identity or more, such as at least 90%, at least 95%, or at least 99% identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base appears in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein.

[0076] As used herein, the terms "individual," "patient," and "subject" are used interchangeably to refer to a member of any animal species, including but not limited to birds, humans and other primates, and other mammals, including commercially relevant mammals or animal models such as mice, rats, monkeys, cows, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0077] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief of one or more symptoms of a disease or a reduction in the number, severity, and / or frequency of the disease in a subject. As used herein, "treat" and "treatment" may include preventing, controlling, prophylactic treatment, and / or inhibiting or reducing the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0078] As used herein, the phrase "introduced into a cell" when referring to an RNAi agent refers to the functional delivery of the RNAi agent to the cell. The phrase "functional delivery" refers to the delivery of the RNAi agent to the cell in a manner that enables the RNAi agent to have the desired biological activity (e.g., sequence-specific inhibition of gene expression).

[0079] Unless otherwise specified, the symbols used in this document are The use of means that any one or more groups may be attached thereto, consistent with the scope of the invention described herein.

[0080] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms, or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers." Stereoisomers that are not mirror images of one another are termed "diastereomers," and stereoisomers that are non-superimposable mirror images of one another are termed "enantiomers," or sometimes optical isomers. A carbon atom bonded to four different substituents is termed a "chiral center."

[0081] As used herein, unless a structure explicitly indicates a specific conformation, for each structure that has asymmetric centers and thus produces enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as individual stereoisomers.

[0082] As used in the claims herein, the phrase "consisting of excludes any element, step, or ingredient not specified in the claim. When used in the claims herein, the phrase "consisting essentially of limits the scope of the claim to the specified materials or steps, and to those materials or steps that do not materially affect the basic and novel characteristics of the claimed invention.

[0083] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) that are in a protonated or deprotonated state, depending on the environment in which the compound or composition is located. Thus, as used herein, the structures disclosed herein contemplate certain functional groups that may be protonated or deprotonated, such as OH, SH, or NH. As those skilled in the art will readily understand, the disclosure herein is intended to encompass the disclosed compounds and compositions, regardless of their protonation state based on the environment (such as pH). Accordingly, the compounds described herein with unstable protons or basic atoms are also understood to represent salt forms of the corresponding compounds. The compounds described herein may be in free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein are understood to be within the scope of the present invention.

[0084] As used herein, the terms "linked" or "conjugated" when referring to a connection between two compounds or molecules refer to the connection of the two compounds or molecules by a covalent bond. Unless otherwise specified, as used herein, the terms "linked" and "conjugated" may refer to a connection between a first compound and a second compound with or without any intermediate atoms or groups of atoms.

[0085] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." The term "or" is used herein to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise.

[0086] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. Although methods and materials similar or equivalent to the methods and materials described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of conflict, this specification (including definitions) shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be limiting.

[0087] Where a value is explicitly enumerated, it is understood that values having approximately the same quantity or amount as the enumerated value are also within the scope of the present disclosure. Where a combination is disclosed, each subcombination of elements in the combination is also explicitly disclosed and is within the scope of the present disclosure. Conversely, where different elements or groups of elements are disclosed individually, combinations thereof are also disclosed. Where any element of the present disclosure is disclosed as having multiple alternatives, examples of the present disclosure in which each alternative is excluded, either individually or in any combination with other alternatives, are also disclosed; more than one element of the present disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed.

[0088] Other objects, features, aspects and advantages of the present invention will become apparent from the following detailed description, drawings and claims. DETAILED DESCRIPTION

[0089] RNAi agents

[0090] RNAi agents for inhibiting C3 gene expression are described herein. Each C3 RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 21 to 49 nucleotides in length. The sense strand and antisense strand can be the same length, or they can be different lengths. In some embodiments, the sense strand and antisense strand are each independently 21 to 27 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, while the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is approximately 21 nucleotides in length, while the antisense strand is approximately 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length, while the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand and antisense strand are each 21 nucleotides in length. In some embodiments, the length of the RNAi agent antisense strand is each independently 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the RNAi agent sense strand is each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. The sense and antisense strands anneal to form a duplex, and in some embodiments, the double-stranded RNAi agent has a duplex length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0091] Examples of nucleotide sequences used to form C3 RNAi agents are provided in Tables 2, 3, 4, 5C, 7A, 7B, and 8. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, 4, 5C, 7A, and 7B are shown in Tables 5A, 5B, 5C, and 8.

[0092] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense and antisense strands is 15-26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., the region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0093] The sense strand of the C3 RNAi agent described herein comprises at least 15 consecutive nucleotides that are at least 85% identical to a core stretch sequence (also referred to herein as a "core stretch" or "core sequence") of the same number of nucleotides in the C3 mRNA. In some embodiments, the sense strand core stretch sequence is 100% (completely) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is generally identical or at least about 85% identical to a nucleotide sequence of the same length present in the C3 mRNA target (sometimes referred to as, for example, a target sequence). In some embodiments, the sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length. In some embodiments, the sense strand core stretch is 21 nucleotides in length.

[0094] The antisense strand of the C3 RNAi agent described herein comprises at least 15 consecutive nucleotides that are at least 85% complementary to a core segment of the same number of nucleotides in the C3 mRNA and to a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the C3 mRNA target (e.g., a target sequence). In some embodiments, the antisense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core segment is 21 nucleotides in length. In some embodiments, the antisense strand core segment is 19 nucleotides in length. The sense strand core segment sequence can be the same length as the corresponding antisense core sequence, or it can be a different length.

[0095] The sense and antisense strands of the C3 RNAi agent anneal to form a duplex. The sense and antisense strands of the C3 RNAi agent can be partially, substantially, or completely complementary to each other. Within the complementary duplex region, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In some embodiments, the sense strand core segment sequence comprises a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides that is at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequence of the antisense strand core segment sequence (i.e., the sense and antisense core segment sequences of the C3 RNAi agent have a region that is at least 85% base paired or 100% base paired of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides).

[0096] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0097] In some embodiments, the sense strand and / or antisense strand may optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both the 3' and 5' ends of the core segment sequence. The additional nucleotides of the antisense strand, if present, may be complementary or non-complementary to the corresponding sequence in the C3 mRNA. The additional nucleotides of the sense strand, if present, may be identical or different to the corresponding sequence in the C3 mRNA. The additional nucleotides of the antisense strand, if present, may be complementary or non-complementary to the additional nucleotides of the corresponding sense strand, if present.

[0098] As used herein, the extension is comprised of 1, 2, 3, 4, 5 or 6 nucleotides at the 5' and / or 3' ends of the sense strand core segment sequence and / or the antisense strand core segment sequence. The extended nucleotides on the sense strand may be complementary or non-complementary to the nucleotides in the corresponding antisense strand (core segment sequence nucleotides or extended nucleotides). Conversely, the extended nucleotides on the antisense strand may be complementary or non-complementary to the nucleotides in the corresponding sense strand (core segment nucleotides or extended nucleotides). In some embodiments, both the sense strand and the antisense strand of the RNAi agent comprise 3' and 5' extensions. In some embodiments, one or more of the 3' extended nucleotides of one chain are base paired with one or more 5' extended nucleotides of the other chain. In other embodiments, one or more of the 3' extended nucleotides of one chain are not base paired with one or more 5' extended nucleotides of the other chain. In some embodiments, the C3 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form an overhang. As used herein and in the art, "overhang" refers to a stretch of one or more unpaired nucleotides at the end of the sense or antisense strand that does not form part of the hybridized or double-stranded portion of the RNAi agents disclosed herein.

[0099] In some embodiments, the C3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the C3 RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are complementary to the corresponding C3 mRNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises nucleotides that are not complementary to the corresponding C3 mRNA sequence.

[0100] In some embodiments, the C3 RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide corresponding to or identical to a nucleotide in the C3 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited thereto: T, UT, TT, UU, UUT, TTT, or TTTT (all listed from 5' to 3').

[0101] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the C3 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises nucleotides corresponding to or identical to nucleotides in the C3 mRNA sequence.

[0102] Examples of sequences for forming C3 RNAi agents are provided in Tables 2, 3, 4, 5C, 7A, 7B, and 8. In some embodiments, the C3 RNAi agent antisense strand comprises the sequence of any of the sequences in Tables 2, 3, 5C, 7A, or 8. In certain embodiments, the C3 RNAi agent antisense strand comprises or consists of any of the modified sequences in Table 3. In some embodiments, the C3 RNAi agent antisense strand comprises the sequence of nucleotides (from 5' end → 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Tables 2, 3, 5C, 7A, or 8. In some embodiments, the C3 RNAi agent sense strand comprises the sequence of any of the sequences in Tables 2, 4, 5C, 7B, or 8. In some embodiments, the sense strand of the C3 RNAi agent comprises a sequence of nucleotides (from 5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any sequence in Tables 2, 4, 5C, 7B, or 8. In certain embodiments, the sense strand of the C3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4.

[0103] In some embodiments, the sense strand and antisense strand of RNAi agents described herein comprise the same number of nucleotides. In some embodiments, the sense strand and antisense strand of RNAi agents described herein comprise different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of RNAi agent form a flat end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of RNAi agent form a flat end. In some embodiments, both ends of RNAi agent form a flat end. In some embodiments, both ends of RNAi agent are not flat ends. " Flat end" as used herein refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of two annealed chains are complementary (forming complementary base pairs).

[0104] In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, both ends of the RNAi agent are not frayed ends. As used herein, frayed ends refer to the ends of double-stranded RNAi agents in which the terminal nucleotides of the two annealed chains are paired (i.e., do not form overhangs), but are not complementary (i.e., form non-complementary pairs). In some embodiments, one or more unpaired nucleotides at the end of one chain of the double-stranded RNAi agent form overhangs. Unpaired nucleotides can form 3' or 5' overhangs on the sense or antisense strands. In some embodiments, the RNAi agent comprises: one blunt end and one floppy end, one blunt end and one 5' overhang, one blunt end and one 3' overhang, one floppy end and one 5' overhang, one floppy end and one 3' overhang, two 5' overhangs, two 3' overhangs, one 5' overhang and one 3' overhang, two floppy ends, or two blunt ends. Typically, when an overhang is present, it is located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0105] The C3 RNAi agents disclosed herein may also comprise one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the C3 RNAi agent are modified nucleotides. The C3 RNAi agents disclosed herein may further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate linkages. In some embodiments, the C3 RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2′-modified nucleotides are combined with modified internucleoside linkages.

