Application of ACTA2 + MCAM + cells in recurrence, radiotherapy curative effect and prognosis evaluation and treatment of nasopharyngeal carcinoma patients

Through the detection and functional inhibition of ACTA2+MCAM+ cells, the problems of nasopharyngeal carcinoma recurrence and radiotherapy resistance were solved, and accurate evaluation and improvement of treatment effect were achieved.

CN120468427AActive Publication Date: 2025-08-12THE FIFTH AFFILIATED HOSPITAL SUN YAT SEN UNIV +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510615532.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-08-12
Estimated Expiration
2045-05-14

AI Technical Summary

Technical Problem

The prior art is difficult to effectively evaluate the recurrence, radiotherapy efficacy and prognosis of patients with nasopharyngeal carcinoma, and there is a lack of effective treatment options for patients with local recurrence after radiotherapy.

Method used

ACTA2+MCAM+ cells were used as biomarkers, and their proportions were detected and evaluated using corresponding kits and reagents. At the same time, specific binding antibodies, gene expression inhibitors and PI3K-AKT pathway inhibitors were used to clear or inhibit the function of ACTA2+MCAM+ cells and block their interaction with tumor cells.

Benefits of technology

It improves the accuracy of nasopharyngeal carcinoma recurrence assessment, significantly reduces radiotherapy resistance, improves radiotherapy efficacy, and provides an effective treatment plan for relapsed patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120468427A_ABST
    Figure CN120468427A_ABST
Patent Text Reader

Abstract

The invention provides application of ACTA2 + MCAM + cells in recurrence, radiotherapy curative effect and prognosis evaluation and treatment of nasopharyngeal carcinoma patients. A large number of researches find that the ACTA2 + MCAM + cell can be used as a specific biomarker for nasopharyngeal carcinoma recurrence, radiotherapy curative effect and prognosis evaluation, and a reagent for detecting the ACTA2 + MCAM + cell can be used for preparing a product for nasopharyngeal carcinoma recurrence, radiotherapy curative effect and prognosis evaluation. Moreover, the ACTA2 + MCAM + cells are combined with ITGA2 integrin receptors on the surfaces of nasopharyngeal carcinoma cells by secreting IV type collagen, and a downstream PI3K-AKT signal channel is activated, so that the radiotherapy resistance of the nasopharyngeal carcinoma cells is promoted. Therefore, the radiotherapy resistance of nasopharyngeal carcinoma can be effectively reversed by specifically removing the ACTA2 + MCAM + cells, inhibiting the ACTA2 + MCAM + cells from generating the IV-type collagen, blocking the combination of the IV-type collagen and an ITGA2 integrin receptor on the surface of a tumor cell and inhibiting a downstream PI3K-AKT signal channel, and the radiotherapy curative effect is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular diagnosis and biomedicine technology, and in particular to the field of ACTA2 + MCAM + Application of cells in recurrence, radiotherapy efficacy and prognosis evaluation and treatment of patients with nasopharyngeal carcinoma. Background Art

[0002] Nasopharyngeal carcinoma is highly prevalent in my country, and a large number of infiltrating immune cells have been found around tumor foci, suggesting the existence of a specific tumor microenvironment (TME) in nasopharyngeal carcinoma. The tumor microenvironment is a complex microecological system with spatiotemporal interactions between heterogeneous cell types (including malignant cells, immune cells, and stromal cells). The tumor microenvironment and its heterogeneity are closely related to tumor treatment resistance and tumor recurrence. Radiotherapy is the most critical treatment for patients with nasopharyngeal carcinoma. About 10-20% of patients with endemic nasopharyngeal carcinoma experience local recurrence after previous radical radiotherapy, and the current conventional treatment for locally recurrent nasopharyngeal carcinoma is a second course of radiotherapy.

[0003] Therefore, timely recurrence assessment, radiotherapy efficacy assessment, and prognosis assessment of nasopharyngeal carcinoma are particularly important for timely intervention and treatment of recurrent patients and selection of appropriate treatment plans. Summary of the Invention

[0004] Based on this, the object of the present invention is to provide ACTA2 + MCAM + Application of cells in the evaluation of recurrence, radiotherapy efficacy and prognosis, and treatment of cancer patients.

