Rabbit-derived monoclonal antibody and application

By developing the rabbit-derived monoclonal antibody Ab-56, the problem of insufficient binding capacity of existing antibodies has been solved, enabling efficient detection of chicken and duck interferon, and supporting the evaluation of the cellular immune protection effect of novel vaccines and the study of the immune response mechanism after viral infection.

CN120463808BActive Publication Date: 2025-12-23CHINA AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510402440.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-12-23
Estimated Expiration
2045-04-01

AI Technical Summary

Technical Problem

Existing anti-chicken interferon-gamma monoclonal antibodies are insufficient in binding capacity and scope of application, making it difficult to meet the needs of evaluating new vaccines and studying the mechanism of immune response after viral infection.

Method used

A rabbit-derived monoclonal antibody, Ab-56, has been developed. Its heavy and light chain variable regions have specific amino acid sequences, exhibit strong binding ability, and show high affinity for chicken interferon-γ and duck interferon-γ, making it suitable for ELISPOT detection.

Benefits of technology

It provides a solid foundation for evaluating the cellular immune protection efficacy of novel vaccines and studying the immune response mechanism after viral infection. It is applicable to the evaluation of vaccines for chickens, ducks and other poultry, and has high affinity and broad applicability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120463808B_ABST
    Figure CN120463808B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biology and discloses a rabbit-derived monoclonal antibody against chicken IFN-gamma protein, which contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID No. 1; and the amino acid sequence of the light chain variable region of the monoclonal antibody is shown as SEQ ID No. 2. The rabbit-derived monoclonal antibody is named Ab-56, and has the following characteristics: 1. Compared with existing monoclonal antibodies, the rabbit-derived monoclonal antibody has strong binding capacity with interferon; 2. The rabbit-derived monoclonal antibody also has strong binding capacity with duck interferon. This provides a solid foundation for evaluation of immune protection effect of some mRNA vaccines, DNA vaccines or live virus vector vaccines and research on immune response mechanism caused by virus infection, and the rabbit-derived monoclonal antibody is not only suitable for chickens, but also suitable for ducks and even other poultry for research on vaccine evaluation and cellular immune protection mechanism. In addition, the application also provides the monoclonal antibody and application.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the biological field, and particularly to a rabbit-derived monoclonal antibody and application. BACKGROUND

[0002] Interferon (IFN) is a protein with broad-spectrum antiviral activity. IFN mainly includes three types of α, β and γ, among which IFN-α and IFN-β are type I IFN. IFN-γ is type II IFN. The cells producing type I and type II IFN are different, and the signal transduction pathways and the induced antiviral proteins are also different. IFN-γ is an important cytokine secreted by T cells and natural killer cells (NK cells) and phagocytes, which plays a key role in immune response, especially in antiviral, antitumor and immune response regulation, and also has the effect of vaccine adjuvant. Chicken IFN-γ (chIFN-γ) was discovered by LOWEN THAL et al. from mitogen-stimulated chicken spleen lymphocytes, and then DIGBY et al. successfully cloned the chIFN-γ gene. Further studies have found that chIFN-γ has the same immune function as mammalian IFN-γ, and has antiviral activity and vaccine adjuvant effect.

[0003] For immunological detection of chIFN-γ, methods such as enzyme-linked immunospot assay (ELISPOT) and enzyme-linked immunosorbent assay (ELISA) can be established. ELISPOT is a highly sensitive immunodetection technology combining cell culture technology and ELISA. This technology captures the cytokines secreted by cultured cells and presents them in the form of enzyme-linked spots, which can detect the secretion of cytokines or immunoglobulins at the single cell level and accurately reflect the activity of cells in the immune system. This technology has many advantages such as high sensitivity, high reliability, high throughput, single cell level, functional detection and low cost, and is the best technology for detecting biological cell immunity today. Therefore, it is widely used in vaccine development, immune monitoring of infectious diseases and autoimmune diseases.

