Exosome for targeted repair of pro-inflammatory microglia as well as preparation method and application of exosome

Abstract

The invention belongs to the technical field of exosomes, and particularly relates to an exosome for targeted repair of pro-inflammatory microglial cells as well as a preparation method and application of the exosome. The method comprises the following steps: constructing a recombinant lentiviral vector containing a Gas6 gene; the method comprises the following steps: overexpressing a Gas6 gene by a stem cell through lentivirus transfection, collecting a cell supernatant, and collecting an exosome from the cell supernatant through an ultracentrifugation method, and the exosome carries a Gas6 protein. The exosome provided by the invention is combined with a receptor through Gas6, the polarization state of microglial cells is relieved, a pro-inflammatory mode is converted into an anti-inflammatory mode, and meanwhile, phagocytosis and anti-inflammatory functions of the microglial cells are recovered, so that A beta deposition is reduced, neuroinflammation is relieved, and cognitive impairment is recovered.

Description

Technical Field

[0001] The present invention belongs to the technical field of exosomes, and specifically relates to an exosome that targets and repairs pro-inflammatory microglial cells, and a preparation method and application thereof. Background Art

[0002] The occurrence and progression of AD are closely related to the gradual accumulation of Aβ plaques and neurofibrillary tangles of hyperphosphorylated tau protein. The main efforts in the development of Alzheimer's disease drugs are focused on reducing extracellular Aβ and tau protein through vaccines or monoclonal antibody-mediated immunotherapy. In fact, aducanumab, a monoclonal antibody targeting Aβ oligomers and fibrils, has been shown to significantly reduce the burden of Aβ in the brains of AD patients and became the first antibody therapy for AD approved by the US Food and Drug Administration. However, there are also studies showing that antibody treatment can trigger Fc receptor (FcR)-mediated proinflammatory responses and nonspecific immune cell activation.

[0003] In recent clinical trials, up to 40% of AD patients treated with high-dose (10 mg kg-1) aducanumab exhibited amyloid-associated imaging abnormalities (ARIA), accompanied by cerebral edema and hemorrhage, limiting the dose that can be administered without toxicity. Furthermore, proinflammatory mediators released by glial cells have been shown to increase neuronal cell death and synaptic elimination in the brain parenchyma, potentially exacerbating cognitive decline. While prior art attempts have been made to reduce FCR-mediated inflammation using point mutations or antibodies of different isotypes (IgG2 and IgG4), these trials have been largely unsuccessful because the reduction in inflammatory side effects has been accompanied by a decrease in Aβ clearance.

[0004] Therefore, the challenge for future Alzheimer's disease treatment is to develop a therapeutic approach that can robustly eliminate Aβ without inducing the pro-inflammatory side effects associated with conventional antibodies. Efferocytosis refers to the process by which phagocytes clear dying cells and is initiated when phagocyte receptors recognize an "Eat-me" signal, such as phosphatidylserine (PtdSer) exposed on the surface of apoptotic cells. Among many phagocytic receptors, the TAM (TYRO3, AXL, and MERTK) family of receptor tyrosine kinases requires the soluble mediator Gas6 or Protein S (pro1) to bridge the interaction between PtdSer and TAM receptors. The PtdSer-Gas6-TAM receptor interaction has been shown to be critical for the sustained elimination of apoptotic cells and debris generated daily from various tissues. Importantly, in contrast to FcR activation, Gas6-mediated TAM receptor activation induces anti-inflammatory signaling, which is critical for maintaining tissue homeostasis.

[0005] Exosomes, as an emerging therapy, have demonstrated remarkable therapeutic effects in the treatment of neurological diseases, offering new hope for traditionally incurable diseases. Current therapies focus on clearing Aβ, but during the onset of AD, microglia are already functionally impaired and unable to clear Aβ. Forcing damaged microglia to phagocytose Aβ can lead to cell apoptosis, exacerbating the disease process.

[0006] Targeting exosomes can also be achieved by physically or chemically attaching functional peptides to them, but this can damage the exosomes to a certain extent, affecting their function or stability. Therefore, constructing stem cells with targeted functions and overexpressing targeted proteins on the stem cell membrane can largely solve this problem. Summary of the Invention

[0007] In response to the problems existing in the prior art, the present invention provides exosomes that are targeted to repair pro-inflammatory microglial cells, as well as a preparation method and application thereof.