[0005] To achieve the above objectives, the present invention adopts the following technical solutions.

[0006] The first aspect of the present invention is to provide ACTA2 + MCAM + Application of cells as biomarkers in the assessment of recurrence, radiotherapy efficacy, and / or prognosis of patients with nasopharyngeal carcinoma.

[0007] The second aspect of the present invention is to provide a method for detecting ACTA2 + MCAM + Use of a cell ratio reagent in preparing a product for evaluating recurrence, and / or radiotherapy efficacy, and / or prognosis of nasopharyngeal carcinoma patients.

[0008] In some embodiments, the reagents include reagents for flow cytometry detection and immunofluorescence detection.

[0009] In some embodiments, the product is a kit.

[0010] The third aspect of the present invention is to provide a kit for evaluating the recurrence, radiotherapy efficacy and prognosis of nasopharyngeal carcinoma patients, the kit comprising a kit for detecting ACTA2 + MCAM + Reagents for cell ratios.

[0011] In some embodiments, the reagents include reagents for flow cytometry detection and immunofluorescence detection.

[0012] The fourth aspect of the present invention is to provide a method for clearing ACTA2 + MCAM + Cell-derived agents, and / or inhibitors of ACTA2 + MCAM + Use of reagents for cell production of type IV collagen and / or PI3K-AKT pathway inhibitors in the preparation of radiosensitizers for nasopharyngeal carcinoma patients.

[0013] In some embodiments, the agent comprises at least one of an MCAM-specific binding antibody, an agent that inhibits COL4A1 gene expression, an agent that inhibits COL4A2 gene expression, and MK2206.

[0014] The fifth aspect of the present invention is to provide a radiosensitizer for nasopharyngeal carcinoma patients, wherein the main active ingredients of the radiosensitizer include a scavenger of ACTA2 + MCAM + Cell-based reagents, inhibiting ACTA2 + MCAM + At least one of an agent that induces cells to produce type IV collagen and a PI3K-AKT pathway inhibitor.

[0015] In some embodiments, the agent comprises at least one of an MCAM-specific binding antibody, an agent that inhibits COL4A1 gene expression, an agent that inhibits COL4A2 gene expression, and MK2206.

[0016] Compared with the prior art, the present invention has the following beneficial effects.

[0017] After extensive research, the present invention found that compared with patients with newly diagnosed nasopharyngeal carcinoma, the expression of ACTA2 in biological samples of patients with recurrent nasopharyngeal carcinoma was significantly higher than that in patients with newly diagnosed nasopharyngeal carcinoma. + MCAM + The content of ACTA2 cells is significantly increased and can be used to evaluate the recurrence of nasopharyngeal carcinoma patients. + MCAM + ACTA2 cells are also significantly associated with poor prognosis and radiotherapy resistance in nasopharyngeal carcinoma patients. + MCAM +Cells can be used as specific biomarkers for nasopharyngeal carcinoma recurrence, radiotherapy efficacy and prognosis assessment. + MCAM + Cell-based reagents can be used to prepare products for cancer recurrence, radiotherapy efficacy, and prognosis assessment.

[0018] Furthermore, the present invention also found that ACTA2 + MCAM + Cells secrete type IV collagen and bind to the ITGA2 integrin receptor on the surface of tumor cells, activating the downstream PI3K-AKT signaling pathway, thereby promoting cancer cell radiotherapy resistance. + MCAM + Cells produce type IV collagen, blocking the binding of type IV collagen to the ITGA2 integrin receptor on the surface of tumor cells and inhibiting the downstream PI3K-AKT signaling pathway can effectively reverse the radiotherapy resistance of tumor cells and improve the efficacy of radiotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 For ACTA2 + MCAM + Experimental results on the correlation between cells and recurrence in patients with nasopharyngeal carcinoma.

[0020] Figure 2 For ACTA2 + MCAM + Experimental results showing that cells are associated with poor prognosis in patients with nasopharyngeal carcinoma.