[0004] Many avian infectious diseases (such as H9N2 subtype avian influenza, Marek's disease, infectious bursal disease, etc.) not only rely on the role of antibodies, but also need cellular immune response to clear infection. T cells (especially CD8+ cytotoxic T cells) play a key role in killing infected cells and inhibiting virus replication. Inactivated vaccines and some subunit vaccines usually mainly induce humoral immune response (antibodies), but cellular immune response is also crucial, so it is necessary to comprehensively evaluate the effect of the vaccine by detecting cellular immune response. By detecting the secretion of IFN-γ through ELISPOT technology, the response of immune cells, especially T cells, to specific antigens can be directly evaluated, reflecting whether these cells have been activated and play an effect in the immune response. Through this method, the immune response can be detected earlier, and the strength of the response can be quantified, which will play an important role in the monitoring of infectious diseases and the development and evaluation of related new vaccines.

[0005] Reports on anti-chIFN-γ monoclonal antibodies and ELISPOT detection can be found in the following documents:

[0006] Publication No. CN118497137A, entitled Preparation and Application of a Monoclonal Antibody for Chicken IFN-γ ELISPOT Test, discloses a hybridoma cell strain capable of stably secreting anti-chicken IFN-γ protein monoclonal antibody, and uses the monoclonal antibody secreted by the hybridoma cell strain as a coating antibody for ELISPOT test. The results are as follows: chIFN-γ-secreting cells under phorbol ester + ionomycin stimulation, and compared with foreign chIFN-γ antibody pairs, show better reactivity.

[0007] The problem to be solved by the present application is how to screen a more excellent and comprehensive monoclonal antibody. SUMMARY

[0008] The present application aims to provide a rabbit-derived monoclonal antibody against chIFN-γ protein, which we named Ab-56, and has the following characteristics: 1. Compared with existing monoclonal antibodies, it has strong binding capacity with interferon; 2. It also has strong binding capacity with duck interferon. This provides a solid foundation for the evaluation of the immune protection effect of some mRNA vaccines, DNA vaccines or live virus vector vaccines and the study of the immune response mechanism after viral infection, and at the same time, it is not only suitable for chicken, but also suitable for duck and even other poultry for vaccine evaluation and study of cellular immune protection mechanism.

[0009] Meanwhile, the present application also provides a monoclonal antibody and application.

[0010] To achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0011] A rabbit monoclonal antibody against chicken IFN-gamma protein, the rabbit monoclonal antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown as SEQ ID No. 1; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown as SEQ ID No. 2.

[0012] Further, the amino acid full-length sequence of the heavy chain of the rabbit monoclonal antibody is shown as SEQ ID No. 8, and the amino acid full-length sequence of the light chain is shown as SEQ ID No. 9.

[0013] The application also discloses the use of the rabbit monoclonal antibody.

[0014] In the use, the rabbit monoclonal antibody is a coating antibody and / or a detection antibody in the kit.

[0015] Compared with the prior art, the application has the beneficial effects that:

[0016] 1. The rabbit monoclonal antibody has a strong binding capacity with interferon compared with the prior art monoclonal antibody;

[0017] 2. The rabbit monoclonal antibody prepared by the application also has a strong binding capacity with duck interferon;

[0018] The above two characteristics provide a solid foundation for the evaluation of the cell immune protection effect of some new mRNA vaccines, DNA vaccines or live virus vector vaccines and the research on the mechanism of the cell immune response caused by virus infection, and the application is not only suitable for chickens, but also suitable for ducks and even other poultry for vaccine evaluation and cell immune protection mechanism research. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 It is a plasmid map of the prokaryotic expression vector pET21b-chIFN-gamma in the embodiment 1 of the application;

[0020] Figure 2 It is an SDS-PAGE gel electrophoresis diagram of the prokaryotic expression chIFN-gamma in the embodiment 1 of the application;

[0021] Figure 3 It is a plasmid map of the eukaryotic expression vector pRK5-chIFN-gamma in the embodiment 2 of the application;

[0022] Figure 4A It is an expression map of the anti-chIFN-gamma rabbit monoclonal antibody expression vector carrying the antibody heavy chain constructed in the embodiment 3 of the application;

[0023] Figure 4BExpression profile of the anti-chIFN-γ rabbit monoclonal antibody expression vector carrying the light chain vector constructed for the embodiment 3 of the present application;

[0024] Figure 5 The result graph of the culture of the sorted 96 B lymphocytes by ELISA detection for the embodiment 3 of the present application;