[0106] In some embodiments, the C3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the C3 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the C3 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.

[0107] Modified nucleotides

[0108] Modified nucleotides, when used in various oligonucleotide constructs, can retain the activity of the compounds in cells while increasing the serum stability of these compounds and can also minimize the potential for activation of interferon activity in humans following administration of the oligonucleotide constructs.

[0109] In some embodiments, the C3 RNAi agent contains one or more modified nucleotides. As used herein, "modified nucleotides" refers to nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2', 3'-open ring nucleotide mimics (non-locked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me, 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to herein or in the art as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary that all positions in a given compound be uniformly modified. Rather, more than one modification may be incorporated into a single C3 RNAi agent or even a single nucleotide thereof. The sense and antisense strands of the C3 RNAi agent may be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0110] Modified nucleobases include synthetic and natural nucleobases such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymidine, 2-thiouracil, 2-thiothymidine, 2-thiothreitol ... adenine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0111] In some embodiments, the 5' and / or 3' end of the antisense strand may comprise an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide". An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar portion. In some embodiments, the abasic residue may be placed inside the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may comprise one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb or Ab may be added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue may be replaced by a ribitol (abasic ribose) residue.

[0112] In some embodiments, all or substantially all nucleotides of RNAi agent are modified nucleotides. As used herein, the RNAi agent wherein substantially all nucleotides present are modified nucleotides is an RNAi agent having four or less (i.e. 0, 1, 2, 3 or 4) nucleotides in both sense strand and antisense strand as ribonucleotides (i.e., unmodified). As used herein, the sense strand wherein substantially all nucleotides present are modified nucleotides is an sense strand having two or less (i.e. 0, 1 or 2) nucleotides in the sense strand as unmodified ribonucleotides. As used herein, the antisense strand wherein substantially all nucleotides present are modified nucleotides is an antisense strand having two or less (i.e. 0, 1 or 2) nucleotides in the sense strand as unmodified ribonucleotides. In some embodiments, one or more nucleotides of RNAi agent are unmodified ribonucleotides. The chemical structure of some modified nucleotides is shown in Table 6 herein.

[0113] Modified internucleoside linkages

[0114] In some embodiments, one or more nucleotides of a C3 RNAi agent are linked by a non-standard linkage or backbone (ie, a modified internucleoside linkage or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, borophosphates with normal 3'-5' linkages, borophosphate analogs with 2'-5' linkages, or borophosphates with inverted polarity (wherein adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'). In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. The modified internucleoside linkage lacking a phosphorus atom includes, but is not limited to, linkage between short-chain alkyl or cycloalkyl sugars, linkage between mixed heteroatoms and alkyl or cycloalkyl sugars, or linkage between one or more short-chain heteroatoms or heterocyclic sugars. In some embodiments, the modified internucleoside backbone includes, but is not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, olefin-containing backbones, sulfamic ester backbones, methyleneimino and methylenehydrazine backbones, sulfonic ester backbones and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 components.

[0115] In some embodiments, the sense strand of the C3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the C3 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the C3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the C3 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0116] In some embodiments, the sense strand of the C3 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 of the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not comprise any phosphorothioate internucleoside linkages between nucleotides, but contains one, two, or three phosphorothioate linkages between the terminal nucleotides on the 5' and 3' ends and the optionally present inverted abasic residue end cap. In some embodiments, the targeting ligand is connected to the sense strand via a phosphorothioate linkage.

[0117] In some embodiments, the antisense strand of the C3 RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides at positions 1-3 of the 5' end of the antisense strand, and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 of the 5' end. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 of the 5' end of the antisense strand, and the fourth phosphorothioate internucleoside linkage is located between positions 20-21 of the 5' end of the antisense strand. In some embodiments, the C3 RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.

[0118] Capping residues or moieties

[0119] In some embodiments, the sense strand may comprise one or more capping residues or moieties, sometimes referred to in the art as "caps", "end caps" or "capping residues". As used herein, "capping residues" are non-nucleotide compounds or other moieties that can be incorporated at one or more ends of the nucleotide sequence of the RNAi agents disclosed herein. In some cases, capping residues can provide certain beneficial properties to the RNAi agent, for example, protection from exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue. (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are generally known in the art and include, for example, inverted abasic residues as well as carbon chains, such as terminal C3H7 (propyl), C6H 13 (Hexyl) or C 12 H25 (dodecyl). In some embodiments, the capping residue is present at the 5′ end, the 3′ end, or both the 5′ and 3′ ends of the sense strand. In some embodiments, the 5′ end and / or the 3′ end of the sense strand may contain more than one inverted abasic deoxyribose moiety as a capping residue.

[0120] In some embodiments, one or more reverse abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more reverse abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more reverse abasic residues or reverse abasic sites are inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. In some embodiments, one or more reverse abasic residues or reverse abasic sites are included at or near one or more ends of the sense strand of the RNAi agent to enable enhanced RNAi agent activity or other desired properties.

[0121] In some embodiments, one or more reverse abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more reverse abasic residues can be inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. Reverse abasic residues can be connected by phosphate, phosphorothioate (for example, shown as (invAb) s herein) or other internucleoside connections. In some embodiments, one or more reverse abasic residues are included at or near one or more ends of the sense strand of the RNAi agent to make it possible for the RNAi agent activity or other desired characteristics to be enhanced. In some embodiments, reverse abasic (deoxyribose) residues can be replaced by reverse ribitol (absic ribose) residues. In some embodiments, the 3' end of the antisense strand core segment sequence, or the 3' end of the antisense strand sequence can include reverse abasic residues. The chemical structure of reverse abasic deoxyribose residues is shown in Table 6 below.

[0122] C3 RNAi agent

[0123] The C3 RNAi agents disclosed herein are designed to target a specific location on the C3 gene (eg, SEQ ID NO: 1).

[0124] NM_000064.4 Homo sapiens complement C3, mRNA transcript (SEQ ID NO: 1):

[0125]

[0126]

[0127]

[0128]

[0129] As defined herein, an antisense sequence designed to target the C3 gene at a given position on the C3 gene requires that, when base-paired with the gene, the 5′-terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream of that position on the gene. For example, as shown in Tables 1 and 2 herein, an antisense sequence designed to target the C3 gene at position 2566 requires that, when base-paired with the gene, the 5′-terminal nucleobase of the antisense strand is aligned with position 2586 of the C3 gene.

[0130] As provided herein, C3 RNAi agents do not require that the nucleobase at position 1 (5′→3′) of the antisense strand be complementary to the gene, provided that the antisense strand has at least 85% complementarity to the gene over a core segment sequence of at least 15 consecutive nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). For example, for a C3 RNAi agent designed to target position 2566 of the C3 gene disclosed herein, the 5′-terminal nucleobase of the antisense strand of the C3 RNAi agent must be aligned with position 2586 of the gene; however, the 5′-terminal nucleobase of the antisense strand can, but is not required to, be complementary to position 2586 of the C3 gene, provided that the antisense strand has at least 85% complementarity to the gene over a core segment sequence of at least 15 contiguous nucleotides (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity). As shown in the examples disclosed herein and as is known in the art, the specific site at which the antisense strand of a C3 RNAi agent binds to a gene (e.g., whether the C3 RNAi agent is designed to target the C3 gene at position 2566 or at another position) is crucial for the level of inhibition achieved by the C3 RNAi agent and the toxicity profile achieved by the molecule (see, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0131] In some embodiments, the C3 RNAi agents disclosed herein target the C3 gene at or near the location of the C3 gene sequence shown in Table 1. In some embodiments, the antisense strand of the C3 RNAi agents disclosed herein includes a core segment sequence that is completely, substantially, or at least partially complementary to the target C3 21-mer sequence disclosed in Table 1.

[0132] Table 1. C3 21-mer mRNA target sequence (taken from Homo sapiens complement C3, mRNA, GenBank NM_000064.4 (SEQ ID NO: 1))

[0133]

[0134] In some embodiments, the C3 RNAi agent comprises an antisense strand, wherein position 21 (5′→3′) of the antisense strand is capable of forming a base pair with position 1 of the 21-mer target sequence disclosed in Table 1. In some embodiments, the C3 RNAi agent comprises an antisense strand, wherein position 1 (5′→3′) of the antisense strand is capable of forming a base pair with position 21 of the 21-mer target sequence disclosed in Table 1.

[0135] In some embodiments, the C3 RNAi agent comprises an antisense strand, wherein position 2 (5′→3′) of the antisense strand is capable of forming a base pair with position 20 of the 21-mer target sequence disclosed in Table 1. In some embodiments, the C3 RNAi agent comprises an antisense strand, wherein positions 2 to 18 (5′→3′) of the antisense strand are capable of forming a base pair with each of the corresponding complementary bases located at positions 18 to 2 of the 21-mer target sequence disclosed in Table 1.

[0136] For the RNAi agents disclosed herein, the nucleotide at position 1 (from 5' end to 3' end) of the antisense strand may be completely complementary to the C3 gene, or may not be complementary to the C3 gene. In some embodiments, the nucleotide at position 1 (from 5' end to 3' end) of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (from 5' end to 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0137] In some embodiments, the C3 RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 2-18, 2-19, 2-20, or 2-21 of any antisense strand sequence in Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the C3 RNAi sense strand comprises a sequence of nucleotides (from 5' end → 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0138] In some embodiments, the C3 RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 2-18, 2-19, 2-20, or 2-21 of any antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8. In some embodiments, the C3 RNAi sense strand comprises a sequence of nucleotides (from 5' end → 3' end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence of Table 2, Table 4, Table 5C, Table 7B, or Table 8.

[0139] In some embodiments, the C3 RNAi agent comprises: (i) an antisense strand comprising a sequence of nucleotides (from 5′ end → 3′ end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand comprising a sequence of nucleotides (from 5′ end → 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Table 2 or Table 4.

[0140] In some embodiments, the C3 RNAi agent comprises: (i) an antisense strand comprising a sequence of nucleotides (from 5′ end → 3′ end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3; and (ii) a sense strand comprising a sequence of nucleotides (from 5′ end → 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 of any sense strand sequence in Table 2 or Table 4.

[0141] In some embodiments, the C3 RNAi agent includes the core 21-mer nucleotide sequence shown in Table 2 below.

