Porcine circovirus type 3 Cap recombinant protein gene, recombinant rod grain, protective antigen and purification method

Abstract

The invention provides a porcine circovirus type 3 Cap recombinant protein gene, a recombinant rod grain, a protective antigen and a purification method, and belongs to the technical field of biology. The invention utilizes an insect baculovirus eukaryotic expression system to prepare the porcine circovirus type 3 Cap protein protective antigen, and provides a chromatographic purification process of the porcine circovirus type 3 Cap protein protective antigen, which adopts a one-step column chromatography purification method and adopts splitting, filtering and composite affinity chromatography processes to obtain the porcine circovirus type 3 Cap protein protective antigen. According to the method, the porcine circovirus type 3 Cap protein protective antigen is specifically purified from the complex cell lysis solution rapidly and efficiently, the recovery rate in the purification process is high, the purity reaches 90% or above, the treatment capacity is large, the assembly rate of the purified product is high, and the method is simple and suitable for large-scale production.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a porcine circovirus type 3 Cap recombinant protein gene, a recombinant bacmid, a protective antigen and a purification method. Background Art

[0002] Porcine circovirus disease (PCVD) is a multisystemic disease caused by circoviruses (PCVs). It can include post-weaning multisystemic wasting syndrome, porcine dermatitis and nephropathy syndrome, proliferative necrotizing pneumonia, and reproductive disorders. Circoviruses, members of the genus Circovirus in the family Circoviridae, are non-enveloped, single-stranded, positive-sense circular DNA viruses and are among the smallest known viruses capable of infecting mammals. To date, four circovirus species have been discovered and characterized: PCV1, PCV2, PCV3, and PCV4. PCV1 was identified as a contaminant in a porcine kidney cell line (PK15) cultured in vitro and is non-pathogenic to pigs. PCV2 was isolated and identified in 1998 from pigs with progressive wasting disease and has subsequently been confirmed as the primary pathogen of PCVD. PCV4 was reported by a veterinary team at Hunan University in 2019, but its pathogenicity has not been widely reported. Porcine circovirus type 3 (PCV3) is a newly discovered virus. It was first detected in 2015 by Palinski et al. from Kansas State University in North Carolina, USA, using metagenomic sequencing in tissues from affected sows, aborted fetuses, porcine dermatitis and nephrotic syndrome, and pigs with heart and multisystem inflammatory diseases. PCV3 often co-infects with pathogens such as PCV2, PRRSV, and MHP, causing secondary infections with Haemophilus parasuis, Actinobacillus pleuropneumoniae, and Streptococcus suis, leading to sudden mortality. PCV3 is currently becoming prevalent both domestically and internationally, causing significant economic losses to the swine industry.

[0003] The PCV3 virion is icosahedral, non-enveloped, and 13-25 nm in diameter. It has a covalently closed circular single-stranded DNA genome structure, approximately 2000 base pairs in length, consisting primarily of three open reading frames (ORFs): ORF1, ORF2, and ORF3. ORF1 is the most conserved region, encoding the Rep protein, which is involved in viral replication. ORF2 is the most variable region, encoding the sole structural protein (Cap protein), which is strongly associated with viral infection and immunity. The Cap protein is the primary protective epitope of PCV3 and is an ideal target antigen for PCV3 vaccine development. ORF3, located opposite ORF1, encodes a nonstructural protein, but the function of the protein encoded by ORF3 is currently unknown.

[0004] Currently, PCV2-Cap protein subunit vaccines are widely used in clinical practice and are effective in preventing porcine circovirus type 2 infection. However, due to differences in the genetic structure of PCV3 and PCV2, the amino acid sequence of the Cap protein encoded by the ORF2 gene shares only approximately 30%, resulting in the commercial PCV2-Cap protein vaccine being unable to provide effective cross-protection against PCV3 infection. Furthermore, due to the difficulty of isolating PCV3 virus and the inability to continuously passage it, domestic research on PCV3 vaccines has primarily focused on genetically engineered subunit vaccines. The insect baculovirus eukaryotic expression system, favored by many researchers due to its ability to perform post-translational modifications and large-scale suspension culture, is favored by many researchers. However, expression of the PCV3-Cap protein using insect baculovirus presents two major challenges: low expression yield and difficulty in purification. Preparation of the PCV3-Cap protein using serum-free insect cell suspension culture is hindered by the presence of allergens such as culture medium components and host proteins in the culture medium, and the differences in physical properties between the PCV3-Cap protein and the PCV2-Cap protein make it impossible to adopt the same purification methods used for the PCV2-Cap protein. Therefore, the purification process becomes a critical factor in the preparation of the PCV3-Cap protein subunit vaccine. Summary of the Invention

