Streptomyces albidoflavus and application thereof
By using Streptocytica chlorophyces Apcs-3, the prevention and treatment problems of potato scab disease were solved, broad-spectrum inhibition and environmentally friendly prevention and treatment effects on potato and other crop diseases were achieved, and seedling growth was promoted.
Patent Information
- Application Number
- CN202510777044.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-08-19
AI Technical Summary
There is a lack of effective agents for preventing and treating potato scabs in the prior art, and Streptocytica chlorophyllium has not been used in this field, resulting in serious impacts on potato yield and quality.
Streptocytica chlorophyces Apcs-3 is used, and the application is carried out by soaking seeds and irrigating roots to inhibit potato scab bacteria and other plant pathogens, produce proteases and are insensitive to commonly used fungicides, and has broad spectrum and environmental safety.
Effectively prevent and treat potato scab disease, inhibit various crop diseases, promote seedling growth, and is insensitive to commonly used fungicides, with environmental safety and drug compound potential.
Smart Images

Figure CN120505252A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of microorganisms, and particularly relates to a Streptomyces alboflavin and an application thereof. Background Art
[0002] Potato common scab is a disease caused by various pathogenic Streptomyces ( Streptomyces spp.), a seed-borne and soil-borne disease found in every potato-growing region worldwide and common in microtuber seed production bases, not only reduces tuber quality and commercial value but, in severe cases, can delay emergence or even kill seedlings, leading to a decrease in potato yield. Registered pesticides for the control of potato scab in China are extremely scarce, with only one. While Streptomyces alboflavin has been reported in industrial, food, and environmental applications, it has not been reported or applied to the control of potato scab. Summary of the Invention
[0003] In order to solve the above problems, the present invention provides a Streptomyces alboflavin and applications thereof.
[0004] A Streptomyces alboflavin is Apcs-3, and the strain is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with a deposit number of CGMCC NO.33439.
[0005] A bacterial liquid, characterized in that it comprises the Apcs-3.
[0006] The invention relates to the use of Streptomyces alboflavin in inhibiting plant pathogens, wherein the Streptomyces alboflavin is the Apcs-3.
[0007] Preferably, the plant pathogens are: potato scab pathogen, potato early blight pathogen ( Alternaria nightshade )、Triticum fusarium ( Fusarium gramineae )、Corn Curvularia spp. ( Curved moonlit ), Bipolaris maydis ( Bipolaris maydis )、Cucumber damping-off pathogen ( Pythium aphanidermatum )、Cucumber wilt pathogen ( Fusarium oxysporum ), cucumber target spot pathogen ( Corynespora cassicola )、Pepper Anthracnose ( Colletotrichum capsici )、Eggplant brown streak pathogen ( Phomopsis vexans ) and tobacco root rot pathogen ( Fusarium solani ) one or more.
[0008] The application of Streptomyces alboflavin in preventing and controlling potato scab, wherein the Streptomyces alboflavin is the Apcs-3.
[0009] Preferably, when controlling potato scab, the Streptomyces alboflavin is applied to potato seedlings.
[0010] Preferably, the application concentration of the Streptomyces alboflavin is 1×10 7 CFU·g -1 ~1×10 9 CFU·g -1 The application amount is 100 mL / plant to 200 mL / plant.
[0011] Preferably, when preventing and controlling potato scab, the Streptomyces alboflavin is used to soak potato seeds, and the soaked seeds are irrigated after sowing.
[0012] Preferably, the root irrigation concentration of the Streptomyces alboflavin is 1×10 8 CFU·g -1 The root irrigation amount is 100 mL / plant to 200 mL / plant.
[0013] Compared with the prior art, the present invention is beneficial in that: The strain of the present invention has the function of preventing and treating potato scab, can effectively prevent and treat potato scab, has a broad spectrum, has an inhibitory effect on pathogens of potato and other crop diseases, can also produce protease, is insensitive to commonly used fungicides, and is sensitive to multiple antibiotics, indicating that it has good environmental safety and potential for combination with other agents, and also has the dual effects of enzyme production and growth promotion. Screening shows that other regional and color Streptomyces have no effect on potato scab. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 It is a confrontation culture of potato scab, among which A is the confrontation culture of strain against potato scab and B is the confrontation culture of strains from other regions and colors against potato scab.