[0142]

[0143] The sense and antisense strands of the C3 RNAi agent comprising or consisting of a sequence in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the C3 RNAi agent having a sense and antisense strand sequence comprising or consisting of a sequence in Table 2 is entirely or substantially entirely modified nucleotides.

[0144] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0145] As used herein, each N listed in the sequence disclosed in Table 2 can be independently selected from any and all core bases (including those found on modified nucleotides and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases that are complementary to the N nucleotides at corresponding positions on the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases that are not complementary to the N nucleotides at corresponding positions on the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases identical to the N nucleotides at corresponding positions on the other chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases different from the N nucleotides at corresponding positions on the other chain.

[0146] Certain modified C3 RNAi agent antisense strands, and their base unmodified nucleobase sequences are provided in Table 3. Certain modified C3 RNAi agent sense strands, and their base unmodified nucleobase sequences are provided in Table 4. In forming the C3 RNAi agent, each nucleotide in each base base sequence listed in Tables 3 and 4 above and Table 2 can be a modified nucleotide.

[0147] The C3 RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand comprising a sequence listed in Table 2 or Table 4 can hybridize with an antisense strand comprising any sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0148] In some embodiments, the antisense strand of the C3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0149] In some embodiments, the C3 RNAi agent comprises or consists of a duplex having a nucleobase sequence of the sense and antisense strands of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, the C3 RNAi agent comprises or consists of a duplex sequence prepared or provided as a sodium salt, a mixed salt, or a free acid.

[0150] Examples of antisense strands containing modified nucleotides are provided in Table 3 and Table 5C. Examples of sense strands containing modified nucleotides are provided in Table 4 and Table 5C.

[0151] As used in Tables 3, 4, 5C, 7A, 7B, and 8, the following symbols are used to represent modified nucleotides and linking groups:

[0152] A = adenosine-3′-phosphate;

[0153] C = cytidine-3′-phosphate;

[0154] G = guanosine-3′-phosphate;

[0155] U = uridine-3′-phosphate

[0156] a=2′-O-methyladenosine-3′-phosphate

[0157] as = 2′-O-methyladenosine-3′-phosphorothioate

[0158] c = 2′-O-methylcytidine-3′-phosphate

[0159] cs = 2′-O-methylcytidine-3′-phosphorothioate

[0160] g = 2′-O-methylguanosine-3′-phosphate

[0161] gs = 2′-O-methylguanosine-3′-phosphorothioate

[0162] u = 2′-O-methyluridine-3′-phosphate

[0163] us = 2′-O-methyluridine-3′-phosphorothioate

[0164] Af = 2′-fluoroadenosine-3′-phosphate

[0165] Afs = 2′-fluoroadenosine-3′-phosphorothioate

[0166] Cf = 2′-fluorocytidine-3′-phosphate

[0167] Cfs = 2′-fluorocytidine-3′-phosphorothioate

[0168] Gf = 2′-fluoroguanosine-3′-phosphate

[0169] Gfs = 2′-fluoroguanosine-3′-phosphorothioate

[0170] Uf = 2′-fluorouridine-3′-phosphate

[0171] Ufs = 2′-fluorouridine-3′-phosphorothioate

[0172] (invAb) = inverted abasic deoxyribonucleotide, see Table 6

[0173] (invAb)s = inverted abasic deoxyribonucleotide-5′-phosphorothioate, see Table 6

[0174] cPrpa = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-phosphate (see Table 6)

[0175] cPrpas = 5′-cyclopropylphosphonate-2′-O-methyladenosine-3′-phosphorothioate (see Table 6)

[0176] cPrpu = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-phosphate (see Table 6)

[0177] cPrpus = 5′-cyclopropylphosphonate-2′-O-methyluridine-3′-phosphorothioate (see Table 6)

[0178] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), when present in an oligonucleotide, the nucleotide monomers are interconnected by 5'-3'-phosphodiester bonds. As will be clearly understood by those skilled in the art, as shown in the modified nucleotide sequences disclosed herein, the inclusion of phosphorothioate linkages replaces the phosphodiester linkages typically present in oligonucleotides. Furthermore, it will be readily understood by those skilled in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence in vitro will typically have a hydroxyl group (-OH) at the corresponding 3' position of a given monomer, rather than a phosphate moiety. Furthermore, for the embodiments disclosed herein, when considering the 5'→3' direction of the corresponding chain, an inverted abasic residue is inserted such that the 3' position of the deoxyribose sugar is connected to the 3' end of the previous monomer on the corresponding chain (see, e.g., Table 6). Furthermore, as will be readily understood and appreciated by those skilled in the art, although the phosphorothioate chemical structures depicted herein generally show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers and resonance structures (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly stated herein, such understanding of those skilled in the art is used when describing the C3 RNAi agents and compositions of C3 RNAi agents disclosed herein.

[0179] Certain examples of targeting ligands, targeting groups, and linking groups for use with the C3 RNAi agents disclosed herein are provided below in Table 6. More specifically, targeting groups and linking groups (which together can form a targeting ligand) include (NAG37) and (NAG37)s, whose chemical structures are provided below in Table 6. Each sense strand and / or antisense strand can have any of the targeting ligands, targeting groups, or linking groups listed herein, as well as other groups, conjugated to the 5' and / or 3' end of the sequence.

[0180]

[0181] The C3 RNAi agents described herein are formed by annealing an antisense strand to a sense strand. A sense strand comprising a sequence listed in Table 2, Table 4, Table 5C, Table 7B, or Table 8 can hybridize with an antisense strand comprising a sequence listed in Table 2, Table 3, Table 5C, Table 7A, or Table 8, provided that the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0182] In some embodiments, the antisense strand of a C3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 5C by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a C3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4 or Table 5C by 0, 1, 2, or 3 nucleotides.

[0183] In some embodiments, the C3 RNAi agent antisense strand comprises a nucleotide sequence of any sequence in Table 2, Table 3, or Table 5C. In some embodiments, the C3 RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any sequence in Table 2, Table 3, or Table 5C. In certain embodiments, the C3 RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 5C.

[0184] In some embodiments, the sense strand of the C3 RNAi agent comprises a nucleotide sequence of any sequence in Table 2, Table 4, or Table 5C. In some embodiments, the sense strand of the C3 RNAi agent comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 of any sequence in Table 2, Table 4, or Table 5C. In certain embodiments, the sense strand of the C3 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4 or Table 5C.

[0185] For the C3 RNAi agents disclosed herein, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand may be perfectly complementary to the C3 gene, or may not be complementary to the C3 gene. In some embodiments, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0186] A sense strand comprising a sequence listed in Table 2, Table 4, Table 5C, Table 7B, or Table 8 can hybridize with any antisense strand comprising a sequence listed in Table 2, Table 3, Table 5C, Table 7A, or Table 8, provided that the two sequences have a region of at least 85% complementarity over a contiguous sequence of 15, 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments, the C3 RNAi agent has a sense strand consisting of a modified sequence of any modified sequence in Table 4 or Table 5C, and an antisense strand consisting of a modified sequence of any modified sequence in Table 3 or Table 5C. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Tables 5A, 5B, 5C, and 8.

[0187] In some embodiments, the C3 RNAi agent comprises a duplex represented by any one of the duplex ID numbers provided herein, is composed of, or is essentially composed of. In some embodiments, the C3 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID number provided herein. In some embodiments, the C3 RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any duplex represented by any duplex ID number provided herein, and a targeting group and / or a linking group, wherein the targeting group and / or the linking group are covalently linked to the sense strand or antisense strand (i.e., conjugated). In some embodiments, the C3 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any duplex ID number provided herein. In some embodiments, the C3 RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any duplex ID number provided herein, and a targeting group and / or a linking group, wherein the targeting group and / or the linking group are covalently linked to the sense strand or antisense strand.

[0188] In some embodiments, the C3 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or targeting ligand. In some embodiments, the C3 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Tables 5A, 5B, and 5C, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0189] A targeting group (with or without a linker) can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, or 5C. A linker (with or without a targeting group) can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5C.

[0190] In some embodiments, the C3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any antisense strand / sense strand duplex of Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting ligand selected from the group consisting of: (NAG37) and (NAG37)s, each as defined in Table 6.

[0191] In some embodiments, the C3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3 or Table 4.

[0192] In some embodiments, the C3 RNAi agent comprises the antisense and sense strands having modified nucleotide sequences of any antisense and / or sense strand nucleotide sequences of any duplex of Tables 5A, 5B, and 5C, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0193] In some embodiments, the C3 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 5A, 5B, and 5C.

[0194] Table 5A. C3 RNAi agent duplexes with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0195]

[0196] Table 5B. C3 RNAi agent duplexes with corresponding sense and antisense strand ID numbers with reference to the targeted positions on the C3 gene (SEQ ID NO: 1).

[0197]

[0198]

[0199] In some embodiments, the C3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid.The RNAi agents described herein inhibit or knock down the expression of one or more C3 genes in vivo and / or in vitro after delivery to cells expressing the C3 gene.

[0200] Targeting ligands or groups, linking groups and delivery vehicles

[0201] In some embodiments, the C3 RNAi agent is conjugated to one or more non-nucleotide groups, including but not limited to targeting groups, linking groups, targeting ligands, delivery polymers, or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense strand and / or antisense strand. In some embodiments, the C3 RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the C3 RNAi agent. The non-nucleotide group can be directly or indirectly linked to the RNAi agent through a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent through an unstable, cleavable, or reversible bond or linker.

[0202] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve the cell or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.

[0203] The targeting group or targeting moiety enhances the pharmacokinetics or biodistribution characteristics of the conjugate or RNAi agent to which it is attached, to improve the cell-specific (including organ-specific in some cases) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. The targeting group can be monovalent, divalent, trivalent, tetravalent, or have a higher valence state for the target to which it is directed. Representative targeting groups include but are not limited to compounds, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0204] In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues (which can be used as a linker in some cases). In some embodiments, the targeting ligand comprises a cluster of galactose derivatives.

[0205] The C3 RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends. The reactive groups can then be used to attach targeting moieties using methods commonly used in the art.