[0005] The present invention aims to provide a porcine circovirus type 3 Cap recombinant protein gene, a recombinant bacmid, a protective antigen and a purification method, which are simple to operate, have high product purity and are easy to scale up for production.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a porcine circovirus type 3 Cap recombinant protein encoding gene, which is obtained by codon optimization of a PCV3-Cap protein expression gene, and the sequence of the gene is shown in SEQ ID NO.1.

[0007] The present invention also provides a method for preparing a recombinant bacmid of porcine circovirus type 3 Cap protein, comprising the following steps: (1) The sequence shown in SEQ ID NO.1 was inserted into the pH promoter of the pFastbac dual vector, and 6*His was added to the N-terminus to obtain a recombinant plasmid; (2) Transpose the recombinant plasmid into DH10Bac™ competent cells and screen for positive clones; (3) The positive clones were lysed to obtain the recombinant bacmid of porcine circovirus type 3 Cap protein.

[0008] The present invention also provides a method for preparing a porcine circovirus type 3 Cap protein recombinant bacmid, and the method comprises preparing the porcine circovirus type 3 Cap protein recombinant bacmid.

[0009] The present invention also provides a porcine circovirus type 3 Cap protein protective antigen, which is obtained by expressing the porcine circovirus type 3 Cap protein recombinant bacmid, and the amino acid sequence of the porcine circovirus type 3 Cap protein protective antigen is shown in SEQ ID NO.2.

[0010] The present invention also provides a method for purifying a porcine circovirus type 3 Cap protein protective antigen, comprising the following steps: (1) Transfect the porcine circovirus type 3 Cap protein recombinant bacmid into sf9 cells, culture them, and collect the PCV3-Cap recombinant baculovirus cells; (2) Add lysis buffer to PCV3-Cap recombinant baculovirus cells for lysis, centrifuge to obtain supernatant, and filter to obtain clarified solution; (3) The protective antigen of porcine circovirus type 3 Cap protein was obtained by column equilibration, sample loading, washing and elution of the clarified liquid using a composite affinity chromatography filler.

[0011] Preferably, in step (2), the lysis solution is Triton X-100, the addition amount is 0.1-1%, and the lysis conditions are 35-38°C and 0.5-1h.

[0012] Preferably, in step (2), the centrifugation condition is 8000-10000 rpm, 20-40 min; and the pore size of the filter is 0.45-0.8 µm.

[0013] Preferably, in step (3), the composite affinity chromatography filler is a composite cross-linked agarose microsphere affinity filler with extremely strong rigidity.

[0014] Preferably, in step (3), the elution solution comprises 50 mM PB-CA, 120 mM NaCl, pH 7.0, and the loading volume of the clarified solution is 1-15 column volumes.

[0015] The beneficial effects of the present invention compared with the prior art are: (1) The present invention utilizes an insect baculovirus eukaryotic expression system to prepare a porcine circovirus type 3 Cap protein protective antigen, and provides a chromatography purification process for the porcine circovirus type 3 Cap protein protective antigen. The one-step column chromatography purification method is used to rapidly and efficiently purify the porcine circovirus type 3 Cap protein protective antigen from a complex cell lysate through lysis, filtration, and composite affinity chromatography processes. The purification process has a high recovery rate, a purity of more than 90%, a large processing volume, a high assembly rate of the purified product, and a simple method suitable for large-scale production.