[0008] The present invention is achieved through the following technical solutions:

[0009] A method for preparing exosomes that target and repair pro-inflammatory microglia, the method comprising:

[0010] Construction of a recombinant lentiviral vector containing the Gas6 gene;

[0011] The Gas6 gene is overexpressed in stem cells by lentiviral transfection, the cell supernatant is collected, and exosomes are collected from the cell supernatant by ultracentrifugation, wherein the exosomes carry the Gas6 protein.

[0012] Furthermore, the lentiviral transfection method includes:

[0013] The Gas6 gene, 3xFLAG sequence, linker sequence and transmembrane peptide sequence were constructed into a lentiviral vector to obtain a recombinant lentiviral vector;

[0014] The recombinant lentiviral vector is used to transfect stem cells, and stem cells capable of overexpressing the Gas6 gene are screened and obtained.

[0015] Furthermore, the obtained recombinant lentiviral vector is pSLenti-EF1a-Gas6-3xFLAG-linker-PDGFR-PGK-Puro-WPRE.

[0016] Furthermore, during the transfection process, the titer of the lentivirus used was 2.0-3.0 TU / ml;

[0017] The stem cells are neural stem cells or mesenchymal stem cells.

[0018] Furthermore, the method further comprises collecting stem cells that overexpress the Gas6 gene, and collecting cell membrane fragments carrying the Gas6 protein by ultrasonic disruption and centrifugation.

[0019] An exosome targeted for repairing pro-inflammatory microglial cells, wherein the exosome is prepared using the preparation method, and the stem cell exosome carries Gas6 protein.

[0020] A use of exosomes for targeted repair of pro-inflammatory microglia, wherein the exosomes are used in the preparation of drugs for preventing or treating Alzheimer's disease, Parkinson's disease, ischemic stroke, neuritis, peripheral neuropathy and central nervous system infectious diseases.

[0021] Furthermore, the exosomes are loaded into a thermosensitive hydrogel, and the exosome-loaded thermosensitive hydrogel is sprayed into the nasal cavity. The exosomes enter the brain through nasal delivery. Under the action of Gas6 protein, the exosomes combine with microglia, restoring the phagocytic function and anti-inflammatory activity of microglia, thereby reducing Aβ aggregation and neuroinflammation.

[0022] Furthermore, the preparation method of the thermosensitive hydrogel is as follows: F127, ginsenoside Rg3 and hydrogel are mixed, and the mixture is shaken at 4-18° C. for 0.5-1 h to prepare an antioxidant thermosensitive hydrogel;

[0023] In the thermosensitive hydrogel, the concentration of F127 is 200-300 mg / mL, and the concentration of ginsenoside Rg3 is 1-50 mg / mL.

[0024] During application, the amount of exosomes added to each milliliter of thermosensitive hydrogel is 0.5-5 mg.

[0025] Beneficial technical effects of the present invention:

[0026] The present invention constructs a stem cell that stably expresses Gas6 and obtains exosomes carrying Gas6 protein on the surface. In the exosomes, the Gas6 protein is connected to the surface of the exosomes through a transmembrane peptide;

[0027] The exosomes provided by the present invention bind to Gas6 and receptors, thereby reducing the polarization state of microglia, switching from a pro-inflammatory to an anti-inflammatory mode, while restoring the phagocytic and anti-inflammatory functions of microglia, thereby reducing Aβ deposition, alleviating neuroinflammation and restoring cognitive dysfunction.

[0028] The thermosensitive hydrogel provided by the present invention can prolong the release time of Gas6-exo (exosomes carrying Gas6 protein) in the nasal cavity and enhance the effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1This is a map of the recombinant lentiviral vector in the embodiment of the present invention;

[0030] Figure 2 The Western blot results in the examples of the present invention are shown below:

[0031] Figure 3 This is an electron micrograph of exosomes in an embodiment of the present invention;

[0032] Figure 4 is the particle size of exosomes in the embodiment of the present invention;

[0033] Figure 5 This is the analysis of exosome membrane potential in the embodiment of the present invention;

[0034] Figure 6 This is the hydrogel morphology observed by electron microscopy in the embodiment of the present invention;

[0035] Figure 7 This is a test of the temperature-sensitive properties of the hydrogel in the embodiment of the present invention;

[0036] Figure 8 This is a test of the adhesion properties of the hydrogel in the embodiment of the present invention;

[0037] Figure 9 For the flow cytometry detection of BV2 exo uptake level in the embodiment of the present invention;