[0025] Figure 6A The SDS-PAGE gel electrophoresis graph of the antibody of the anti-chIFN-γ rabbit monoclonal antibody expressed for the embodiment 3 of the present application;

[0026] Figure 6B The graph of the antibody titer of the anti-chIFN-γ rabbit monoclonal antibody expressed for the embodiment 4 of the present application;

[0027] Figure 6C The test result of the affinity of the 3 monoclonal antibodies and foreign antibodies determined by the ELISA method for the embodiment 4 of the present application;

[0028] Figure 7 The WB result graph of the rabbit monoclonal antibody Ab-56 antibody detecting chicken chIFN-γ for the embodiment 5 of the present application;

[0029] Figure 8 The WB result graph of the rabbit monoclonal antibody Ab-56 antibody detecting duck DuIFN-γ for the embodiment 6 of the present application;

[0030] Figure 9 The monoclonal antibody combination screening result graph for the embodiment 8 of the present application;

[0031] Figure 10 The best coating antibody concentration and the screening result graph of the color developing solution for the embodiment 8 of the present application;

[0032] Figure 11 The best biotin-labeled detection antibody concentration screening result graph for the embodiment 8 of the present application;

[0033] Figure 12 The best HRP-labeled streptavidin concentration screening result graph for the embodiment 8 of the present application. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present application will be described clearly and completely below with the accompanying drawings of the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments of the present application. Based on the embodiments of the present application, all the other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application. Specific embodiment 1

[0036] A method for expressing recombinant chIFN-γ protein in prokaryotes, which is operated as follows:

[0037] Take the spleen of 6-8 weeks old chicken, extract RNA from chicken spleen cells with Magen RNA extraction kit (item number R411102), and use Solap Bio reverse transcription kit (M-MLV, item number 2641Q) to generate cDNA for PCR amplification of chIFN-γ gene by using oligo-dT primer. The sequence of PCR amplification primer is:

[0038] chIFN-γ-F (GCGCCATATGCTAAATCTTGTTC, SEQ ID NO. 14)

[0039] chIFN-γ-R (GGCCTCGAGGCAATTGCATCTCCTCTG, SEQ ID NO. 15)

[0040] The PCR reaction system contains 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 6.5 μL ddH2O, 12.5 μL 2×Phanta Max Master Mix (Dye Plus) (Novagen, item number P525). The PCR program is 95℃ pre-denaturation for 5 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 60 s, 30 cycles, 72℃ extension for 5 min, and then 4℃ maintenance. The amplified band size is 450 bp, which is the sequence of chIFN-γ protein without signal peptide, and the sequencing result is consistent with the chIFN-γ gene (X99774.1) registered in GenBank.

[0041] The PCR amplified chIFN-γ gene and the laboratory preserved pET21b(+) vector are double digested with Nde I (item number R0111V) and Xho I (item number R0146V) purchased from NEB company, and then connected with NEB T4 ligase (item number M0202V) to construct pET21b-chIFN-γ prokaryotic expression plasmid. The plasmid has 6×His tag at the C-terminal of chIFN-γ gene for protein purification (plasmid map is shown in Figure 1 ).

[0042] The pET21b-chIFN-γ plasmid is added to an EP tube containing BL21 DE3 competent cells (Bi Yun Tian, item number C1400), mixed gently, and then placed in an ice bath for 30 min, a 42°C water bath for 45 s, and then placed in an ice bath for 2 min. 500 μL of LB-antibiotic-free solution is added, and the mixture is incubated at 37°C, 220 rpm for 45 min. 150 μL of the bacterial solution is spread on an ampicillin LB solid medium, and incubated at 37°C overnight. Five single colonies are selected and inoculated in 1 mL of ampicillin LB culture solution, and incubated at 37°C, 220 rpm for 4-6 h. The bacterial solution is used as a template for PCR using chIFN-γ gene amplification primers, and the positive bacterial solution is sent for sequencing.