[0206] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand containing a portion that has an affinity for the asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes galactose and a galactose derivative that has an affinity equal to or greater than galactose for the asialoglycoprotein receptor. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, and N-isobutyrylgalactosamine (see, for example, ST Iobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that can be used to target oligonucleotides and other molecules to the liver in vivo are known in the art (see, eg, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0207] Galactose derivatives have been used to target molecules to hepatocytes in vivo by binding to asialoglycoprotein receptors expressed on the surface of hepatocytes. The binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors promotes cell-specific targeting to hepatocytes and endocytosis of molecules into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also referred to as monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivatives can be attached to the 3' or 5' end of the sense or antisense strand of the RNAi agent using methods known in the art.

[0208] The preparation of targeting ligands, such as clusters of galactose derivatives, is described, for example, in International Patent Application Publication No. WO 2018 / 044350 to Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO 2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated herein by reference in their entirety.

[0209] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. The terminal galactose derivative is attached to the molecule by its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as a tri-antennary galactose derivative or a trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetylgalactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetylgalactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as a tetraantennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetylgalactosamine moieties.

[0210] As used herein, galactose derivative trimer contains three galactose derivatives, each of which is connected to a central branch point. As used herein, galactose derivative tetramer contains four galactose derivatives, each of which is connected to a central branch point. Galactose derivatives can be attached to a central branch point by the C-1 carbon of sugar. In some embodiments, galactose derivatives are connected to branch points by a joint or a spacer. In some embodiments, joints or spacers are flexible hydrophilic spacers, such as PEG groups (see, for example, U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 pp. 1538-1546). In some embodiments, PEG spacers are PEG3 spacers. Branch point can be any small molecule that allows the attachment of three galactose derivatives and further allows branch point to be attached to RNAi agents. An example of a branch point group is dilysine or diglutamic acid. The attachment of branch point to RNAi agents can be carried out by joints or spacers. In some embodiments, joints or spacers include flexible hydrophilic spacers, such as, but not limited to, PEG spacers. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetylgalactosamine. In some embodiments, the galactose derivative cluster comprises a galactose derivative tetramer, which can be, for example, an N-acetylgalactosamine tetramer.

[0211] Embodiments of the present disclosure include pharmaceutical compositions for delivering C3 RNAi agents to liver cells in vivo. Such pharmaceutical compositions may include, for example, C3 RNAi agents conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises a galactose derivative trimer (which may be, for example, an N-acetylgalactosamine trimer) or a galactose derivative tetramer (which may be, for example, an N-acetylgalactosamine tetramer).

[0212] A targeting ligand or targeting group can be linked to the 3' or 5' end of the sense or antisense strand of a C3 RNAi agent disclosed herein.

[0213] Targeting ligands include, but are not limited to (NAG37) and (NAG37)s as defined in Table 6. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0214] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group facilitates the covalent connection of the agent to the targeting group, delivery polymer, or delivery vehicle. The linking group can be connected to the 3' and / or 5' ends of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is connected to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' ends of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups may include, but are not limited to, reactive groups such as primary amines and alkynes, alkyls, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0215] In some embodiments, the targeting group is internally linked to a nucleotide on the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0216] A linker or a linking group is a connection between two atoms that connects a chemical group (such as an RNAi agent) or a segment of interest to another chemical group (such as a targeting group or a delivery polymer) or a segment of interest through one or more covalent bonds. Unstable connections comprise unstable bonds. The connection may optionally comprise a spacer that increases the distance between the two connected atoms. The spacer can further increase the flexibility and / or length of the connection. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the foregoing list is not intended to limit the scope of this specification.

[0217] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents can be connected to the same targeting group or two different targeting groups (i.e., targeting groups with different chemical structures). In some embodiments, the targeting group is connected to the C3 RNAi agent disclosed herein without the use of an additional linker. In some embodiments, the targeting group itself is designed to have a linker or other readily available site that facilitates conjugation. In some embodiments, when two or more C3 RNAi agents are included in a single molecule, each of the RNAi agents can use the same linker or different linkers (i.e., linkers with different chemical structures).

[0218] Any of the C3 RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5C, 7A, 7B, or 8, whether modified or unmodified, contain 3' and / or 5' targeting groups or linking groups. Any of the C3 RNAi agent sequences listed in Tables 3 or 4 or otherwise described herein that contain 3' or 5' targeting groups or linking groups may alternatively not contain a 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group, including but not limited to those depicted in Table 6. Any of the C3 RNAi agent duplexes listed in Tables 5A, 5B, 5C, and 8, whether modified or unmodified, may further contain a targeting group or linking group, including but not limited to those depicted in Table 6, and the targeting group or linking group may be attached to the 3' or 5' end of the sense or antisense strand of the C3 RNAi agent duplex.

[0219] Examples of targeting groups and linking groups, which when combined can form a targeting ligand, are provided in Table 6. Tables 4, 5C, and 8 provide certain embodiments of the sense strand of a C3 RNAi agent having a targeting group or linking group attached to the 5' or 3' end.

[0220] Table 6. Structures representing various modified nucleotides, targeting ligands or targeting groups, capping residues, and linking groups.

[0221]

[0222]

[0223]

[0224] In each of the above structures in Table 6, NAG comprises N-acetylgalactosamine. As one skilled in the art would appreciate based on the above structures and the description provided herein, for attachment, in some embodiments, NAG as depicted in Table 6 above may comprise another galactose derivative that has affinity for the asialoglycoprotein receptor present on hepatocytes. Other linking groups known in the art may be used.

[0225] In some embodiments, RNAi agent can be delivered to cell or tissue using delivery vehicle.Delivery vehicle is the compound that improves the delivery of RNAi agent to cell or tissue.Delivery vehicle can include but is not limited to: polymer, such as amphipathic polymer, membrane active polymer, peptide, melittin, melittin-like peptide (MLP), lipid, reversibly modified polymer or peptide, or reversibly modified membrane active polyamine.In some embodiments, RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including but not limited to cholesterol and cholesterol derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169 and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres, protein carriers, or other delivery systems suitable for nucleic acid or oligonucleotide delivery as known and available in the art.

[0226] Pharmaceutical composition

[0227] The C3 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medicaments"). In some embodiments, the pharmaceutical compositions comprise at least one C3 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of a target mRNA in a target cell, cell population, tissue, or organism.

[0228] The pharmaceutical composition can be used to treat a subject with a disease, disorder, or condition that would benefit from a reduction in target C3 mRNA levels or inhibition of target gene expression. The pharmaceutical composition can be used to treat a subject at risk of developing a disease, disorder, symptom, or condition that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering to the subject to be treated a C3 RNAi agent linked to a targeting ligand as described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising a C3 RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject (including a human).

[0229] The pharmaceutical compositions and methods disclosed herein comprising C3 RNAi agents reduce the level of a target mRNA in a cell, a cell population, a cell population, a tissue, an organ, or a subject, comprising inhibiting the expression or translation of C3 mRNA in the subject by administering to the subject a therapeutically effective amount of a C3 RNAi agent as described herein. In some embodiments, the subject has previously been identified as having pathogenic upregulation of the target gene in hepatocytes. In some embodiments, the subject has previously been identified or diagnosed as having IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the subject has suffered symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the subject will benefit from a reduction in C3 gene expression in the subject's liver.

[0230] In some embodiments, the pharmaceutical composition comprising the C3 RNAi agent is used to treat or control clinical manifestations associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria (PNH). Other diseases or conditions for which the C3 RNAi agent may be useful include lupus nephritis, primary membranous nephropathy (PMN), and / or autoimmune hemolytic anemia (AIHA) / cold agglutinin disease (CAD). In some embodiments, a therapeutically (including prophylactically) effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any disclosed C3 RNAi agent can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0231] The pharmaceutical composition comprising a C3 RNAi agent can be used to treat at least one symptom of a subject suffering from a disease or condition that would benefit from reduction or inhibition of C3 mRNA expression and / or reduction of C3 protein levels. Measuring C3 levels can be performed according to established methods known in the art.

[0232] In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising a C3 RNAi agent is administered to a subject to treat a symptom. In other embodiments, a prophylactically effective amount of one or more C3 RNAi agents is administered to a subject to prevent or inhibit at least one symptom.

[0233] The route of administration is the path by which the C3 RNAi agent comes into contact with the body. In general, methods for administering drugs, oligonucleotides, and nucleic acids for treating mammals are well known in the art and can be applied to the administration of the compositions described herein. The C3 RNAi agents disclosed herein can be administered by any suitable route, in formulations appropriately tailored to the specific route. Thus, the pharmaceutical compositions described herein can be administered by injection, such as intravenous, intramuscular, intradermal, subcutaneous, intraarticular, or intraperitoneal injection. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0234] The pharmaceutical compositions comprising C3 RNAi agents described herein can be delivered to cells, cell groups, tissues or subjects using oligonucleotide delivery technologies known in the art. In general, any suitable method for delivering nucleic acid molecules (in vitro or in vivo) recognized in the art can be applied to the compositions described herein. For example, delivery can be by topical administration (e.g., direct injection, implantation or topical application), systemic administration, or subcutaneous, intravenous, intraperitoneal or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal cavity, oral, rectal or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0235] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients.The pharmaceutical compositions described herein are formulated for administration to a subject.

[0236] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance that is intentionally included in a drug delivery system in addition to an active pharmaceutical ingredient (API, therapeutic product, e.g., C3 RNAi drug). The excipient does not play or is not expected to play a therapeutic role at the intended dose. The excipient may act to: a) aid in the processing of the drug delivery system during production; b) protect, support, or enhance the stability, bioavailability, or patient acceptance of the API; c) aid in product identification; and / or d) enhance the overall safety, efficacy, or any other attribute of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0237] Excipients include, but are not limited to, absorption enhancers, antiadherents, antifoaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tonicity agents, vehicles, waterproofing agents, and wetting agents.

[0238] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Suitable carriers should be stable under production and storage conditions and should prevent the contamination of microorganisms (such as bacteria and fungi). Carriers can be solvents or dispersion media containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol) and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining the required particle size and by using a surfactant in the case of a dispersion. In many cases, it is preferred to include isotonic agents, such as sugars, polyols (such as mannitol, sorbitol) and sodium chloride in the composition. Prolonged absorption of the injection composition is caused by including in the composition a substance that delays absorption (such as aluminum monostearate and gelatin).

[0239] Sterile injectable solutions can be prepared by combining the desired amount of the active compound in an appropriate solvent with one or a combination of the ingredients listed above, as needed, followed by filtration sterilization. Typically, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the desired other ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze drying, which yield a powder of the active ingredient plus any other desired ingredients from a previously sterile-filtered solution.