[0021] Figure 3 For ACTA2 + MCAM + Experimental results on the relationship between cells and radioresistance in patients with nasopharyngeal carcinoma.

[0022] Figure 4 For ACTA2 + MCAM + Experimental results on promoting radioresistance of nasopharyngeal carcinoma cells through type IV collagen.

[0023] Figure 5 These are the experimental results showing that collagen IV promotes radioresistance of nasopharyngeal carcinoma cells by binding to the integrin receptor ITGA2 on the surface of nasopharyngeal carcinoma cells.

[0024] Figure 6 To inhibit the PI3K-AKT pathway after ACTA2 + MCAM + The related experimental results showed that the tumor-promoting effect of cells was significantly weakened. DETAILED DESCRIPTION

[0025] Experimental procedures in the following examples, where specific conditions are not specified, generally followed conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. All commonly used chemical reagents used in the examples were commercially available.

[0026] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0027] The terms "comprise," "comprising," and "having," and any variations thereof, are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, product, or device comprising a series of steps is not limited to the listed steps or modules but may optionally include steps not listed, or other steps inherent to the process, method, product, or device.

[0028] The term "and / or" as used herein describes the relationship between associated objects, indicating that three possible relationships exist. For example, "A and / or B" can represent: A exists alone, A and B exist simultaneously, or B exists alone. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0029] The following describes the method in conjunction with specific embodiments.

[0030] In the following examples, ACTA2 + MCAM + MCAM + Tumor-associated fibroblasts (MCAMs) + mCAFs).

[0031] Example 1

[0032] 40 paired clinical samples from patients with newly diagnosed and recurrent nasopharyngeal carcinoma (validation cohort 1) were collected. Immunofluorescence staining was used to detect MCAM in the samples. + The proportion of tumor-associated fibroblasts.

[0033] Figure 1 A in the middle is a typical immunofluorescence staining result. Figure 1 Middle B is the statistical result graph, which shows that compared with the samples of patients with newly diagnosed nasopharyngeal carcinoma, the expression of ACTA2 in the samples of patients with recurrent nasopharyngeal carcinoma is significantly higher than that in the samples of patients with newly diagnosed nasopharyngeal carcinoma. + MCAM +The proportion of double-positive tumor-associated fibroblasts was significantly increased in patients with recurrent nasopharyngeal carcinoma.

[0034] Furthermore, to verify the ACTA2 + MCAM + The role of double-positive tumor-associated fibroblasts in evaluating the recurrence of nasopharyngeal carcinoma. 10 PT and 10 RT nasopharyngeal carcinoma in situ lesions were re-cultured for primary fibroblasts, and MCAM was sorted by flow cytometry. + The proportion of tumor-associated fibroblasts was found in RT samples, MCAM + The proportion of mCAFs was 58.47% (median), which was almost 9 times that of PT samples (median, 6.275%) ( Figure 1 Further, we performed ROC curve analysis and found that MCAM + When mCAFs cells were used to predict the recurrence of nasopharyngeal carcinoma, the AUC was 0.9100 ( Figure 1 As shown in D), the accuracy is higher. Therefore, MCAM + mCAFs have a high predictive value for the prognosis of nasopharyngeal carcinoma patients.

[0035] The above results show that MCAM + Tumor-associated fibroblasts can be used as a specific assessment marker for nasopharyngeal carcinoma recurrence with high accuracy.

[0036] Example 2

[0037] We also found that MCAM + Tumor-associated fibroblasts are significantly associated with poor prognosis in patients with nasopharyngeal carcinoma. Figure 2 As shown in the validation cohort 2, we collected samples from 86 pNPC patients who had received radiotherapy and used immunofluorescence staining to detect MCAM. + The proportion of mCAFs cells was analyzed, and the samples were divided into high MCAM according to the detection results. + mCAFs cell ratio group and low MCAM + The mCAFs cell ratio groups were grouped as follows: the top 30% of patients with MCAM expression were defined as the high MCAM expression group, and the bottom 70% of patients were defined as the low MCAM expression group. The prognoses of the two groups were compared.