[0038] Figure 10 The positive rate of exo uptake by BV2 detected by flow cytometry in the embodiment of the present invention;

[0039] Figure 11 This is the flow cytometry test for the level of Aβ uptake by BV2 in the embodiment of the present invention;

[0040] Figure 12 This is the positive rate of Aβ uptake by BV2 detected by flow cytometry in the embodiment of the present invention;

[0041] Figure 13 The ELISA method for detecting NGF levels in HT22 cells was used in the present invention;

[0042] Figure 14 ELISA was used to detect BDNF levels in HT22 cells in the present invention;

[0043] Figure 15 It is the TNF-α content in the cell supernatant in the examples of the present invention.

[0044] Figure 16 It is the IL-10 content in the cell supernatant in the examples of the present invention.

[0045] Figure 17 This is the fluorescence intensity detection in the mouse brain in the embodiment of the present invention;

[0046] Figure 18 is the number of times the mouse crosses the platform within 1 minute in the embodiment of the present invention;

[0047] Figure 19 is the NGF content in brain tissue in the embodiment of the present invention;

[0048] Figure 20 is the BDNF content in brain tissue in the embodiment of the present invention;

[0049] Figure 21 It is the IL-10 content of brain tissue in the examples of the present invention.

[0050] Figure 22 It is the TNF-α content of brain tissue in the examples of the present invention. DETAILED DESCRIPTION

[0051] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0052] On the contrary, the present invention covers any alternatives, modifications, equivalents, and solutions that fall within the spirit and scope of the present invention as defined by the claims. Furthermore, to facilitate a better understanding of the present invention, certain specific details are described in detail below in the detailed description of the present invention. Those skilled in the art will be able to fully understand the present invention without these details.

[0053] Example 1: A method for preparing exosomes that target and repair pro-inflammatory microglia, the method comprising:

[0054] Construction of a recombinant lentiviral vector containing the Gas6 gene;

[0055] The Gas6 gene is overexpressed in stem cells by lentiviral transfection, the cell supernatant is collected, and exosomes are collected from the cell supernatant by ultracentrifugation, wherein the exosomes carry the Gas6 protein.

[0056] Among them, collecting exosomes by ultracentrifugation is a conventional method, which specifically includes: collecting cell supernatant, removing floating cells, dead cells, and cell debris by ultracentrifugation, collecting the precipitate by centrifugation again, washing impurities with PBS and resuspending to obtain exosomes.

[0057] In this embodiment, the lentiviral transfection method includes:

[0058] The Gas6 gene, 3xFLAG sequence, linker sequence and transmembrane peptide sequence were constructed into a lentiviral vector to obtain a recombinant lentiviral vector;

[0059] The recombinant lentiviral vector is used to transfect stem cells, and stem cells capable of overexpressing the Gas6 gene are screened and obtained.

[0060] In this embodiment, Figure 1 As shown, the obtained recombinant lentiviral vector is pSLenti-EF1a-Gas6-3xFLAG-linker-PDGFR-PGK-Puro-WPRE.

[0061] In this embodiment, the stem cells are human or mouse neural stem cells or mesenchymal stem cells. The Gas6 genes used include mouse Gas6 genes and human Gas6 genes. When mouse stem cells are used, a recombinant lentiviral vector containing the mouse Gas6 gene sequence is constructed and the stem cells are transfected. When human stem cells are used, a recombinant lentiviral vector containing the human Gas6 gene sequence is constructed and the stem cells are transfected. The difference between the two lentiviral vector construction methods lies only in the difference in the Gas6 gene sequence used.

[0062] In this example, the construction method of a recombinant lentiviral vector containing a mouse Gas6 gene sequence is described in detail, including:

[0063] The mouse Gas6 gene sequence was obtained by database screening, and a Gas6 effective gene was constructed based on the Gas6 gene sequence. The sequence of the constructed Gas6 effective gene is shown in SEQ ID NO.1;

[0064] (1) The Gas6 gene (i.e., the Gas6 effective gene), 3xFLAG sequence, linker sequence, and transmembrane peptide (PDGFR) sequence were constructed into a lentiviral vector to obtain a recombinant lentiviral vector pSLenti-EF1a-Gas6-3xFLAG-linker-PDGFR-PGK-Puro-WPRE containing the Gas6, 3xFLAG sequence, linker sequence, and transmembrane peptide sequence genes;

[0065] (2) Lentivirus packaging production and supernatant collection;

[0066] (3) Lentiviral supernatant was used to transfect and screen mouse neural stem cells and construct an immortalized mouse Gas6 neural stem cell line.