[0240] In some embodiments, the pharmaceutical formulations disclosed herein comprising a C3 RNAi agent suitable for subcutaneous administration can be prepared in a sodium phosphate aqueous buffer (e.g., a C3 RNAi agent formulated in a 0.5 mM sodium dihydrogen phosphate, 0.5 mM sodium hydrogen phosphate aqueous solution). In some embodiments, the pharmaceutical formulations disclosed herein comprising a C3 RNAi agent suitable for subcutaneous administration can be prepared in water for injection (sterile water). The C3 RNAi agent disclosed herein suitable for subcutaneous administration can be prepared in isotonic saline (0.9%).

[0241] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous formulation of the drug (which may be in microcrystalline form), such as an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for intra-articular and ocular administration.

[0242] Formulations suitable for oral administration of the C3 RNAi agents disclosed herein can also be prepared. In some embodiments, the C3 RNAi agents disclosed herein are administered orally. In some embodiments, the C3 RNAi agents disclosed herein are formulated into capsules for oral administration.

[0243] The active compound can be prepared with a carrier that will protect the compound from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0244] C3 RNAi agents can be formulated as compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suitable as unitary dosages for subjects to be treated; each unit contains a predetermined quantity of active compound, in association with the required pharmaceutical carrier, calculated to produce the desired therapeutic effect. The specifications for the dosage unit forms of the present disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the art of formulating such active compounds for use in treating individuals.

[0245] The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs expressing or comprising RNAi agents as defined herein can be used as "pharmaceutical compositions." As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or preventive effect.

[0246] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another C3 RNAi agent (e.g., a C3 RNAi agent that targets a different sequence within the C3 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0247] In some embodiments, the C3 RNAi agent is optionally combined with one or more additional therapeutic agents. The C3 RNAi agent and the additional therapeutic agent can be administered as a single composition, or they can also be administered separately. In some embodiments, one or more additional therapeutic agents are administered separately in a dosage form different from the RNAi agent (e.g., the C3 RNAi agent is administered by subcutaneous injection, and the additional therapeutic agent involved in the method for treating the dosage regimen is administered orally). In some embodiments, the C3 RNAi agent is administered to a subject in need by subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, which together provide a treatment regimen for the disease and condition associated with IgA nephropathy, C3 glomerulopathy and / or paroxysmal nocturnal hemoglobinuria. In some embodiments, the C3 RNAi agent is administered to a subject in need by subcutaneous injection, and one or more optional additional therapeutic agents are administered by separate subcutaneous injections. In some embodiments, the C3 RNAi agent and one or more additional therapeutic agents are combined into a single dosage form (e.g., a "cocktail" formulated as a single composition for subcutaneous injection). The C3 RNAi agent (with or without one or more additional therapeutic agents) can be combined with one or more excipients to form a pharmaceutical composition.

[0248] Typically, the effective amount of a C3 RNAi agent will be in the range of about 0.1 to about 100 mg / kg body weight / dose, for example, about 1.0 to about 50 mg / kg body weight / dose. In some embodiments, the effective amount of the active compound will be in the range of about 0.25 to about 5 mg / kg body weight / dose. In some embodiments, the effective amount of the active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight / dose. In some embodiments, the effective amount of a C3 RNAi agent can be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of C3 RNAi agent. In some embodiments, the fixed dose is in the range of 50 to 400 mg of C3 RNAi agent. Dosing can be weekly, biweekly, monthly, quarterly, or at any other interval, depending on the dose of the C3 RNAi agent administered, the activity level of the specific C3 RNAi agent, and the level of inhibition desired for the specific subject. The examples herein show suitable levels of inhibition in certain animal species. The amount administered will depend on variables such as the overall health of the patient or subject, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. In addition, it will be understood that the initial dose administered may be higher than the upper levels described above to quickly achieve the desired blood or tissue levels, or the initial dose may be lower than optimal.

[0249] To treat a disease or to form a medicament or composition for treating a disease, the pharmaceutical compositions described herein comprising a C3 RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment, including but not limited to: a second or additional RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0250] The C3 RNAi agent can be packaged into a kit, container, packaging bag or dispenser when added to a pharmaceutically acceptable excipient or adjuvant. The pharmaceutical composition described herein can be packaged in a prefilled syringe, pen syringe, automatic injector, infusion bag / device or vial.

[0251] C3 RNAi Agents Drug Substances and Formulations

[0252] In some embodiments, the C3 RNAi agent disclosed herein has the nucleotide sequence of the C3 RNAi drug substance shown in the following Table 8. The nucleotide sequence of the C3 RNAi agent present in the C3 RNAi drug substance includes the antisense strand nucleotide sequence shown in the following Table 7A and the sense strand nucleotide sequence shown in the following Table 7B.

[0253] Table 7A. C3 RNAi agent antisense strand sequences

[0254]

[0255] Table 7B. C3 RNAi Agent Sense Strand Nucleotide Sequences (Shown as Modified Versions Without Inverted Abasic Residues or NAG Targeting Groups Present in C3 RNAi Drug Substances)

[0256]

[0257] As used in Tables 7A, 7B, and 8 herein, the following symbols are used to represent modified nucleotides, targeting groups, and linking groups: A, C, G, and U represent adenosine, cytidine, guanosine, and uridine, respectively; a, c, g, and u represent 2′-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoroadenosine, cytidine, guanosine, and uridine, respectively; s represents a phosphorothioate linkage; (invAb) represents an inverted abasic deoxyribose residue (see Table 6); and (NAG37)s represents the following structure (depicted as a sodium salt and the free acid):

[0258]

[0259] ((NAG37)s shown as sodium salt)

[0260]

[0261] ((NAG37)s shown as free acid)

[0262] Each sense and / or antisense strand can have any of the above-listed targeting or linking groups, as well as other targeting or linking groups, conjugated to the 5' and / or 3' end of the sequence.

[0263] The C3 RNAi agent antisense strand sequence is designed to target the mRNA transcript of the C3 gene from a human subject, thereby silencing C3 protein translation in a C3-bearing human subject using an RNA interference mechanism.

[0264] In some embodiments, the methods disclosed herein utilize the C3 RNAi drug substances shown in Table 8 below:

[0265] Table 8. C3 RNAi drug substances

[0266]

[0267] Table 8.1 Properties of the C3 RNAi Drug Substances Described in Table 8

[0268]

[0269] In some embodiments, the C3 RNAi drug substance is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the form is a sodium salt.

[0270] In some embodiments, the C3 RNAi drug substances provided in Table 8 are formulated with one or more pharmaceutically acceptable excipients to form pharmaceutical compositions suitable for administration to human subjects. In some embodiments, the C3 RNAi drug substances described in Table 8 are formulated at 200 mg / mL (on a free acid / salt-free basis) in an aqueous sodium phosphate buffer (0.5 mM sodium dihydrogen phosphate, 0.5 mM sodium hydrogen phosphate) suitable for subcutaneous administration in humans.

[0271] Treatments and expression suppression

[0272] The C3 RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) having a disease or condition that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) who would benefit from reduction and / or inhibition of C3 mRNA expression and / or C3 protein levels, for example, subjects who have been diagnosed with or are experiencing symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria.

[0273] In some embodiments, a therapeutically effective amount of any one or more C3 RNAi agents is administered to a subject. Treatment of a subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more C3 RNAi agents described herein is administered to a subject. The subject may be an adult, adolescent, child, or infant. The pharmaceutical compositions described herein can be administered to humans or animals.

[0274] The C3 RNAi agents described herein can be used to treat at least one symptom or manifestation of a disease in a subject suffering from a C3-related disease or condition, such as a disease or condition mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression. In some embodiments, the C3 RNAi agents are used to treat or control clinical manifestations in a subject suffering from a disease or condition who would benefit, at least in part, from a reduction in C3 mRNA or C3 protein levels. A therapeutically effective amount of one or more C3 RNAi agents described herein or a composition containing a C3 RNAi agent is administered to the subject. In some embodiments, the methods disclosed herein comprise administering a composition comprising a C3 RNAi agent described herein to the subject to be treated. In some embodiments, a prophylactically effective amount of any one or more of the C3 RNAi agents is administered to the subject, thereby treating the subject by preventing or inhibiting at least one symptom or manifestation of the disease.

[0275] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by C3 gene expression, dysregulation of the complement cascade, or dysregulated complement activity in a patient in need thereof, wherein the method comprises administering to the patient any of the C3 RNAi agents described herein.

[0276] In some embodiments, the gene expression level and / or mRNA level of the C3 gene in a subject administered a C3 RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject before administration of the C3 RNAi agent or a subject that has not received the C3 RNAi agent. The C3 mRNA level in the subject may be reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, C3 gene expression in hepatocytes is inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or greater than 65% relative to the subject before administration of the C3 RNAi agent or a subject that has not received the C3 RNAi agent.

[0277] In some embodiments, C3 protein levels in a subject administered a C3 RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject before administration of the C3 RNAi agent or a subject that did not receive the C3 RNAi agent. Protein levels in the subject can be reduced in cells, cell populations, tissues, blood, and / or other bodily fluids of the subject.

[0278] Reduction in C3 mRNA levels and C3 protein levels can be assessed by any method known in the art. As used herein, a reduction or decrease in C3 mRNA levels and / or protein levels is collectively referred to herein as a decrease or reduction in C3, or as an inhibition or reduction of C3 gene expression. The examples presented herein illustrate known methods for assessing inhibition of C3 gene expression. One of ordinary skill in the art will further appreciate suitable methods for assessing inhibition of C3 gene expression in vivo and / or in vitro.

[0279] In some embodiments, disclosed herein are methods of treating (including prophylactic treatment) a disease, disorder, or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods of treating (including prophylactic treatment) a disease, disorder, or symptom caused by complement-mediated renal disease (CMRD), wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods of treating (including prophylactic treatment) a disease or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent, the C3 RNAi agent comprising an antisense strand comprising a sequence of any of Tables 2, 3, 5C, 7A, or 8, and a sense strand comprising any of Tables 2, 4, 5C, 7B, or 8, the sense strand being at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of treating (including prophylactic treatment) a disease or symptom caused by IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of a C3 RNAi agent comprising a sense strand comprising any sequence in Table 2, 4, 5C, 7B, or 8 and an antisense strand comprising a sequence in any sequence in Table 2, 3, 5C, 7A, or 8, the antisense strand being at least partially complementary to the sense strand.