[0038] The results showed that low MCAM + Compared with the mCAFs cell ratio group, a higher proportion of MCAM + mCAFs were associated with worse LRRFS ( Figure 2 B) is related to OS ( Figure 2 Middle A), multivariate analysis also suggested that MCAM+ The proportion of mCAFs+ cells was an important independent predictor of LRRFS (HR=8.93, P<0.001) and OS outcomes (HR=7.69, P=0.015) (Table 1).

[0039] Table 1

[0040]

[0041] Example 3

[0042] MCAM + Tumor-associated fibroblasts are significantly associated with radioresistance in nasopharyngeal carcinoma patients.

[0043] 1. In vitro cell line experiments

[0044] First, we successfully identified MCAM by flow cytometry from fresh tissue samples of patients with recurrent nasopharyngeal carcinoma. + myCAFs(ACTA2 + MCAM + ) and MCAM - CAFs (ACTA2 + MCAM - ), the identification results are shown in Figure Figure 3 As shown in A.

[0045] MCAM + CAFs and MCAM - CAFs were co-cultured with nasopharyngeal carcinoma cell lines C666 and TW03, respectively, as follows: nasopharyngeal carcinoma cell lines and fibroblasts were indirectly co-cultured using a 0.42 μm pore size Tranwell chamber (Cat 3412, Corning). C666 cells or TW03 cells were seeded at a ratio of 1.5 × 105 on the bottom of a six-well plate, and fibroblasts were seeded at a ratio of 5 × 10 4 The cells were seeded at a high density in the upper chamber of a six-well plate and the subsequent experiments were completed after five days of indirect co-culture.

[0046] Nasopharyngeal carcinoma cell lines C666 and TW03 were expressed with MCAM + After 5 days of indirect co-culture of mCAFs or MCAM-mCAFs, they were irradiated with 10Gy. Immunofluorescence was used to detect the expression of nuclear protein γH2AX after irradiation, and flow cytometry was used to detect tumor cell apoptosis. We found that there was no significant difference between the MCAM-mCAFs co-culture group and the PBS group, while the MCAM + mCAF can significantly reduce the γH2AX uptake rate in C666 and TW03 cells ( Figure 3In addition, we also found that indirect co-culture of NPC cells with MCAM+mCAFs could significantly attenuate the apoptosis of C666 and TW03 cells ( Figure 3 C), but the apoptosis level in the MCAM-mCAFs co-culture group did not change significantly. The results of flow cytometry and immunofluorescence detection showed that MCAM + mCAFs can reduce the apoptosis rate of tumor cells and promote the occurrence of radioresistance in nasopharyngeal carcinoma cells.

[0047] 2. In vivo experiments in animal models

[0048] Furthermore, in order to better explore MCAM + To investigate the in vivo effect of mCAFs on nasopharyngeal carcinoma cell radioresistance, we purchased female NCG mice (18-20 g, 3-8 weeks old, strain NO. T001475) from Guangdong GemPharmatech Co., Ltd. in China to conduct in vivo experiments on the NCG mouse model. The method is as follows: Guangdong Yaokang Co., Ltd. constructed a highly immunodeficient NCG mouse model by simultaneously knocking out the Prkdc gene (protein kinase, DNA activation, catalytic polypeptide) and I12rg (common gamma chain receptor) gene. The NCG mice were randomly divided into three groups: C666+MCAM + mCAFs group, C666+MCAM - CAFs group and C666+PBS group (n=6 in each group). C666 cells (1×10 6 ) and MCAM + mCAFs or MCAM - CAFs were mixed in a ratio of 3:1. The mixed cells were injected subcutaneously into the buttocks of mice to establish a tumor xenograft model. When the tumor was measurable, on the 6th to 7th day, all mice were locally irradiated under anesthesia with a dose of 2Gy, once a day, for 5 consecutive days. The tumor volume (V) and weight of each mouse were measured every 2 days, and the changes in tumor volume of the three groups of mice were observed and recorded. The calculation formula is V = (length × width 2) / 2. When the mouse tumor grew to a certain size, around the 28th day, the mouse was killed and the mouse tumor was removed to measure the volume and weigh it. In addition, the mouse tumor survival curve was drawn for each of the three groups according to the above treatment, and the volume of the mouse tumor reached 1600mm 3 Mice were considered to have reached the survival endpoint when the thrombus was ruptured or obvious ulcers appeared.