[0016] (2) The present invention uses the detergent TritonX-100 to lyse cells during the chromatography purification of the protective antigen of porcine circovirus type 3 Cap protein, which can release the Cap protein simply and efficiently. A composite affinity filler is used during purification, and the one-step column chromatography process is simple to operate and easy to scale up. The obtained antigen is in elution mode, with high purity and high protein content. The antigen processing volume is 5-15 column volumes, and the purification efficiency is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 The results of three rounds of blue-white screening of the PCV3-Cap recombinant bacmid in Example 1 of the present invention are shown; Figure 2 This is a diagram showing the cytopathic effect of recombinant baculovirus formed by transfecting sf9 cells with PCV3-Cap recombinant bacmid in Example 1 of the present invention; Figure 3 This is an SDS-PAGE image of the PCV3-Cap protein expressed in H5 cells in Example 1 of the present invention; Figure 4 The SDS-PAGE results of the PCV3-Cap protein purified by composite affinity chromatography in Example 2 of the present invention, wherein M: 15-245 kd protein marker, 1: loading, 2: flow-through, 3: wash, and 4: elution; Figure 5 This is a Western blot analysis of the PCV3-Cap protein purified by composite affinity chromatography in Example 2 of the present invention; M: 15-245 kd protein marker, 1: purified PCV3-Cap protein; Figure 6 4 is a graph showing the purity of the purified PCV3-Cap solution obtained in Example 3 of the present invention by high performance liquid chromatography; Figure 7 This is a specific indirect immunofluorescence identification image of the PCV3-Cap purified solution in Example 3 of the present invention; Figure 8 This is an electron micrograph of virus-like particles formed by self-assembly of the purified PCV3-Cap protein in Example 3 of the present invention. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The gene encoding the porcine circovirus type 3 Cap protein protective antigen (SEQ ID NO.1): ATGAGACACAGAGCTATCTTCAGACGCAGACCAAGACCAAGACGCAGACGCAGACACAGACGCAGATACGCTAGACGCAGACTGTTCATCAGAAGACCAACTGCTGGTACTTACTACACTAAGAAGTACTCCACTATGAACGTGATCTCCGTGGGTACTCCACAAGACAACAAGCCATGGCACGCTAACCACTTCATCACTAGACTGAACGAGTGGGAGACTGCTATCTCCTTCGAGTACTACAAGATCCTGAAGATGAAGGTGACTCTGTCCCCTGTGATCTCCCCTGCTCAGCAGACTAAGACTATGTTCGGTCACACTGCTATCGACCTGGACGGTGCTTGGACTACTAACACTTGGCTGCAAGACGACCCATACGCTGAGTCCTCCACTAGAAAGGTGATGACTTCCAAGAAAAAGCACTCCCGCTACTTCACTCCAAAGCCAATCCTGGCTGGTACTACTTCCGCTCACCCTGGTCAGTCCCTGTTCTTTTTCTCCCGCCCAACTCCATGGCTGAACACTTACGACCCAACTGTGCAGTGGGGTGCTCTGCTGTGGTCCATCTACGTGCCTGAGAAGACTGGTATGACTGACTTCTACGGTACTAAAGAGGTGTGGATCAGATACAAGTCCGTGCTGGGATCGGGTGGCCACCACCATCATCACCATTGA; Amino acid sequence of the protective antigen of porcine circovirus type 3 Cap protein (SEQ ID NO.2): MRHRAIFRRRPRPRRRRRHRRRYARRRLFIRRPTAGTYYTKKYSTMNVISVGTPQDNKPWHANHFITRLNEWETAISFEYYKILKMKVTLSPVISPAQQTKTMFGHTAIDLDGAWTTNTWLQDDPYAESSTRKVMTSKKKHSRYFTPKPILAGTTSAHPGQSLFFFSRPTPWLNTYDPTVQWGALLWSIYVPEKTGMTDFYGTKEVWIRYKSVLGSGGHHHHHH*。

[0025] Example 1 Example 1 of the present invention provides a method for constructing a porcine circovirus type 3 Cap protein insect baculovirus expression vector, the specific steps of which are as follows: 1. Optimization and synthesis of the PCV3-Cap protein target gene The PCV3-Cap protein expression gene was codon-optimized in the Spodoptera frugiperda (sf9 / sf21) host to obtain the gene sequence shown in SEQ ID NO. 1. This gene was inserted into the pH promoter of the pFastbac dual vector, and a 6*His residue was added to the N-terminus. The plasmid DNA was synthesized by GenScript.