[0043] The bacterial solution with correct sequencing is inoculated in 10 mL of ampicillin LB culture solution at a ratio of 1:100 for overnight activation. The next day, 200 mL of ampicillin LB culture solution is inoculated at a ratio of 1:50, and incubated at 37°C, 200 rpm until the OD 600nm is about 0.6-0.8. IPTG is added to a final concentration of 0.5 mM, and the mixture is induced at 37°C, 200 rpm for 8 h. The bacterial solution is centrifuged, resuspended in PBS, and sonicated to release the protein. The supernatant is collected by centrifugation, and purified according to the instructions of the Kingsway NI affinity chromatography column (item number L00250). 100 mM imidazole is used for impurity removal, and 200 mM imidazole is used for elution. A total of 10 mg of soluble chIFN-γ protein expressed in prokaryotes is obtained (see SDS-PAGE gel electrophoresis in Figure 2 ).

[0044] Example 2

[0045] A eukaryotic expression method for preparing recombinant chIFN-γ protein is as follows:

[0046] The chIFN-γ gene amplified in Example 1 is inserted into the commercially available vector pRK5 preserved in the laboratory, and a eukaryotic expression plasmid pRK5-chIFN-γ is constructed according to the method of Example 1 (see reference Figure 3 ). The constructed plasmid is transformed into Trans5α E. coli competent cells (purchased from Beijing Zison Biotechnology Co., Ltd.), and positive single colonies with correct sequences are identified by colony PCR and sequencing. The positive single colonies are inoculated in test tubes containing 20 mL of ampicillin LB culture solution at a ratio of 1:100, and incubated at 37°C, 200 rpm overnight. The bacterial solution is collected, and the plasmid is extracted using an endotoxin-free plasmid extraction kit (OMEGA, item number D694302).

[0047] Two to three hours before transfection, 200 mL of HEK293F cells were seeded in sterile flasks at a density of 2 x 106 / mL. 300 μg of plasmid DNA was added to 20 mL of fresh culture medium, mixed, and then 900 μL of PEI transfection reagent (Jierui, Catalog No. BYPS-24765) was added, mixed, and allowed to stand for 10-20 minutes to form a DNA-PEI complex, which was then added evenly to the transfection flask. Protein expression was detected 60-72 hours after transfection.

[0048] Since the chIFN-γ protein was well expressed in the cell supernatant, it was purified according to the instructions for the NI affinity chromatography column (Genscript, Catalog No. L00250) to obtain 2 mg of protein. The purified chIFN-γ was then labeled according to the FITC labeling kit (Bi Yun Tian, Catalog No. P0639M) and used as an antigen for sorting chIFN-γ-specific single B cells.

[0049] Example 3

[0050] The preparation of chIFN-γ-specific monoclonal antibodies was prepared using flow cytometry sorting technology, and the specific operation was as follows:

[0051] A healthy adult New Zealand white rabbit weighing more than 2 kg was used. 1 mL of prokaryotic expressed recombinant chIFN-γ protein containing 500 μg was mixed and emulsified with an equal volume of Freund's complete adjuvant (Sigma), and was immunized subcutaneously at multiple points on both sides of the rabbit's spine. Two weeks later, a second immunization was performed, and the subsequent incomplete Freund's adjuvant (Sigma) was used in the same way and amount as the first time. On the 8th day after each immunization, 1 mL of blood was collected from the marginal ear vein, and the serum was separated and detected for antibody titer by ELISA. When the antibody titer was greater than 10 6 , the immunization was stopped.

[0052] To perform flow cytometry sorting on the rabbit's spleen B lymphocytes and screen for chIFN-γ-specific single B cells, the PBMC isolation kit (Solabio, Catalog No. P8760) was used to isolate the rabbit's spleen lymphocytes, which were resuspended in ice bath FACS buffer and the cell concentration was adjusted to 10 6 cells / mL. 10 μg of phycoerythrin (PE)-labeled goat anti-rabbit secondary antibody (abcom, Catalog No. ab72465) and 20 μg of BV421-labeled eukaryotic expressed recombinant chIFN-γ protein prepared in Example 2 were added in sequence, and incubated on ice for 30 minutes to allow the labels to bind to the cell surface antigen receptors.

[0053] After the completion of the labeling, 400 g centrifugation for 10 minutes, resuspend the cells with ice bath FACS buffer and wash 3 times, constant volume to 500 μL FACS buffer, transfer to sterile flow tube ice. On the flow cytometer, optimize the conditions, set the sorting gate and flow rate, with the help of the sorting system, sort the PE + BV421 + cells into a 96-well PCR plate containing reverse transcriptase and lysis solution, and these cells are chIFN-γ specific single B lymphocytes.