[0049] Consistent with the in vitro experimental results, this model verified that C666 interacts with MCAM + Co-culture of mCAFs but not MCAM - When co-cultured with mCAFs, the tumor's radiation resistance and sustained tumor growth were significantly enhanced, and the apoptosis of tumor cells and the tumor volume ( Figure 3D) and weight ( Figure 3 In vivo experiments also proved that MCAM + myCAF may be the main factor causing radioresistance of nasopharyngeal carcinoma.

[0050] The above results show that MCAM + Tumor-associated fibroblasts are significantly associated with radiotherapy resistance in nasopharyngeal carcinoma patients, and MCAM in tissue samples + Patients with a high proportion of tumor-associated fibroblasts develop radioresistance.

[0051] Example 4

[0052] Furthermore, the results of differential gene analysis of single-cell sequencing (sequencing was commissioned by Guangzhou Yuanxin Biotechnology Co., Ltd.) suggested that in MCAM + In tumor-associated fibroblasts, there were significant differences in secretory protein genes such as COL4A1, COL4A2, PDGFA, and IGFBP7 ( Figure 4 A and B), further WB and ELISA results also confirmed MCAM + myCAFs significantly increased the secretion of type IV collagen ( Figure 4 C and D), we hypothesized that type IV collagen plays a role in radioresistance of NPC cells and conducted validation.

[0053] Experimental method: We dissolved 5 mg of exogenous type IV human collagen (Cat. No 5022, Advanced BioMatrix, USA) in 5 ml of 0.25% pre-cooled glacial acetic acid and stirred overnight at 4°C. The dissolved type IV collagen was diluted to 20 μg / cm 2 The excess liquid was then aspirated and the type IV collagen coated plate was stored in a humidified environment at 4°C for subsequent experiments.

[0054] We found that after exogenous addition of type IV collagen, the radioresistance of nasopharyngeal carcinoma cells C666 and TW03 cells was significantly enhanced, and the number of tumor cell clones increased significantly ( Figure 4 Middle E), the number of apoptotic cells decreased significantly ( Figure 4 Middle F).

[0055] To further explore MCAM + To investigate whether myCAF functions through type IV collagen, we constructed a stable knockdown system of COL4A1 using shRNA specifically targeting the COL4A1 gene. +Fibroblast cell line. This example provides two shRNAs specifically targeting the COL4A1 gene, namely shRNA1 and shRNA2. The nucleotide sequence of shRNA1 is shown in SEQ ID NO.1; the nucleotide sequence of shRNA2 is shown in SEQ ID NO.2; and the NC sequence is shown in SEQ ID NO.3.

[0056] SEQ ID NO.1:GATCCAGGTGAGATACTTGGC;

[0057] SEQ ID NO.2: AATTGTTATAGGCACAGGACC;

[0058] SEQ ID NO. 3: TAATACGACTCACTATAGGG.

[0059] Construction of COL4A1 stable knockdown of MCAM + The method for the fibroblast cell line (sh-COL4A1) is as follows:

[0060] The COL4A1 knockdown lentiviral vector containing shRNA1 and shRNA2 used in this study was constructed by Guangzhou Yijin Biotechnology Co., Ltd. MCAM was transfected with COL4A1 knockdown lentivirus. + mCAFs. Nasopharyngeal carcinoma cells or primary fibroblasts were cultured at a rate of 1×10 5 The cells were seeded at a density of 100 μg / well in a 6-well plate and transfected using the calcium phosphate method with 50 μl of concentrated viral particle suspension. After 8 h, the transduction medium was replaced with fresh complete medium. After 48 h, the transduced cells were selected using purromycin (TRC, Canada). The transfected cells were verified by western blot. + mCAFs were transfected, sorted, and expanded. Western blot analysis verified the effectiveness of gene knockout.