[0026] 2. Preparation of PCV3-Cap Recombinant Bacmid (1) Transposition Thaw a tube of DH10Bac™ competent cells on ice. Add 1 ng of plasmid DNA to the cells and gently flick to mix. Incubate the cells on ice for 30 minutes. Then, heat shock the cells at 42°C for 90 seconds without shaking. Immediately transfer the tube to ice and chill for 2 minutes. Finally, add 900 µL of room-temperature LB medium. Incubate the tube at 37°C with shaking at 220 rpm for 4 hours. Centrifuge at 5000 rpm, discard the supernatant, resuspend the suspension in 1 mL of LB medium, and apply 100 µL of the stock solution to a plate containing three antibodies. Incubate the plate at 37°C for 24-48 hours.

[0027] (2) Blue-white spot screening Pick up the large and round white colonies near the blue spots on the plate, streak them on a new screening plate, and culture them at 37℃ in the dark for 24-48 hours. If all the colonies on the plate are white, pick the white colonies and inoculate them into liquid LB medium containing three resistances and shake and culture them overnight. If there are still blue colonies, they need to be purified again. After three times of blue-white purification, the positive clones are purified, such as Figure 1 shown.

[0028] (3) Extraction of recombinant bacmid (Biyuntian: Baculovirus shuttle vector bacmid small-scale extraction kit) 1) Inoculate the positive clone into 3 mL of SOC medium (containing 7 μg / mL gentamicin, 100 μg / mL kanamycin, and 10 μg / mL tetracycline) and culture overnight at 37°C and 200 rpm.

[0029] 2) Collect 1.5 mL of overnight cultured bacteria by centrifugation at 10,000 g for 1 minute. Discard the supernatant. Add another 1.5 mL of overnight cultured bacteria and centrifuge again as before, collecting a total of 3 mL of overnight cultured bacteria per tube.

[0030] 3) Add 300 μL of Solution I (with RNase A) to resuspend the bacterial pellet. Ensure that the pellet is completely dispersed and no bacterial clumps are visible.

[0031] 4) Add 300 μL of Solution II and gently invert the tube 4-6 times to completely lyse the bacteria and make the solution transparent. If the solution is still not completely transparent, increase the inversion frequency by 3-5 times. Incubate the tube at room temperature for another 2-3 minutes. The total lysis time should not exceed 5 minutes.

[0032] 5) Add 300 μL of Solution III and immediately invert the tube 4-6 times to mix thoroughly. A white flocculent mass will be visible. Centrifuge at >12,000 g for 10 minutes and transfer the supernatant to a clean 2 mL centrifuge tube. If a small amount of insoluble material remains in the supernatant, centrifuge at >12,000 g for 5-10 minutes and remove the supernatant. Ensure that the supernatant is clear and free of insoluble material.

[0033] 6) Slowly add 800 μL of pre-chilled isopropanol to the supernatant, mix thoroughly by inversion, place on ice for 10 minutes, centrifuge at >12,000 g for 10 minutes, and discard the supernatant.

[0034] 7) Resuspend the pellet in 500 μL of pre-chilled 70% ethanol, centrifuge at >15,000 g for 5 minutes, and discard the supernatant.

[0035] 8) Resuspend the pellet in 200 μL of pre-chilled 70% ethanol, centrifuge at >12,000 g for 5 minutes, and discard the supernatant.

[0036] 9) Allow the precipitate to dry at room temperature. After the ethanol evaporates, dissolve it in 20 μL of TE to obtain the porcine circovirus type 3 Cap protein recombinant bacmid (PCV3-Cap recombinant bacmid), which is then stored at -20°C.

[0037] (4) Preparation of PCV3-Cap recombinant baculovirus 1) Sf9 cells in logarithmic growth phase were plated in 6-well plates, with 0.8×10 cells per well. 6 Cells were plated in 6 wells and incubated at room temperature for 1-2 hours.

[0038] 2) Replace the culture medium in the 6-well plate with 2% FBS-free SFM-900 II SFM medium.

[0039] 3) Dilute 10 μL of Lipofectamine 3000 to 100 μL with antibody-free and serum-free incomplete Grace medium and gently flick to mix.