[0067] Among them, the forward sequencing primer for sequencing and identifying the recombinant plasmid vector is 19444-F: GCCAGCTTGGCACTTGATG (as shown in SEQ ID NO.2); the reverse sequencing primer is PGK-R: AAGAACGGAGCCGGTTGGCG (as shown in SEQ ID NO.3).

[0068] The transfection process in step (3) of this embodiment is specifically as follows:

[0069] Plate the stem cells to be transfected (using C17.2 cells as an example):

[0070] C17.2 cells were seeded into 6-well plates at a confluence of 30%; C17.2 cells were plated at 2.5×10 5 cells / mL cell suspension, ready for plating; 2 mL per well, i.e. 5×10 5 cells / well, spread on a 6-well plate.

[0071] The specific operation of lentivirus infection is as follows: 12 to 20 hours after cell plating, lentivirus is infected;

[0072] Add polybrene: Add 10 μL of 1 mg / mL polybrene to each well, for a final polybrene concentration of 5 μg / mL in the cell sample. Change the culture medium 12-20 hours after infection: Discard the culture medium and add 2 mL of fresh culture medium to each well.

[0073] Stable strain screening: After 72 hours, add puromycin to a final concentration of 2 μg / mL. Replace the culture medium with fresh puromycin every 2-3 days. Approximately two weeks after drug screening, extract proteins for Western blot analysis.

[0074] In this embodiment, during the transfection process, the titer of the lentivirus used was 2.0-3.0 TU / ml; wherein, the titer of the lentivirus was specifically determined through a lentivirus titration experiment.

[0075] In this example, a control lentiviral vector pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3xFLAG-WPRE was constructed;

[0076] Stem cells were transfected with recombinant and control lentiviral vectors. Approximately two weeks after puromycin selection, white light images were taken. Cell 3xFLAG protein expression levels were assessed by Western blot. If successful, stable cell lines were established and cryopreserved.

[0077] Gas6-3xFLAG-linker-transmembrane peptide protein is approximately 80KDa, Figure 2 As shown, NSC represents normal neural stem cells, negative control represents neural stem cells after transfection with the control lentiviral vector, and Gas6-NSC represents neural stem cells after transfection with the recombinant lentiviral vector of the present invention; the experimental results showed that a protein band was detected at around Marker 100 KDa, so mouse neural stem cells overexpressing Gas6 were successfully constructed.

[0078] Exosome extraction: Collect the cell supernatant, collect the exosomes by centrifugation, and further wash the impurities and resuspend them with PBS. Characterization and detection are then performed. Figure 3-Figure 5 In the figure, NSC-exo represents exosomes secreted by normal neural stem cells, and Gas6-exo represents exosomes secreted by neural stem cells after lentiviral vector transfection. As can be seen from the figure, after overexpression of Gas6, there is no obvious change in the morphology of exosomes, and there is no significant difference in their particle size and membrane potential.

[0079] In this embodiment, the method also includes collecting stem cells that overexpress the Gas6 gene, and collecting cell membrane fragments carrying the Gas6 protein by ultrasonic crushing and centrifugation; the specific method is to culture the stably transfected cell line in a serum-free culture medium + 1% penicillin and streptomycin + 2 μg / ml puromycin system, collect the cells, and collect the cell membrane fragments carrying the Gas6 protein on the surface by ultrasonic crushing and centrifugation.

[0080] The present invention also provides a use of cell membrane fragments carrying Gas6 protein, wherein the cell membrane fragments carrying Gas6 protein are used to prepare a drug for preventing or treating Alzheimer's disease, Parkinson's disease, ischemic stroke, neuritis, peripheral neuropathy, and central nervous system infectious diseases. The specific preparation method includes:

[0081] Liposome nanoparticles or PLGA nanoparticles are prepared, and then cell membrane fragments carrying Gas6 protein are adhered to the surface of the nanoparticles or PLGA nanoparticles by extrusion to give the nanoparticles or PLGA nanoparticles targeting effects and low immunogenicity. Finally, the nanoparticles are loaded into a thermosensitive hydrogel.

[0082] The preparation process of liposome nanoparticles is as follows: dissolving phospholipids and cholesterol in methanol, and preparing liposome nanoparticles by microfluidics.