[0061] Nasopharyngeal carcinoma cell lines C666 and TW03 were co-infected with sh-NC, two sh-COL4A1 (containing shRNA1 and shRNA2, respectively) and MCAM. - CAFs were co-cultured. After 48 hours of co-culture, the number of tumor cell clones was detected by plate cloning method, and the apoptosis of tumor cells was detected by flow cytometry.

[0062] The results showed that the number of tumor cell clones co-cultured with the two sh-COL4A1 cells was significantly reduced compared with NC ( Figure 4 Middle G), the number of apoptotic cells increased significantly ( Figure 4 Middle H), almost the same as MCAM -In addition, after knocking down COL4A1, MCAM + mCAFs significantly reduced the ability to promote radioresistance, further confirming that MCAM + mCAFs promote radioresistance through type IV collagen. + The production of type IV collagen by mCAFs can reverse the radioresistance of nasopharyngeal carcinoma cells and improve the therapeutic effect of radiotherapy.

[0063] To explore the key receptors of type IV collagen acting on tumor cells, we performed ligand receptor analysis. The results suggested that there were COL4A1 / 2-ITGA2_ITGB1 and COL4A1 / 2-ITGA3_ITGB1 interactions between fibroblasts and tumor cells ( Figure 5 A), spatial transcriptome results also suggest that compared with other fibroblasts, tumor cells have a strong affinity for MCAM + There is a stronger COL4A1 / 2-ITGA2_ITGB1 interaction between mCAFs ( Figure 5 Immunofluorescence results also showed that ITGA2 was significantly localized on the surface of tumor cells, while type IV collagen was localized around tumor cells ( Figure 5 Middle C).

[0064] In addition, by transfecting Flag-tagged COL4A1 plasmid and HA-tagged ITGA2 plasmid into 293T cells, immunoprecipitation results indicated that there was a significant interaction between COL4A1 and ITGA2 ( Figure 5 Middle D).

[0065] We further used shRNA specifically targeting the ITGA2 gene to construct a stable knockdown strain of ITGA2 in nasopharyngeal carcinoma cell lines (C666 and TW03) to explore the effect of knocking down the ITGA2 integrin receptor and exogenously adding type IV collagen for in vitro irradiation on the radiotherapy resistance of tumor cells. In this example, two shRNAs were designed to specifically knock down the ITGA2 gene: shRNA1 and shRNA2, and the NC sequence was used as a control. The nucleotide sequence of the shRNA1 is shown in SEQ ID NO.4, the nucleotide sequence of the shRNA2 is shown in SEQ ID NO.5, and the nucleotide sequence of the NC sequence is shown in SEQ ID NO.3.

[0066] SEQ ID NO.4:GCTGTGATTGATCAATGCAAC;

[0067] SEQ ID NO. 5: GCAGTTCTTGGGTACTTAAAC.

[0068] The construction method of ITGA2 stable knockdown TW03 cell line (sh-ITGA2) is similar to the construction method of sh-COL4A1 mentioned above.

[0069] Plate cloning experiment: Fibroblasts and tumor cells were indirectly co-cultured according to the method mentioned above. After 5 days of co-culture, nasopharyngeal carcinoma cells treated according to the specified conditions were seeded into 6-well plates, and TW03 cells were plated at a density of 1×10 4 / hole, C666 with a density of 1×10 5 Inoculate 100 cells / well. Irradiate cells at a dose of 10 Gy, and refresh the culture medium every 3 days. After 7-14 days of culture, wash the tumor cells with PBS, fix them with formaldehyde for 30 minutes at room temperature, stain them with 1% crystal violet for 10 minutes, and photograph and count them.

[0070] The results of plate cloning experiments showed that after knocking down ITGA2, after exogenous addition of IV collagen, the results of plate cloning and flow cytometry showed that the effect of collagen in promoting radiotherapy resistance was significantly reduced after knocking down ITGA2 ( Figure 5 (E and G) The results suggest that type IV collagen plays a role in nasopharyngeal carcinoma by binding to the integrin receptor ITGA2 on the surface of nasopharyngeal carcinoma cells, promoting the radioresistance of nasopharyngeal carcinoma cells.