[0040] 4) Dilute 5 μg of recombinant bacmid to 100 μL with antibody-free and serum-free incomplete Grace medium and gently flick to mix.

[0041] 5) Mix the diluted bacmid and transfection reagent (Invitrogen™ Cellfectin® II Reagent) evenly, add the diluted bacmid to a 6-well plate, and incubate at room temperature for 15-20 minutes. Gently tap the plate to mix thoroughly. A blank cell culture plate serves as a negative control.

[0042] 6) 4-6 hours after transfection, replace the medium with Grace's complete medium containing 10% FBS.

[0043] 7) The transfected sf9 cells were cultured in the dark at 27°C for 5-7 days. After observing the cytopathic effect, the cell suspension was collected and recorded as the P0 seed stock. The recombinant baculovirus cells became round and the diameter increased, as shown in Figure 2. Figure 2 shown.

[0044] (5) SDS-PAGE identification of protective antigens of porcine circovirus type 3 Cap protein 1) Inoculate 125 mL of Sf9 insect cells cultured in a shake flask at a density of 2 × 10 cells per 125 mL of venom solution at a dilution of 1:100. 6 / mL, and were harvested after culturing at 27℃ for 96h and recorded as P1 generation.

[0045] (2) The P1 seed virus was inoculated into H5 cells in a shake flask at a dilution of 1:1000 and cultured at 27°C and 110 rpm until the cell viability was about 20-30%. The antigen was harvested and identified by SDS-PAGE. The protective antigen of porcine circovirus type 3 Cap protein (PCV3-Cap protein) was expressed in a soluble form. Figure 3 .

[0046] Example 2 Example 2 of the present invention provides a method for purifying a porcine circovirus type 3 Cap protein protective antigen, the specific steps of which are as follows: 1. Clarification of Porcine Circovirus Type 3 Cap Protein Protective Antigen (1) Take the culture medium of the Sf9 insect cells after inoculation at generation P1 in step (5) of Example (1) (the culture medium of the PCV3-Cap recombinant baculovirus cells) and add 0.5% (V / V) Triton X-100. Stir and lyse at 37°C and 50 rpm for 1 h.

[0047] (2) The lysate was centrifuged at 8000 rpm for 30 min and the supernatant was harvested.

[0048] (3) The supernatant of porcine circovirus type 3 Cap protein protective antigen is filtered through a 0.65 μm filter element, and the filtrate is harvested to obtain a clarified solution (clarified porcine circovirus type 3 Cap protein protective antigen solution).

[0049] 2. Purification of Porcine Circovirus Type 3 Cap Protein Protective Antigen by Complex Affinity Chromatography (1) Equilibration: Equilibrate the column with 3-5 CV of equilibration buffer (10 mM PB, pH 7.2) until the pH, conductivity, and UV baselines are stable and the UV is cleared.

[0050] (2) Loading: Load 5CV of clarified porcine circovirus type 3 Cap protein protective antigen solution.

[0051] (3) Washing: Rinse the column with 3CV of washing buffer (10mM PB, 0.5M NaCl, pH 7.2) to remove unbound substances.

[0052] (4) Elution: Wash the column with 3CV of elution buffer (50mM PB-CA, 120mM NaCl, pH 7.0) and collect the elution peak, which is the purified porcine circovirus type 3 Cap protein protective antigen.

[0053] The eluted peak samples were subjected to SDS-PAGE identification ( Figure 4 ), no target protein was detected in the flow-through and wash solution, and the target protein content in the elution solution was high and pure. The results of immunoblotting showed that the purified porcine circovirus type 3 Cap protein protective antigen had good binding activity with PCV3 positive infection serum ( Figure 5 ).

[0054] Example 3 Example 3 of the present invention provides a method for purifying a porcine circovirus type 3 Cap protein protective antigen, the specific steps of which are as follows: 1. Clarification of Porcine Circovirus Type 3 Cap Protein Protective Antigen (1) Take the PCV3-Cap recombinant baculovirus cell culture medium, add 0.5% (V / V) Triton X-100, and stir at 37°C and 50 rpm for 1 hour.

[0055] (2) The lysate was centrifuged at 8000 rpm for 30 min and the supernatant was harvested.