[0054] At room temperature, the single specific single B cells in the 96-well PCR plate were lysed, and the heavy and light chain variable region mRNA was reverse transcribed into cDNA template with oligo-dT primer. Two rounds of nested PCR were performed using primers provided by Yantai Teko Biotechnology Co., Ltd. to obtain the antibody heavy and light chain variable region DNA genes. The VHand VLamino acid sequences were obtained by sequencing the amplified products, and the selected VH and VL genes were cloned into the plasmid expression vector (pTT5CH, pTT5CL) with light and heavy chain constant region, inserted upstream of the CH and CL genes, to obtain light and heavy chain gene expression vectors. The vector contains IL-2 secretion signal peptide (SEQ ID No. 7: MYRMQLLSCIALSLALVTNS), leader sequence, promoter sequence, poly(A) sequence, heavy chain constant region (CH) and light chain constant region (CL) genes of rabbit monoclonal antibody, etc. The vector map is shown in Figure 4A and Figure 4B The constructed vector was transformed into Trans5α E. coli competent cells, and enough plasmid was prepared for subsequent transfection and expression.

[0055] 1 μg of plasmid containing heavy and light chain genes was transferred into 24-well plate HEK293T cells at a ratio of 1:1, and the cells expressed heavy and light chains and assembled into complete antibody structure released into the culture medium. After 60-72 hours of culture, the supernatant contained recombinant rabbit monoclonal antibodies that could recognize chIFN-γ. Figure 5 It is known that 27 of the 96 cell supernatants are chIFN-γ positive. After removing the non-specific B lymphocytes, 8 chIFN-γ specific single B lymphocytes were obtained, and the antibodies produced by them were named Ab-6, Ab-24, Ab-38, Ab-48, Ab-56, Ab-66, Ab-68, and Ab-75. The three strains with the highest affinity (Ab-38, Ab-56, and Ab-68 antibodies) were selected for subsequent experiments, and their variable region amino acid sequences are as follows:

[0056] Ab-56 antibody, heavy chain variable region amino acid as SEQ ID No. 1, light chain variable region amino acid as SEQ ID No. 2, the amino acid full-length sequence of its heavy chain is as shown in SEQ ID No. 8, and the amino acid full-length sequence of the light chain is as shown in SEQ ID No. 9;

[0057] Ab-68 antibody, heavy chain variable region as SEQ ID No. 3, light chain variable region as SEQ ID No. 4, the amino acid full-length sequence of its heavy chain is as shown in SEQ ID No. 10, and the amino acid full-length sequence of the light chain is as shown in SEQ ID No. 11;

[0058] Ab-38 antibody, heavy chain variable region as SEQ ID No. 5, light chain variable region as SEQ ID No. 6, the amino acid full-length sequence of its heavy chain is as shown in SEQ ID No. 12, and the amino acid full-length sequence of the light chain is as shown in SEQ ID No. 13.

[0059] Referring to the method in Example 2, the above three monoclonal antibodies were mass expressed using HEK293F cells. The monoclonal antibodies were purified from the supernatant using protein A affinity gel resin, and the antibody expression was identified by SDS-PAGE gel electrophoresis. The results are shown in FIG. 2, and all the antibodies have obvious bands at 55KDa and 25KDa, indicating that the antibodies are successfully expressed. The antibodies were concentrated to 1 mg / mL using 30kDa concentration tubes, and were aliquoted and stored in a -20°C refrigerator for standby. Figure 6A

[0060] Example 4

[0061] The binding ability of the prepared monoclonal antibodies to chIFN-γ was determined by ELISA, and the operation was as follows:

[0062] The prokaryotic expressed chIFN-γ protein was diluted with PBS to 1 μg / ml, coated in a 96-well ELISA plate at 100 μL / well, and incubated at 4°C overnight. The plate was washed with 200 μL PBST for 3 times, 3 minutes each time, 200 μL of PBS containing 5% skim milk was added to each well, and incubated at 37°C for 2h. The plate was washed with 200 μL PBST for 3 times, 3 minutes each time. The antibody to be tested was added at 100 μL / well in a 2-fold gradient (starting from 1:400), and incubated at 37°C for 1h. The plate was washed with 200 μL PBST for 3 times, 3 minutes each time. The HRP-labeled goat anti-rabbit IgG antibody was diluted with PBS containing 2.5wt% skim milk powder at 1:5000, 100 μL was added to each well, and incubated at 37°C for 1h. The plate was washed with 200 μL PBST for 3 times, 3 minutes each time. 100 μL of commercial TMB color developing liquid was added to each well, and reacted at room temperature for 15 min in the dark, then 50 μL of 2M H2SO4 was added to terminate the reaction, and the enzyme-labeled instrument was read​ Absorbance value.