[0083] Preparation method of PLGA nanoparticles: emulsification-solvent evaporation method Steps:

[0084] ① Organic phase preparation: dissolve PLGA (e.g., 50:50 ratio) in dichloromethane (DCM) or ethyl acetate;

[0085] ② Colostrum preparation: The organic phase is added dropwise to the aqueous phase containing an emulsifier (such as PVA, F68), and homogenized at high speed (10,000-20,000 rpm) to form W / O colostrum;

[0086] ③Solvent evaporation: The organic solvent evaporates under magnetic stirring (can be accelerated by decompression), and the particles solidify;

[0087] ④Purification: remove free drugs and emulsifiers by centrifugation / ultrafiltration, freeze-dry and store to obtain PLGA nanoparticles.

[0088] Example 2: An exosome targeted for repairing pro-inflammatory microglial cells, characterized in that the exosomes are prepared using the preparation method described in Example 1, and the stem cell exosomes carry Gas6 protein.

[0089] Example 3: Application of exosomes for targeted repair of pro-inflammatory microglia. The exosomes described in Example 2 are used in the preparation of a drug for preventing or treating Alzheimer's disease, Parkinson's disease, ischemic stroke, neuritis, peripheral neuropathy, and central nervous system infectious diseases. These exosomes restore microglia to their normal state before allowing them to exert anti-inflammatory and phagocytic effects, potentially useful for all neuroinflammatory diseases.

[0090] Exosomes were loaded into thermosensitive hydrogels, and the exosome-loaded thermosensitive hydrogels (FR@Gas6-exo) were sprayed into the nasal cavity of mice. The exosomes entered the brain through nasal delivery. Under the action of Gas6 protein, the exosomes combined with microglia, restoring the phagocytic function and anti-inflammatory activity of microglia, thereby reducing Aβ aggregation and neuroinflammation.

[0091] The thermosensitive hydrogel is prepared by mixing F127 (polyethylene glycol-polypropylene glycol-polyethylene glycol triblock copolymer, a conventional compound purchased from Suzhou Yongqinquan Intelligent Equipment Co., Ltd.), ginsenoside Rg3 and hydrogel, and shaking at 4-18° C. for 0.5-1 hour to prepare an antioxidant thermosensitive hydrogel;

[0092] In the thermosensitive hydrogel, the concentration of F127 is 200-300 mg / mL, and the concentration of ginsenoside Rg3 is 1-50 mg / mL.

[0093] During application, the amount of exosomes added to each milliliter of thermosensitive hydrogel is 0.5-5 mg.

[0094] This example constructs an anti-oxidative thermosensitive hydrogel that can adhere to the skin surface, solidify at 37°C, and can adhere for 120 minutes.

[0095] like Figure 6 As shown, electron microscopy results showed that the thermosensitive hydrogel FR (composed of F127 and Rg3) was successfully constructed, and exosomes were observed in the pores. Figure 7-Figure 8 Results showed that the thermosensitive hydrogel is liquid at room temperature and solidifies at 37°C. Once applied to the skin, it immediately solidifies and maintains its solid state for approximately two hours. The solidification time of the thermosensitive hydrogel is approximately two hours, and it does not cause discomfort or discomfort to the patient.

[0096] Figure 9-10In the figure, NSC-exo represents exosomes secreted by normal neural stem cells, Gas6-exo represents exosomes secreted by neural stem cells after lentiviral vector transfection; FR@Gas6-exo represents thermosensitive hydrogel loaded with exosomes; Figure 9-10 Flow cytometry analysis showed that the thermosensitive hydrogel-loaded Gas6-exo (FR@Gas6-exo) bound more to BV2 cells.

[0097] Figure 11-12 Flow cytometry revealed that thermosensitive hydrogel-loaded Gas6 exosomes (FR@Gas6-exo) promoted Aβ uptake by BV2 cells. Compared to the exosome group, overexpressed Gas6 exosomes showed stronger binding to BV2 cells, indicating that Gas6 can target microglia and activate their phagocytic function. Furthermore, the thermosensitive hydrogel enhanced this function.