[0280] In some embodiments, disclosed herein are methods for inhibiting expression of a C3 gene in a cell, wherein the method comprises administering to the cell a C3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of a C3 mRNA having a sequence in Table 1. In some embodiments, disclosed herein are methods for inhibiting expression of a C3 gene in a cell, wherein the method comprises administering to the cell a C3 RNAi agent comprising an antisense strand comprising a sequence of any of Tables 2, 3, 5C, 7A, or 8 and a sense strand comprising any of Tables 2, 4, 5C, 7B, or 8, the sense strand being at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods for inhibiting expression of a C3 gene in a cell, wherein the method comprises administering to the cell a C3 RNAi agent comprising a sense strand comprising a sequence of any of Tables 2, 4, 5C, 7B, or 8 and an antisense strand comprising a sequence of any of Tables 2, 3, 5C, 7A, or 8, the antisense strand being at least partially complementary to the sense strand.

[0281] The use of C3 RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases / conditions associated with complement dysregulation and / or elevated C3 gene expression, including but not limited to IgA nephropathy, C3 glomerulopathy, and paroxysmal nocturnal hemoglobinuria. The C3 RNAi agents mediate RNA interference to inhibit the expression of one or more genes necessary for the production of C3 protein. C3 RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria. In addition, compositions for delivering C3 RNAi agents to liver cells in vivo, and in particular, hepatocytes, are described.

[0282] cells, tissues, organs and non-human organisms

[0283] Cells, tissues, organs, and non-human organisms comprising at least one of the C3 RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is prepared by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0284] Implementation Plan

[0285] The following non-limiting embodiments illustrate the invention described herein.

[0286] Embodiment 1. An RNAi agent for inhibiting C3 gene expression, comprising:

[0287] an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8; and

[0288] a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand,

[0289] wherein all or substantially all nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand comprising N-acetylgalactosamine.

[0290] Embodiment 2. An RNAi agent for inhibiting C3 gene expression, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differs by 0 or 1 nucleotide from the 15 consecutive nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5C, Table 7B, or Table 8, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand over at least 15 consecutive nucleotides.

[0291] Embodiment 3. The RNAi agent of any one of embodiments 1-2, wherein at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

[0292] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein the modified nucleotides are independently selected from the group consisting of 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′,3′-open ring nucleotide mimics, locked nucleotides, 2′-F-arabino nucleotides, 2′-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2′-O-methyl nucleotides, inverted 2′-deoxy nucleotides, 2′-amino modified nucleotides, 2′-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3′-O-methyl nucleotides.

[0293] Embodiment 5. The RNAi agent of embodiment 4, wherein all or substantially all modified nucleotides are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0294] Embodiment 6. The RNAi agent of any one of embodiments 1-5, wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3, Table 5C, Table 7A, or Table 8.

[0295] Embodiment 7. The RNAi agent of any one of embodiments 1-6, wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified sense strand sequences of Table 4, Table 5C, Table 7B, or Table 8.

[0296] Embodiment 8. The RNAi agent of embodiment 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences of Table 3, Table 5C, Table 7A, or Table 8, and the sense strand comprises a nucleotide sequence of any one of the modified sequences of Table 4, Table 5C, Table 7B, or Table 8.

[0297] Embodiment 9. The RNAi agent of any one of embodiments 1-8, wherein the targeting ligand comprises:

[0298]

[0299] Embodiment 10. The RNAi agent of any one of embodiments 1-9, wherein the targeting ligand is linked to the sense strand.

[0300] Embodiment 11. The RNAi agent of embodiment 10, wherein the targeting ligand is linked to the 5' end of the sense strand.

[0301] Embodiment 12. The RNAi agent of any one of embodiments 1-11, wherein the sense strand is between 15 and 30 nucleotides in length and the antisense strand is between 21 and 30 nucleotides in length.

[0302] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each between 21 and 27 nucleotides in length.

[0303] Embodiment 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.

[0304] Embodiment 15. The RNAi agent of embodiment 14, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0305] Embodiment 16. The RNAi agent of any one of embodiments 1-15, wherein the RNAi agent has two blunt ends.

[0306] Embodiment 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two terminal caps.

[0307] Embodiment 18. The RNAi agent of any one of embodiments 1-17, wherein the sense strand comprises one or two inverted abasic residues.

[0308] Embodiment 19. The RNAi agent of embodiment 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex sequence of any one of the duplexes shown in Tables 5A, 5B, 5C, or 8.

[0309] Embodiment 20. The RNAi agent according to any one of embodiments 1-19, wherein the RNAi agent is a pharmaceutically acceptable salt.

[0310] Embodiment 21. The RNAi agent of embodiment 20, wherein the RNAi agent is a sodium salt.

[0311] Embodiment 22. A composition comprising the RNAi agent of any one of embodiments 1-21, wherein the composition comprises a pharmaceutically acceptable excipient.

[0312] Embodiment 23. The composition of embodiment 22, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

[0313] Embodiment 24. The composition of embodiment 22, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

[0314] Embodiment 25. A method of inhibiting C3 gene expression in a hepatocyte, the method comprising introducing into the cell an effective amount of the RNAi agent according to any one of embodiments 1-21 or the composition according to any one of embodiments 22-24.

[0315] Embodiment 26. The method of embodiment 25, wherein C3 mRNA in hepatocytes is reduced by at least about 50%.

[0316] Embodiment 27. The method of any one of embodiments 25-26, wherein C3 protein in hepatocytes is reduced by at least about 50%.

[0317] Embodiment 28. A method of inhibiting C3 gene expression in a subject, the method comprising administering to the subject an effective amount of the RNAi agent according to any one of embodiments 1-21 or the composition according to any one of embodiments 22-24.

[0318] Embodiment 29. The method of embodiment 28, wherein the subject is a human subject.

[0319] Embodiment 30. The method of embodiment 28 or 29, wherein C3 mRNA in the subject is reduced by at least about 50%.

[0320] Embodiment 31. The method of any one of embodiments 28-30, wherein the C3 protein in the subject is reduced by at least about 50%.

[0321] Embodiment 32. A method of treating a C3-related disease, disorder, symptom, or other manifestation of a disease, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition according to any one of embodiments 22-24.

[0322] Embodiment 33. The method of embodiment 32, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

[0323] Embodiment 34. The method of any one of embodiments 25-33, wherein serum C3 protein levels are reduced in the subject.

[0324] Embodiment 35. The method of any one of embodiments 25-34, wherein the alternative complement pathway hemolytic activity (AH50) in the subject is reduced by at least about 50%.

[0325] Embodiment 36. The method of embodiment 35, wherein AH50 is reduced by at least about 75%.

[0326] Embodiment 37. The method of embodiment 36, wherein AH50 is reduced by about 90% or more.

[0327] Embodiment 38. The method of any one of embodiments 25-37, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

[0328] Embodiment 39. The method of any one of embodiments 25-37, wherein the RNAi agent is administered to the human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0329] Embodiment 40. The method of embodiment 39, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

[0330] Embodiment 41. The RNAi agent of any one of embodiments 1-21 or the composition of any one of embodiments 22-24, for use in treating a disease, disorder, or symptom mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

[0331] Embodiment 42. The RNAi agent or composition of embodiment 41, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD) and / or another type of complement-mediated kidney disease.

[0332] Embodiment 43. The RNAi agent of any one of embodiments 1-21 or the composition of any one of embodiments 22-24, for use in the preparation of a pharmaceutical composition for treating a disease, disorder, or symptom mediated at least in part by dysregulated complement activity, dysregulated C3 activity, or C3 gene expression.

[0333] Embodiment 44. The RNAi agent or composition according to any one of Embodiments 41 to 43, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

[0334] Embodiment 1a. A method of treating a C3-related disease, disorder or symptom in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising a therapeutically effective amount of an RNAi agent for inhibiting expression of a C3 gene, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand comprises the nucleotide sequence of (5′→3′)UUUCGAACAACAGAGUAGGGU (SEQ ID NO: 3), and wherein the sense strand comprises the nucleotide sequence of (5′→3′)ACCCUACUCUGUUGUUCGAAA (SEQ ID NO: 8), wherein all or substantially all modified nucleotides of the sense strand and the antisense strand are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or a combination thereof, and wherein the RNAi agent is linked to a targeting ligand comprising N-acetylgalactosamine.

[0335] Embodiment 2a. A method of treating a C3-related disease, disorder or symptom in a human subject in need thereof, the method comprising administering to the human subject a pharmaceutical composition comprising a therapeutically effective amount of an RNAi agent for inhibiting C3 gene expression, wherein the RNAi agent comprises an antisense strand and a sense strand, wherein the antisense strand comprises the nucleotide sequence (5′→3′)usUfsusCfgAfacaacAfgAfgUfaGfGfgsu (SEQ ID NO: 13), and the sense strand comprises the nucleotide sequence (5′→3′)(NAG37)s(invAb)sacccuacuCfUfGfuuguucgaaas(invAb) (SEQ ID NO: NO:14), wherein a is 2′-O-methyladenosine; c is 2′-O-methylcytidine; g is 2′-O-methylguanosine; u is 2′-O-methyluridine, Af is 2′-fluoroadenosine, Cf is 2′-fluorocytidine; Gf is 2′-fluoroguanosine; Uf is 2′-fluoroadenosine; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; (NAG37)s comprises the following chemical structure:

[0336]

[0337] Embodiment 3a. The method of embodiment 2a, wherein the RNAi agent is a pharmaceutically acceptable salt.

[0338] Embodiment 4a. The RNAi agent according to embodiment 2a, wherein the RNAi agent is a sodium salt.

[0339] Embodiment 5a. The method of embodiment 2a, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated renal disease.

[0340] Embodiment 6a. The method of embodiment 5a, wherein the disease is IgA nephropathy (IgAN) or C3 glomerulopathy (C3G).

[0341] Embodiment 7a. The method of embodiment 2a, wherein the pharmaceutical composition comprises a sodium phosphate buffer.

[0342] Embodiment 8a. The method of embodiment 2a, wherein the pharmaceutical composition comprises isotonic saline.

[0343] Embodiment 9a. The method of embodiment 2a, wherein the pharmaceutical composition comprises water for injection.