[0063] The foreign antibody (MT7C10) was used as a positive control and the same procedure was followed, but the secondary antibody was an HRP-labeled goat anti-mouse IgG antibody.

[0064] With a 2.1-fold negative control The value is the CUT OFF value; see the results below. Figure 6B As shown, the titers of Ab-38, Ab-56, and Ab-68 antibodies are all greater than 1:819200, which is higher than the titer of foreign antibodies (MT7C10).

[0065] The affinity dissociation constant (KD value) of an antibody is an important indicator of the affinity between an antibody and an antigen. Its value varies depending on the antibody-antigen pair, and is generally in the range of 10. -6 -10 -12 Within the mol / L range, the smaller the KD value, the higher the affinity. A scatter plot is drawn with absorbance values ​​on the ordinate and antibody concentration on the abscissa, generating a logarithmic trend line and the corresponding formula. Half of the maximum absorbance value (considered as the absorbance at which the antigen-antibody binding rate is 50%) is substituted into the above formula to calculate the antibody concentration, which is the antibody affinity dissociation constant (KD).

[0066] The results are as follows Figure 6C As shown. The calculated KD values ​​for the four monoclonal antibodies are as follows:

[0067] Ab-38 strain: 8.08×10 -11 mol / L;

[0068] Ab-56 strain: 6.49×10 -11 mol / L;

[0069] Ab-68 strain: 7.16×10 -11 mol / L;

[0070] Foreign antibody (MT7C10): 2.05 × 10⁻⁶ -10 mol / L.

[0071] The KD values ​​of the above four monoclonal antibodies are all within the high affinity range, therefore they are all high affinity antibodies.

[0072] Among them, the KD values ​​of Ab-38, Ab-56 and Ab-68 are relatively close, and their affinity levels are comparable; the KD values ​​of foreign antibodies are relatively large, and although they are within the range of high affinity antibodies, their affinity is slightly lower than that of the three antibodies provided in this invention.

[0073] Example 5

[0074] The chIFN-γ binding ability of the prepared monoclonal antibody pair was determined by Western Blot.

[0075] The specific operation is as follows:

[0076] (1) The prokaryotic expressed chIFN-γ was diluted to a concentration of 0.5 mg / mL, 50 μL of the sample was mixed with 10 μL of 6x protein loading buffer, and boiled at 100°C for 10 min, and 10 μL was spotted for SDS-PAGE gel electrophoresis. Since the size of the target protein is about 15 KDa, the protein gel concentration used is 12 wt%; the protein was transferred to the PVDF membrane by the operation of Western Blot; after the transfer was completed, the PVDF membrane was taken out, washed with PBS, and then 10 mL of PBS containing 5 wt% skim milk was used for blocking at 37°C for 2 h.

[0077] (2) The blocked PVDF membrane was washed with PBST three times for 5 min each time, 10 mL of Ab-56 antibody diluted 1:5000 times with 2.5 wt% skim milk in PBS was added, and incubated at 4°C overnight. At the same time, a foreign anti-chIFN-γ antibody was used for comparison.

[0078] (3) PBST was washed three times for 5 min each time, 10 mL of commercial HRP-labeled goat anti-rabbit IgG antibody (Bi Yun Tian, product number A0208) diluted 1:5000 times with 2.5 wt% skim milk in PBS was added, and incubated at 37°C for 1 h. The secondary antibody used in the control group (foreign anti-chIFN-γ antibody group) was HRP-labeled goat anti-mouse IgG antibody (Bi Yun Tian, product number A0216).

[0079] (4) PBST was washed three times for 5 min each time, ECL luminescent liquid was added, and reacted at room temperature for 1 min. Photographed and analyzed by a chemiluminescence imaging system.