[0098] Figure 13-14 ELISA results showed that FR@Gas6-exo alleviated and promoted the expression of NGF and BDNF in HT22 cells; Figure 15-16 ELISA results showed that FR@Gas6-exo reduced the expression of the inflammatory factor TNF-α in BV2 cells and promoted the expression of IL-10. This indicates that compared with the exo group, exo overexpressing Gas6 has a stronger repair ability on HT22 cells. When HT22 and BV2 cells were co-cultured, the FR@Gas6-exo group expressed higher levels of the neurotrophic factors NGF and BDNF, indicating that after expressing Gas6 protein, Gas6-exo enhanced the regulation of neuroinflammation in BV2 cells and repaired neuronal damage.

[0099] Specifically, the concentration of exosomes delivered to the nasal cavity: the exosome-loaded hydrogel was sprayed into the mouse nasal cavity to form a layer of hydrogel on the outer surface of the olfactory epithelial cells. The exosome concentration was 1 mg / ml (0.5-4 mg / ml), the total amount was 10-30 μl, twice a week, and the treatment was continuous for 4 weeks.

[0100] In this example, F127, ginsenoside Rg3, and hydrogel were mixed and shaken at 4°C for 0.5-1 hour to prepare an antioxidant thermosensitive hydrogel. The concentration of F127 in the thermosensitive hydrogel was 200-300 mg / mL, and the concentration of ginsenoside Rg3 was 1-50 mg / mL. Exosomes were then loaded onto the thermosensitive hydrogel.

[0101] After co-incubation with exosomes, Cy7 dye was instilled into the nasal cavity and then detected at 0, 1, 2, 4, 8, 12, 24, and 48 hours. Figure 17As shown in the figure, after 1 hour, all exosomes in the group were able to enter the brain and reached a peak at 4 hours. Compared with exosomes, Gas6-exo and FR@Gas6-exo had significantly longer residence time in the brain, and FR@Gas6-exo had a longer residence time, with fluorescence still detectable at 48 hours.

[0102] Compared with the exo group, the regulatory ability of exo after overexpression of Gas6 on neuroinflammation was enhanced, such as Figure 15-16 The results showed that the expression level of the pro-inflammatory factor TNF-α in the FR@Gas6-exo group was significantly reduced, while the expression level of the anti-inflammatory factor IL-1 was higher. This indicates that the thermosensitive hydrogel loaded with Gas6 has a stronger inhibitory effect on neuroinflammation. The same results were also obtained in the mouse experiment ( Figure 21-22 ) and can significantly improve the cognitive dysfunction of 5xFAD mice ( Figure 19 ).

[0103] like Figure 17 As shown, compared with the exosome group, the Gas6-exo group showed a significant increase in brain retention at 1, 3, and 6 hours, and its degradation rate slowed at subsequent time points, resulting in a longer brain retention period. Furthermore, the exosomes in the FR@Gas6-exo group remained in the brain longer. We analyzed this to be due to the thermosensitive hydrogel increasing the duration of exosome activity and the effect of Gas6, which resulted in greater binding of Gas6-exo to microglia and less clearance.

[0104] like Figure 19 As shown, the mouse water maze results showed that compared with normal Gas6-exo, the number of times the mice crossed the platform within 1 minute was significantly increased after treatment with thermosensitive hydrogel-loaded exo overexpressing Gas6, indicating that Gas6-exo has a better effect on improving cognitive dysfunction in mice.

[0105] Figure 19-20 ELISA results showed that the levels of neurotrophic factors NGF and BDNF in the brains of 5xFAD mice decreased significantly compared to the control group. Compared to the model group, the levels of neurotrophic factors in each treatment group increased significantly, with the most significant increase after thermosensitive hydrogel loading. That is, after FR@Gas6-exo treatment, the expression levels of neurotrophic factors NGF and BDNF in the mouse brains were higher.

[0106] Figure 21-22ELISA results showed that compared with the control group, the level of the pro-inflammatory cytokine TNF-α in the brains of 5xFAD mice was significantly increased, while the level of the anti-inflammatory cytokine IL-10 was significantly decreased. After treatment, the level of neuroinflammation was significantly reduced. Furthermore, compared with the Gas6-exo group, the FR@Gas6-exo group showed a more significant increase in IL-10 levels and a more pronounced decrease in TNF-α, indicating a better therapeutic effect.