[0344] Embodiment 10a. The method of embodiment 2a, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of the human subject's body weight.

[0345] Embodiment 11a. The method of embodiment 2a, wherein the RNAi agent is administered to the human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

[0346] Embodiment 12a. The method of embodiment 10a, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

[0347] Embodiment 13a. The method of embodiment 2a, wherein the serum C3 protein level in the subject is reduced.

[0348] Embodiment 14a. The method of embodiment 2a, wherein the subject's alternative complement pathway hemolytic activity (AH50) is reduced by at least about 50%.

[0349] Embodiment 15a. The method of embodiment 13a, wherein the AH50 is reduced by about 90% or more.

[0350] Embodiment 16a. The method of embodiment 6a, wherein the RNAi agent is formulated at 200 mg / mL in a sodium phosphate aqueous buffer, wherein the sodium phosphate aqueous buffer has a concentration of about 0.5 mM sodium dihydrogen phosphate and 0.5 mM sodium hydrogen phosphate.

[0351] Embodiment 17a. The method of embodiment 11a, wherein the RNAi agent is administered to the human subject no more frequently than once every twelve weeks.

[0352] Embodiment 18a. The method of embodiment 11a, wherein the RNAi agent is administered to the human subject no more frequently than four times a year.

[0353] The embodiments and items provided above are now illustrated by the following non-limiting examples.

[0354] Example

[0355] Example 1. Synthesis of C3 RNAi Agent.

[0356] The C3 RNAi agent duplexes shown in Tables 5A, 5B, 5C, and 8 above were synthesized according to the following general procedure:

[0357] A. Synthesis.

[0358] The sense and antisense strands of the RNAi agent are synthesized according to the phosphoramidite technique on solid phase used in oligonucleotide synthesis. Such standard syntheses are generally known in the art. Depending on the scale, the (Bioautomation), (Bioautomation) or OP Pilot 100 (GE Healthcare). or The synthesis was carried out on a solid support made from Prime Synthesis, Aston, PA, USA. The monomer at the 3′ end of the corresponding chain was attached to the solid support as the starting point of the synthesis. All 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). 2′-O-methyl phosphoramidites include the following: (5′-O-dimethoxytrityl-N 6 -(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite), 5′-O-dimethoxytrityl-N 4 -(acetyl)-2′-O-methylcytidine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5′-O-dimethoxytrityl-N 25′-(isobutyryl)-2′-O-methylguanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5′-O-dimethoxytrityl-2′-O-methyluridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2′-Deoxy-2′-fluorophosphoramidite carries the same protecting group as 2′-O-methylphosphoramidite. 5′-(4,4′-dimethoxytrityl)-2′,3′-secouridine and 2′-benzoyl-3′-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-dimethoxytrityl-2'-O-methylinosine-3'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramidite was synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55): 6808-6811 (July 2021)). Reverse abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N, N-diisopropylamino) phosphoramidite) was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytrityl-N 2 ,N 6 -(phenoxyacetate)-2′-O-methyldiaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was obtained from ChemGenes or Hongene Biotech.

[0359] The phosphoramidite containing the targeting ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), and all the remaining phosphoramidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. The connection time was 12 minutes (RNA), 15 minutes (targeting ligand), 90 seconds (2'OMe) and 60 seconds (2'F). To introduce the phosphorothioate connection, a solution of 100 mM 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Each of the C3 RNAi agent duplexes synthesized and tested in the following examples used N-acetylgalactosamine as the "NAG" in the targeting ligand chemical structure shown in Table 6. (NAG37) and (NAG37)s targeting ligand phosphoramidite compounds can be synthesized according to International Patent Application Publication No. WO 2018 / 044350 of Arrowhead Pharmaceuticals, Inc.

[0360] B. Cleavage and deprotection of support-bound oligomers.

[0361] After completion of the solid phase synthesis, the dried solid support was treated with a 1:1 volume of 40 wt.% methylamine in water and 28% ammonium hydroxide solution (Aldrich) at 30° C. for 1.5 hours. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0362] C. Purification.

[0363] The crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, and contained 20% acetonitrile, and buffer B was identical to buffer A with the addition of 1.5 M sodium chloride. A UV trace was recorded at 260 nm. Appropriate fractions were combined and then run on a size exclusion HPLC using a GE Healthcare XK 26 / 40 column equipped with Sephadex G25 fine, using filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile as the running buffer.

[0364] D. Annealing.

[0365] Complementary strands are mixed by mixing equimolar RNA solutions (sense and antisense) in 1× phosphate buffered saline (Corning, Cellgro) to form RNAi agents. Some RNAi agents are lyophilized and stored at -15 to -25°C. The duplex concentration is determined by measuring the absorbance of the solution on a UV-visible spectrophotometer in 1× phosphate buffered saline. The absorbance of the solution at 260 nm is then multiplied by the conversion factor and the dilution factor to determine the duplex concentration. The conversion factor used is 0.050 mg / (mL·cm) or calculated based on the experimentally determined extinction coefficient.

[0366] Example 2. In vivo testing of C3 RNAi agents in cynomolgus monkeys.

[0367] The C3 RNAi agent AD09546 was evaluated in cynomolgus monkeys (cynos). On days 1 and 29, three male cynos per group (n=3) were administered a 0.3 mL / kg subcutaneous injection (approximately 1.5 mL volume, depending on animal weight) containing 0.5 mg / kg (mpk), 1.5 mg / kg, or 4.5 mg / kg of the C3 RNAi agent in isotonic saline.

[0368] Table 9. Targeting sites and dosing groups of Example 2

[0369]

[0370] The C3 RNAi agent comprises a modified nucleotide conjugated to a targeting ligand containing three N-acetylgalactosamine groups (tridentate ligand) at the 5′ end of the sense strand, having a modified sequence as shown in the double-stranded structure herein. (For detailed modification and structural information on the C3 RNAi agent, including the (NAG37)s ligand, see Tables 3, 4, 5A, 5B, 5C, 6, 7A, 7B, and 8). The C3 RNAi agent comprises a nucleotide sequence designed to inhibit expression of the human C3 gene at position 2566. (See, for example, SEQ ID NO: 1).

[0371] Serum was collected on day -7 (pre-dose), day 1 (pre-dose), day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, day 64, day 71, day 78, and day 85. Figure 1 Cynomolgus monkey serum C3 protein normalized to predose levels is shown, with each serum collection date calculated by week (e.g., Figure 1 , week 0 is day 1, week 4 is day 29, and week 12 is day 85).

[0372] In addition, hemolytic activity was also assessed. Hemolytic activity is sensitive to the reduction, absence and / or inactivation of key components of the complement system. As shown, there are three pathways for complement activation: the alternative pathway, the classical pathway, and the lectin pathway. Since all three activation pathways of the complement system require the participation of C3 to cause tissue damage in vivo (see, for example, Thurman, J. and Holers, VM, J. Immunol. 2006 Feb 1, 176 (3) 1305-1310), the activation of the alternative complement pathway (AP) was measured to assess the effect of C3 knockdown on the complement system. The AP only requires Mg 2+ ions, while the classical and lectin pathways require Ca 2+ and Mg 2+ This difference is exploited to assay only AP in the presence of both classical and lectin pathway proteins. Rabbit erythrocytes, which are known to spontaneously activate AP in most mammalian species, are used for this assay.

[0373] For the hemolytic activity assay, 10 μL of cynomolgus monkey serum was first diluted in 10 μL of GVB buffer (Cat. No. B103, Complement Technology, Inc.) and then further diluted with 50 μL of the same buffer. 5 μL of 0.1 M MgEGTA (Cat. No. B106, Complement Technology, Inc.) and 25 μL of rabbit erythrocytes (Cat. No. B302, Complement Technology, Inc.) were added. Thus, the mixture consisted of a 10-fold dilution of each collected serum sample (final serum concentration was 10%; the total volume at this step was 100 μL, 1.25 × 10 7 Rabbit erythrocytes were incubated with serum for 15 minutes at 37°C and the lysis of rabbit erythrocytes was assessed. At the end of the reaction, 100 μL of cold GVBE (Cat. No. B104, Complement Technology, Inc.) was added to terminate the reaction (final volume = 200 μL). Maximum lysis was determined by incubating the same number of rabbit erythrocytes completely lysed with 2% Tween 20 at 37°C for 60 minutes. The supernatant of each reaction was transferred to a new ELISA plate and read at 412 nm. Hemolytic activity was determined using the following formula: (reading - background) / (maximum hemolysis reading - background) × 100%. Figure 2 Shown are the percent pre-dose hemolytic activity (AP) as of week 8 (day 57). For each individual animal, the percent remaining hemolytic activity for samples collected at all time points in the study was normalized by the average hemolysis level on day -7 and day 1 for the same corresponding animal.

[0374] like Figure 1 and Figure 2 As shown, a maximum reduction of approximately 84.3% in serum C3 levels was achieved, with a corresponding decrease in hemolytic activity. In addition, a long duration of effect was observed, suggesting that dosing with AD09546 every three or six months is feasible.

[0375] In addition, the complement C3a of the collected serum samples was also assessed. Complement C3a is composed of 75 amino acid residues and is released from complement C3 when the complement system is activated to stimulate the immune system (Yoshikawa, Handbook of Biologically Active Peptides, Second Edition, 2013, Chapter 214: 1570-1576). Therefore, serum C3a levels are indicators of complement C3-related activity. Using BD OptEIA human C3a ELISA kit (Catalog Number: 550499, BD Biosciences), serum C3a levels were quantitatively measured by ELISA. Standard assay procedures were performed as provided by BD Biosciences. For sample dilutions, 500 times and 2000 times dilutions were prepared.

[0376] Figure 5 Absolute C3a levels over time are shown. Figure 6 Relative C3a levels are shown as a percentage of pre-dose C3a levels. Figure 6 As shown in , a maximum serum C3a reduction of approximately 85% was achieved 7 weeks after injection with 4.5 mg / kg RNAi agent AD09546, with corresponding C3-related activity.

[0377] Example 3. Phase I / IIa clinical trial of a C3 RNAi drug substance in healthy human volunteers and adult subjects with IgA nephropathy (IgAN) and C3 glomerulopathy (C3G).