[0080] The results are shown in Figure 7 Ab-56 appeared obvious positive bands at 16 KDa and 32 KDa (chIFN-γ dimer), indicating that the antibody Ab-56 described in the application reacts well with chIFN-γ, and can provide important materials for the Western Blot detection of chIFN-γ. The foreign antibody (MT7C10) has similar detection performance as Ab-56.

[0081] Example 6

[0082] chIFN-γ has a large difference in similarity with the amino acid sequence of mammalian IFN-γ, such as only 25.5% similarity with rabbit IFN-γ, but 66.1% similarity with duck IFN-γ (DuIFN-γ). This means that there is a certain similarity between them, and some epitope regions can be recognized by the monoclonal antibody of chIFN-γ.

[0083] According to the method in Example 1, the prokaryotic expression vector of DuIFN-γ was constructed and DuIFN-γ protein was expressed. Then, according to the steps of Example 5, Western Blot assay was performed to determine the binding ability of the prepared monoclonal antibody to DuIFN-γ.

[0084] As shown in Figure 8 , the results show that the Ab-56 antibody also has strong binding ability to DuIFN-γ. At the same time, compared with foreign antibodies (MT7C10), the binding ability of Ab-56 antibody to DuIFN-γ is obviously stronger than that of foreign antibodies, so Ab-56 antibody has great potential for use in the detection of DuIFN-γ.

[0085] Example 7

[0086] Exploration of ELISPOT kit conditions

[0087] In Example 4, Ab-38 antibody, Ab-56 antibody, and Ab-68 antibody were screened to have the highest affinity; these three antibodies were labeled with HRP, HRP-Ab-38 (corresponding to Ab-38 antibody), HRP-Ab-56 (corresponding to Ab-56 antibody), and HRP-Ab-68 (corresponding to Ab-68 antibody), and their effects as detection antibodies were evaluated by ELISA.

[0088] The specific operation is as follows:

[0089] (1) The purified chIFN-γ with a concentration of 1 ug / mL was diluted with PBS at a dilution ratio of 3 times, 100 uL per well, and added to a 96-well ELISA plate, and incubated at 4°C overnight.

[0090] (2) Washed with PBST for 3 times, 200 uL each time, and added 200 uL / well of PBST containing 5 wt% skim milk to each well, and incubated at 37°C for 1 h.

[0091] (3) Washed with PBST for 3 times, 200 uL each time, and added 100 uL / well of 1 mg / mL HRP-Ab-38, HRP-Ab-56, and HRP-Ab-68 diluted at 1:2000 to each well, and incubated at 37°C for 1 h.

[0092] (4) Wash 3 times with PBST, 200 μL each time, use 100 μL TMB color developing solution to develop color at room temperature for 15 min, add 50 μL 3M H2SO4 to stop the reaction, use an enzyme label meter to read OD 450nm

[0093] As shown in Table 1, the three antibodies have strong binding capacity for different coating concentrations of interferon. Among them, when there is no chIFN-γ coating, No. 38 antibody is used as the detection antibody, which has a higher background value, so it is not recommended to be used as the detection antibody.

[0094] Table 1 Test results of chIFN-γ binding capacity of different antibodies

[0095]

[0096]

[0097] Example 8

[0098] Determination of the best antibody pair

[0099] (1) Use Ab-38, Ab-56, and Ab-68 as coating antibodies, coat the ELISPOT filter plate at a concentration of 5 μg / mL, 100 uL per well.

[0100] (2) Wash 3 times with sterile PBS, 200 μL each time, add 10 μL PHA stimulation to each well as a positive control, add 10 μL PBS to the control group as a negative control, add 1x10^6 chicken PBMC cells per well, and incubate at 37°C, 5% CO2 for 48 hours.

[0101] (3) Wash 3 times with PBS, 200 μL each time, use bio-Ab-56 (biotin-labeled Ab-56 detection antibody) and bio-Ab-68 (biotin-labeled Ab-68 detection antibody) at a concentration of 1 μg / mL as detection antibodies, 100 μL per well, and incubate at 37°C for 1 h.

[0102] (4) Wash 3 times with PBS, 200 μL each time, add 1:2000 diluted HRP-labeled streptavidin to each well, 100 μL per well, and incubate at 37°C for 1 h.