[0056] (3) The supernatant of porcine circovirus type 3 Cap protein protective antigen is filtered through a 0.8 μm filter element, and the filtrate is harvested to obtain the clarified liquid.

[0057] 2. Purification of Porcine Circovirus Type 3 Cap Protein Protective Antigen by Complex Affinity Chromatography (1) Equilibration: Equilibrate the column with 3-5 CV of equilibration buffer until the pH, conductivity, and UV baselines are stable and the UV is cleared.

[0058] (2) Sample loading: Load 10CV of clarified porcine circovirus type 3 Cap protein protective antigen solution.

[0059] (3) Washing: Rinse the column with 3CV of washing buffer to remove unbound substances.

[0060] (4) Elution: Wash the column with 3CV of elution buffer and collect the elution peak, which is the purified porcine circovirus type 3 Cap protein protective antigen.

[0061] The elution peak samples were analyzed by high performance liquid chromatography, and the purity of the target protein was 94% ( Figure 6 ); Indirect immunofluorescence results showed that the purified porcine circovirus type 3 Cap protein had good protective antigen specificity ( Figure 7 ); Transmission electron microscopy showed that the purified PCV3-Cap could be well assembled into virus-like particles ( Figure 8 ).

[0062] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A gene encoding porcine circovirus type 3 Cap recombinant protein, characterized in that: The gene is obtained by codon optimization of the PCV3-Cap protein expression gene, and the sequence of the gene is shown in SEQ ID NO.

1.

2. A method for preparing a porcine circovirus type 3 Cap protein recombinant bacmid, characterized in that: The steps include: (1) The sequence shown in SEQ ID NO.1 was inserted into the pH promoter of the pFastbac dual vector, and 6*His was added to the N-terminus to obtain a recombinant plasmid; (2) Transpose the recombinant plasmid into DH10Bac™ competent cells and screen for positive clones; (3) The positive clones were lysed to obtain the recombinant bacmid of porcine circovirus type 3 Cap protein.

3. A porcine circovirus type 3 Cap protein recombinant bacmid prepared according to the method for preparing a porcine circovirus type 3 Cap protein recombinant bacmid according to claim 2.

4. A porcine circovirus type 3 Cap protein protective antigen, characterized in that: The porcine circovirus type 3 Cap protein protective antigen is obtained by expressing the porcine circovirus type 3 Cap protein recombinant bacmid according to claim 3, and the amino acid sequence of the porcine circovirus type 3 Cap protein protective antigen is shown in SEQ ID NO.

2.

5. A method for purifying the protective antigen of porcine circovirus type 3 Cap protein according to claim 4, characterized in that: The steps include: (1) Transfect the porcine circovirus type 3 Cap protein recombinant bacmid into sf9 cells, culture them, and collect the PCV3-Cap recombinant baculovirus cells; (2) Add lysis buffer to PCV3-Cap recombinant baculovirus cells for lysis, centrifuge to obtain supernatant, and filter to obtain clarified solution; (3) The protective antigen of porcine circovirus type 3 Cap protein was obtained by column equilibration, sample loading, washing and elution of the clarified liquid using a composite affinity chromatography filler.

6. The method for purifying the porcine circovirus type 3 Cap protein protective antigen according to claim 5, characterized in that: In step (2), the lysis solution is TritonX-100, the addition amount is 0.1-1%, and the lysis conditions are 35-38°C and 0.5-1h.

7. The method for purifying the protective antigen of porcine circovirus type 3 Cap protein according to claim 5, characterized in that: In step (2), the centrifugation condition is 8000-10000 rpm, 20-40 min; the pore size of the filter is 0.45-0.8 µm.

8. The method for purifying the protective antigen of porcine circovirus type 3 Cap protein according to claim 5, characterized in that: In step (3), the composite affinity chromatography filler is a composite cross-linked agarose microsphere affinity filler with extremely strong rigidity.

9. The method for purifying the protective antigen of porcine circovirus type 3 Cap protein according to claim 5, characterized in that: In step (3), the elution solution includes 50 mM PB-CA, 120 mM NaCl, pH 7.0, and the loading volume of the clear solution is 1-15 column volumes.

Images