[0378] A Phase 1 / 2a single-dose and multiple-dose escalation study was initiated to evaluate the safety, tolerability, pharmacokinetic, and pharmacodynamic effects of the C3 RNAi drug substance described in Table 8 formulated in sodium phosphate buffer in adult healthy volunteers and subjects with IgA nephropathy (IgAN) and C3 glomerulopathy (C3G). The C3 RNAi drug substance described in Table 8 was formulated at 200 mg / mL in aqueous sodium phosphate buffer (0.5 mM sodium dihydrogen phosphate, 0.5 mM sodium hydrogen phosphate) ("formulated C3 RNAi drug substance"). Figure 3 A preliminary clinical trial design for a cohort of healthy adult volunteers is presented, and Figure 4 The design of a preliminary clinical trial in adult subjects with C3G and IgAN is shown. Figure 7 、 8The clinical trial design was modified as shown in Figures 9 and 10. Before dosing any patients, it was determined that patients with paroxysmal nocturnal hemoglobinuria (PNH) would not be included at this time.

[0379] Five single ascending dose (SAD) cohorts each enrolled six normal healthy volunteer (NHV) subjects (randomized 2:1 drug:placebo) to receive doses of 25 mg, 50 mg, 100 mg, 200 mg, or 400 mg of formulated C3 RNAi drug substance or placebo (i.e., four subjects in each cohort received C3 RNAi drug substance and two subjects received placebo). Two dose levels (200 mg and 400 mg) were further studied in multiple ascending dose (MAD) cohorts, with six NHV subjects in each cohort (randomized 2:1 drug:placebo) to receive formulated C3 RNAi drug substance or placebo on days 1 and 29.

[0380] In NHV, the formulated C3 RNAi drug substance was found to be generally well tolerated, with no drug-related serious adverse events (SAEs), no study discontinuations due to adverse events (AEs), no clinically significant laboratory findings, and no adverse patterns of change reported in any clinical laboratory parameters.

[0381] Total C3 protein levels in serum samples were measured by turbidimetry. A known amount of anti-C3 antibody was added to the assay matrix, and C3 was then assayed using the Beckman Immage 800 immunochemistry system to measure the increase in the rate of light scattered by particles suspended in solution due to the complex formed during the antigen-antibody reaction.

[0382] The alternative complement pathway hemolytic activity (AH50) was also assessed using a typical hemolytic assay based on the lysis of rabbit red blood cells (RA) due to complement activation on the cell surface. The AH50 (50% complement hemolytic dose) of each component was determined by adding a defined amount of test sample. Serial dilutions of the test sample were mixed with an equal volume of RA. The amount of hemoglobin released when the target cells were lysed by the action of complement was measured, and the percentage of lysed cells was calculated from this. For the cell concentrations used in this example, the most sensitive wavelength used was 415 nm, which is the main peak of the hemoglobin spectrum. For each assay, a five-point standard and a five-point characterized QC control were used to validate the run.

[0383] In addition, the reduction of C3 may also be related to the impairment of the activity of the alternative complement pathway (AP), and AP assay measurements. The AP assay is an ELISA-based assay that detects the complement membrane attack complex (MAC), a cytolytic immune effector in the final step of the complement cascade. The commercially available kit (COMPLAP330RUO, SVAR Life Sciences, Sweden) is specific for the alternative pathway because the plate is coated with a specific activator of the alternative pathway. The results described herein were calculated using negative and positive control samples according to the manufacturer's protocol.

[0384] Preliminary data from NHV showed consistent reductions in C3 serum protein levels across all SAD cohorts, with a mean reduction of 80.7% achieved at Day 29 in the 400 mg cohort that was sustained through Week 16 (see Figure 11 AH50 was also assessed and showed a mean reduction of up to 68.8% in AH50 for the 400 mg cohort (see Figure 13 ). Also evaluated AP, which showed a mean reduction of approximately 85% to 90% for the 400 mg cohort, was sustained through Week 16 (see Figure 15 ).

[0385] In the NHV MAD cohort, 4 weeks after the last dose, 200 mg and 400 mg achieved a mean C3 reduction of 79.5% and 87.8%, respectively (see e.g. Figure 12 This was associated with a mean reduction in AH50 of 67% and 91.3%, respectively, and in the 400 mg cohort, 3 of 4 subjects had an AH50 reduction of greater than 95%. The maximum reduction in serum C3 protein levels in any single subject was approximately 86% reduction in subjects in the 200 mg cohort and approximately 92% reduction in subjects in the 400 mg cohort. AP, and at week 8, the 200 mg cohort showed a mean reduction of approximately 87.2%, and the 400 mg cohort showed a mean reduction of approximately 99% at week 8 (see Figure 15 Given the long duration of inhibitory effects observed, quarterly or possibly even less frequent dosing (especially at the 400 mg dose) seems reasonable.

[0386] These data are the first reported clinical data using any inhibitor of C3 gene expression in human subjects, and more specifically, the first reported data in humans showing clinical inhibition of the alternative pathway by inhibiting C3 gene expression.

[0387] Other implementation plans

[0388] It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting C3 gene expression, comprising: an antisense strand, wherein nucleotides 1-21 of the antisense strand comprise nucleotides 1-21 of the antisense strand sequence of Table 2, Table 3, Table 5C, Table 7A, or Table 8; and a sense strand comprising a nucleotide sequence that is at least partially complementary to said antisense strand, wherein all or substantially all nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand comprising N-acetylgalactosamine.

2. According to the RNAi agent for inhibiting C3 gene expression, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differs by 0 or 1 nucleotide from the 15 consecutive nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5C, Table 7B or Table 8, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand over at least 15 consecutive nucleotides.

3. The RNAi agent of any one of claims 1-2, wherein at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

4. The RNAi agent of any one of claims 1 to 3, wherein the modified nucleotides are independently selected from the group consisting of 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′,3′-open ring nucleotide mimics, locked nucleotides, 2′-F-arabino nucleotides, 2′-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2′-O-methyl nucleotides, inverted 2′-deoxy nucleotides, 2′-amino modified nucleotides, 2′-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3′-O-methyl nucleotides. 5 . The RNAi agent of claim 4 , wherein all or substantially all of the modified nucleotides are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or a combination thereof.

6. The RNAi agent of any one of claims 1-5, wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3, Table 5C, Table 7A, or Table 8.

7. The RNAi agent of any one of claims 1-6, wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified sense strand sequences of Table 4, Table 5C, Table 7B, or Table 8.

8. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences of Table 3, Table 5C, Table 7A, or Table 8, and the sense strand comprises a nucleotide sequence of any one of the modified sequences of Table 4, Table 5C, Table 7B, or Table 8.

9. The RNAi agent of any one of claims 1-8, wherein the targeting ligand comprises:

10. The RNAi agent of any one of claims 1-9, wherein the targeting ligand is linked to the sense strand. The RNAi agent of claim 10 , wherein the targeting ligand is linked to the 5′ end of the sense strand.

12. The RNAi agent of any one of claims 1-11, wherein the sense strand is between 15 and 30 nucleotides in length, and the antisense strand is between 21 and 30 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each between 21 and 27 nucleotides in length.

14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.

15. The RNAi agent of claim 14, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

16. The RNAi agent of any one of claims 1-15, wherein the RNAi agent has two blunt ends.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two end caps.

18. The RNAi agent of any one of claims 1-17, wherein the sense strand comprises one or two inverted abasic residues.

19. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex sequence of any one of the duplexes shown in Tables 5A, 5B, 5C, or 8.

20. The RNAi agent of any one of claims 1-19, wherein the RNAi agent is a pharmaceutically acceptable salt.

21. The RNAi agent of claim 20, wherein the RNAi agent is a sodium salt.

22. A composition comprising the RNAi agent of any one of claims 1-21, wherein the composition comprises a pharmaceutically acceptable excipient.

23. The composition of claim 22, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

24. The composition of claim 22, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

25. A method of inhibiting C3 gene expression in hepatocytes, the method comprising introducing into the cells an effective amount of the RNAi agent according to any one of claims 1-21 or the composition according to any one of claims 22-24.

26. The method of claim 25, wherein C3 mRNA in the hepatocytes is reduced by at least about 50%.

27. The method of any one of claims 25-26, wherein C3 protein in the hepatocytes is reduced by at least about 50%.

28. A method of inhibiting C3 gene expression in a subject, the method comprising administering to the subject an effective amount of the RNAi agent of any one of claims 1-21 or the composition of any one of claims 22-24.

29. The method of claim 28, wherein the subject is a human subject.

30. The method of claim 28 or 29, wherein C3 mRNA is reduced by at least about 50% in the subject.

31. The method of any one of claims 28-30, wherein C3 protein in the subject is reduced by at least about 50%.

32. A method of treating a C3-related disease, disorder, symptom or other disease manifestation, the method comprising administering to a human subject in need thereof a therapeutically effective amount of a composition according to any one of claims 22-24.

33. The method of claim 32, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

34. The method of any one of claims 25-33, wherein serum C3 protein levels are reduced in the subject.

35. The method of any one of claims 25-34, wherein alternative complement pathway hemolytic activity (AH50) is reduced by at least about 50% in the subject.

36. The method of claim 35, wherein the AH50 is reduced by at least about 75%.

37. The method of claim 36, wherein the AH50 is reduced by about 90% or more.

38. The method of any one of claims 25-37, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

39. The method of any one of claims 25-37, wherein the RNAi agent is administered to a human subject at a dose of about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, or about 400 mg.

40. The method of claim 39, wherein the RNAi agent is administered to the human subject at a dose of about 100 mg, about 200 mg, or about 400 mg.

41. The RNAi agent of any one of claims 1-21 or the composition of any one of claims 22-24 for use in treating a disease, disorder or symptom mediated at least in part by dysregulated complement activity, dysregulated C3 activity or C3 gene expression.

42. The RNAi agent or composition of claim 41, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), paroxysmal nocturnal hemoglobinuria (PNH), lupus nephritis, primary membranous nephropathy (PMN), autoimmune hemolytic anemia / cold agglutinin disease (AIHA / CAD), and / or another type of complement-mediated kidney disease.

43. The RNAi agent of any one of claims 1-21 or the composition of any one of claims 22-24, for use in the preparation of a pharmaceutical composition for treating a disease, disorder or symptom mediated at least in part by dysregulated complement activity, dysregulated C3 activity or C3 gene expression.

44. The RNAi agent or composition of any one of claims 41 to 43, wherein the RNAi agent is administered to the human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of human subject body weight.

Images