[0103] (5) Wash 3 times with PBS, 200 μL each time, use TMB color developing solution to develop color at room temperature for 15 min, rinse 4 times with deionized water. Discard the liquid, place it in a well-ventilated place to dry in the dark, and take a picture of the corresponding well using a plate reader.

[0104] As follows Figure 9 ​As shown, when Ab-56 was used as the coating antibody and bio-Ab-68 was used as the detection antibody, the number of spots was the largest and clearest, the staining background color was light, and the control group had no obvious spots.

[0105] Optimal coating antibody concentration and selection of chromogenic solution

[0106] The Ab-56 antibody protein was diluted with PBS buffer to six concentrations: 10 μg / mL, 5 μg / mL, 2.5 μg / mL, 1.25 μg / mL, 0.625 μg / mL, and 0.3125 μg / mL. 100 μL of each protein was coated onto each well of an ELISPOT plate. The ELISPOT procedure was then performed, and finally, different chromogenic solutions were used for color development.

[0107] Depend on Figure 10 It was found that the number of spots was appropriate and clear at a dilution of 5 μg / mL (500 ng / well), with a light staining background, while the control group showed no obvious spots. At different concentrations, the number of spots with AEC chromogenic solution (solarbio, catalog number A2010) was less than that with TMB chromogenic solution (Mabtech, catalog number 3651-10), indicating that TMB chromogenic solution was more sensitive. Therefore, TMB chromogenic solution was selected as the final chromogenic solution.

[0108] Selection of optimal biotin-labeled detection antibody concentration

[0109] Bio-Ab-68 was diluted with PBS containing 0.5% FBS to five working concentrations: 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.125 μg / mL, and 0.0625 μg / mL. ELISPOT procedures were then performed. Results were judged based on the number of spots in the experimental group, a suitable light staining background, and the absence of obvious spots in the control group. (Results referenced...) Figure 11 Ultimately, the optimal concentration of the detection antibody bio-Ab-68 was determined to be 0.5 μg / mL.

[0110] Selection of optimal HRP-labeled streptavidin concentration

[0111] Following the conditions established above, ELISPOT procedures were performed. After incubation with bio-Ab-68 for 1 hour, the sample was washed three times with 200 μL of PBS each time. HRP-labeled streptavidin (Mabtech, catalog number 3310-9-1000) was diluted with PBS containing 0.5% FBS at ratios of 1:1000, 1:2000, 1:4000, 1:8000, and 1:16000, with 100 μL added to each well. The mixture was incubated at 37°C for 1 hour. ELISPOT development and termination procedures were then continued. The criteria for judgment were an appropriate number of spots in the experimental group, a light staining background, and no obvious spots in the control group. (Reference)Figure 12 As a result, the optimal dilution ratio of HRP-labeled streptavidin was finally determined to be 1 : 1000.

[0112] It will be apparent to those skilled in the art that the application is not limited to the details of the foregoing exemplary embodiments and that the present application can be implemented in other particular forms without departing from the spirit or essential characteristics thereof. The presently disclosed embodiments are, therefore, to be considered in all respects as illustrative and not restrictive, the scope of the application being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. No feature of the application is considered critical unless it is expressly stated in the claims.

Claims

1. A rabbit-derived monoclonal antibody against chicken IFN-γ protein, characterized in that, The rabbit-derived monoclonal antibody contains a heavy chain variable region and a light chain variable region; the amino acid sequence of the heavy chain variable region of the monoclonal antibody is shown in SEQ ID No. 1; the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID No.

2.

2. Use of the rabbit monoclonal antibody preparation kit as described in claim 1.

3. The use according to claim 2, characterized in that, The rabbit-derived monoclonal antibody is the coating antibody and / or detection antibody in the kit.

Citation Information

Patent Citations

  • Preparation and application of monoclonal antibody for chicken IFN-gamma ELISPOT test

    CN118497137A

  • A humanized antibody and antigen-binding fragment (FAB) that bind to human interferon-gamma, DNA fragments encoding said antibody and antigen-binding fragment, a cell transformed with a DNA fragment, and a method for producing said antibody and antigen-binding fragment

    RU2013123639A