[0071] Our single-cell sequencing results suggest that the PI3K-AKT pathway is also significantly activated in recurrent NPC compared with newly diagnosed patients ( Figure 5 Middle F, Figure 6 (A) Significant activation of this pathway was also detected in nasopharyngeal carcinoma radioresistant lines.

[0072] Furthermore, we found that when TW03 and C666 cells were treated with the AKT inhibitor MK2206 and irradiated in the presence of exogenous type IV collagen, both plate cloning and flow cytometry apoptosis results suggested that AKT inhibition accelerated the uptake of γ-H2AX by both cell lines ( Figure 6 In vivo experimental results also suggest that treating tumor cells with PI3K-AKT pathway pan-AKT inhibitor MK2206 can reverse the radioresistance induced by IV collagen ( Figure 6 Medium CG).

[0073] The above results show that MCAM + Tumor-associated fibroblasts secrete type IV collagen and bind to the ITGA2 integrin receptor on the surface of tumor cells, activating the downstream PI3K-AKT signaling pathway, thereby promoting cancer cell radiotherapy resistance. + Tumor-associated fibroblasts, inhibiting MCAM +Tumor-associated fibroblasts produce type IV collagen or block the binding of type IV collagen to the ITGA2 integrin receptor on the surface of tumor cells, and inhibit the downstream PI3K-AKT signaling pathway, which can effectively reverse the radiotherapy resistance of tumor cells and improve the efficacy of radiotherapy.

[0074] The technical features of the above-described embodiments can be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0075] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. ACTA2 + MCAM + Application of cells as biomarkers in the assessment of recurrence, radiotherapy efficacy, and / or prognosis of patients with nasopharyngeal carcinoma.

2. Detection of ACTA2 + MCAM + Use of a cell ratio reagent in preparing a product for evaluating recurrence, and / or radiotherapy efficacy, and / or prognosis of nasopharyngeal carcinoma patients.

3. The use according to claim 2, characterized in that The reagents include reagents for flow cytometry detection and immunofluorescence detection.

4. The use according to claim 2 or 3, characterized in that The product is a test kit.

5. A kit for evaluating recurrence, radiotherapy efficacy and prognosis of nasopharyngeal carcinoma patients, characterized in that: The kit contains a detection kit for ACTA2 + MCAM + Reagents for cell ratios.

6. The kit according to claim 5, wherein The reagents include reagents for flow cytometry detection and immunofluorescence detection.

7. Clearing ACTA2 + MCAM + Cell-derived agents, and / or inhibitors of ACTA2 + MCAM + Use of reagents for cell production of type IV collagen and / or PI3K-AKT pathway inhibitors in the preparation of radiosensitizers for nasopharyngeal carcinoma patients.

8. The use according to claim 7, characterized in that The reagent comprises at least one of an MCAM-specific binding antibody, an agent for inhibiting COL4A1 gene expression, an agent for inhibiting COL4A2 gene expression, and MK2206.

9. A radiosensitizer for nasopharyngeal carcinoma patients, characterized in that: The main active ingredients of the radiosensitizer include scavenging ACTA2 + MCAM + Cell-based reagents, inhibiting ACTA2 + MCAM + At least one of an agent that induces cells to produce type IV collagen and a PI3K-AKT pathway inhibitor.

10. The radiosensitizer according to claim 9, characterized in that The reagent comprises at least one of an MCAM-specific binding antibody, an agent for inhibiting COL4A1 gene expression, an agent for inhibiting COL4A2 gene expression, and MK2206.

Citation Information

Patent Citations

  • Serine threonine kinase (AKT) degradation / disruption compounds and methods of use

    CN112154146A

  • Marker group for predicting nasopharyngeal carcinoma immunotherapy effect and application thereof

    CN112280862A

  • Cancer vaccine

    CN115003322A

  • Biomarker for evaluating nasopharyngeal carcinoma prognosis and application thereof

    CN117192123A

  • Hypermethylation Biomarkers for Detection of Head and Neck Squamous Cell Cancer

    US20130071842A1