[0107] The exosomes provided by the present invention are intended to first restore the normal state and function of microglia, and then exert their anti-inflammatory and phagocytic effects. Gas6 protein is expressed on the cell membrane surface under the action of transmembrane peptides, and the surface of exosomes also carries Gas6 protein under exocytosis. The role of Gas6 protein: Targeted binding to the microglial surface receptor TAM and activating the phagocytic function of TAM. The phagocytic function of microglia is impaired in disease states. First, it promotes microglia to phagocytose Gas6-exo, repairs damaged microglia, activates phagocytic function, and accelerates the uptake and degradation of extracellular proteins.

[0108] The exosomes in the present invention are engineered exosomes Gas6-exo targeting Aβ. The engineered exosomes are secreted by stem cells that stably express the truncated receptor binding domain of growth arrest-specific 6 (Gas6). Gas6 is a bridging molecule that clears dead cells through TAM (TYRO3, AXL and MERTK) receptors, specifically targeting and activating microglia and selectively eliminating Aβ plaques through TAM receptor-dependent phagocytosis without inducing NF-κB-mediated inflammatory responses or reactive glial cell formation. In addition, the uptake of stem cell exosomes exo can restore and enhance the phagocytic function of microglia to induce the coordinated clearance of Aβ. Compared with exo treatment alone, AD model mice showed significantly reduced AD pathologies such as Aβ plaques and neuroinflammation, resulting in better cognitive behavior. At the same time, the effect of the thermosensitive hydrogel (FR) prolonged the drug's duration of action and enhanced its efficacy. The results indicate that FR@Gas6-exo may be a new AD therapeutic agent that overcomes the side effects of traditional antibody treatments.

[0109] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for preparing exosomes that target and repair pro-inflammatory microglia, characterized in that: The method comprises: Construction of a recombinant lentiviral vector containing the Gas6 gene; The Gas6 gene is overexpressed in stem cells by lentiviral transfection, the cell supernatant is collected, and exosomes are collected from the cell supernatant by ultracentrifugation, wherein the exosomes carry the Gas6 protein.

2. The method for preparing exosomes that target and repair pro-inflammatory microglia according to claim 1, characterized in that: The lentiviral transfection method comprises: The Gas6 gene, 3xFLAG sequence, linker sequence and transmembrane peptide sequence were constructed into a lentiviral vector to obtain a recombinant lentiviral vector; The recombinant lentiviral vector is used to transfect stem cells, and stem cells capable of overexpressing the Gas6 gene are screened and obtained.

3. The method for preparing exosomes that target and repair pro-inflammatory microglia according to claim 1, characterized in that: The obtained recombinant lentiviral vector is pSLenti-EF1a-Gas6-3xFLAG-linker-PDGFR-PGK-Puro-WPRE.

4. The method for preparing exosomes that target and repair pro-inflammatory microglia according to claim 1, wherein: During transfection, the titer of the lentivirus used was 2.0-3.0 TU / ml; The stem cells are neural stem cells or mesenchymal stem cells.

5. The method for preparing exosomes that target and repair pro-inflammatory microglia according to claim 1, characterized in that: The method further comprises collecting stem cells that overexpress the Gas6 gene, and collecting cell membrane fragments carrying the Gas6 protein by ultrasonic disruption and centrifugation.

6. An exosome targeted to repair pro-inflammatory microglia, characterized in that: The exosomes are prepared using the preparation method according to any one of claims 1 to 5, and the stem cell exosomes carry Gas6 protein.

7. The use of exosomes for targeted repair of pro-inflammatory microglia according to claim 6, characterized in that: The exosomes are used in the preparation of drugs for preventing or treating Alzheimer's disease, Parkinson's disease, ischemic stroke, neuritis, peripheral neuropathy and central nervous system infectious diseases.

8. The use according to claim 6, characterized in that Exosomes are loaded into thermosensitive hydrogels, which are then sprayed into the nasal cavity. The exosomes enter the brain through nasal delivery. Under the action of Gas6 protein, the exosomes bind to microglia, restoring the phagocytic function and anti-inflammatory activity of microglia to reduce Aβ aggregation and neuroinflammation.

9. The use according to claim 8, characterized in that The preparation method of the thermosensitive hydrogel is as follows: F127, ginsenoside Rg3 and hydrogel are mixed, and the mixture is shaken at 4-18° C. for 0.5-1 h to prepare an antioxidant thermosensitive hydrogel; In the thermosensitive hydrogel, the concentration of F127 was 200-300 mg / mL, and the concentration of ginsenoside Rg3 was 1-50 mg / mL; During application, the amount of exosomes added to each milliliter of thermosensitive hydrogel is 0.5-5 mg.

Images