[0015] Figure 2 is the antibacterial spectrum, where A: Alternaria solani ; B: Grassy shoots ; C: Curvularia lunate ;D: Bipolaris maydis ; E: Pythium aphanidermatum ; F: Fusarium oxysporum ; G: Corynespora cassicola ;H: Colletotrichum capsici ; I: Phomopsis annoying ; J: Fusarium solani .
[0016] Figure 3The Gram staining, colony characteristics and electron microscopy observation of strain Apcs-3, among which A is Gram staining; B is the colony morphology of Apcs-3 on OMA plate; C is the morphology of Apcs-3 under electron microscope at 13.0K times; D is the morphology of Apcs-3 under electron microscope at 10.0K times.
[0017] Figure 4 A phylogenetic tree of strain Apcs-3 was constructed for the 16S rDNA sequence.
[0018] Figure 5 is the result of antagonistic enzyme activity determination, where A is protease, B is pectinase, and C is cellulase.
[0019] Figure 6 It is the result of the growth-promoting characteristics, where A is the nitrogen-promoting ability, B is the phosphorus-solubilizing ability, and C is the potassium-solubilizing ability.
[0020] Figure 7 The results of volatile substance detection are shown in Figure 2, where A is the strain treated with Apcs-3 and B is CK.
[0021] Figure 8 Effects on seedlings. A is the potato seedlings treated with Apcs-3 bacterial suspension, and B is the potato seedlings treated with clean water. DETAILED DESCRIPTION
[0022] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.
[0023] The culture medium information used in the present invention is as follows: The formula of LB medium is: yeast extract 5.0 g, peptone 10.0 g, NaCl 5.0 g, agar powder 15.0 g, and water is added to 1 L.
[0024] LB liquid medium: The formula is: yeast extract 5.0 g, peptone 10.0 g, NaCl 5.0 g, and water to 1 L.
[0025] The formula of PDA culture medium is: 200.0 g of potato, 20.0 g of glucose, 15.0 g of agar powder, and water to 1 L.
[0026] The formula of OMA solid culture medium is: 60.0 g of oats, 15.0 g of agar powder, and water to 1 L.
[0027] The formula of OMA liquid culture medium is: 60.0 g of oats, made up to 1 L with water.
[0028] The formula of skim milk culture medium is: glucose 15.0g, skim milk powder 20.0g, KCl 0.5g, MgSO4·7H2O0.5g, agar powder 15.0g, and water is added to 1L.
[0029] The formula of pectin culture medium is: pectin 5.0 g, peptone 2.0 g, KH2PO4 0.5 g, MgSO4·7H2O 0.3 g, agar powder 15.0 g, and water is added to 1 L.
[0030] The formula of sodium carboxymethyl cellulose culture medium is: 5.0 g of peptone, 1.0 g of yeast extract, 3.0 g of beef extract, 5.0 g of sodium carboxymethyl cellulose, and water is added to 1 L.
[0031] The formula of nitrogen-promoting culture medium is: K2HPO4 0.2g, MgSO4·7H2O 0.2g, NaCl 0.2g, CaCO3 5.0g, mannitol 10.0g, CaSO4 0.1g, agar powder 15.0g, and water is added to 1L.
[0032] The formula of phosphate-solubilizing culture medium is: glucose 10.0g, (NH4)2SO40.1g, MgSO4·7H2O 0.25g, KCl0.2g, MgCl2·6H2O 5.0g, Ca3(PO4)25.0g, agar powder 15.0g, and water is added to 1L.
[0033] The formula of potassium-dissolving culture medium is: sucrose 5.0g, Na2HPO4 2.0g, MgSO4·7H2O 0.5g, FeCl3 0.005g, CaCO3 0.1g, potassium feldspar 2.0g, agar powder 15.0g, and water is added to 1L.
[0034] The formula of MH culture medium is: beef extract powder 6.0, soluble starch 1.5, acid hydrolyzed casein 17.5, agar powder 17.0, and water is added to 1L.
[0035] Example 1 Identification of strain Apcs-3 (1) Observation of morphological characteristics and determination of physiological and biochemical characteristics After single colony purification of strain Apcs-3 on OMA medium, single colonies were picked with an inoculating loop and streaked in a zigzag pattern on Gao's No. 1, LB, ISP2, ISP6, or NA culture media. After 24 hours, the colony morphology of strain Apcs-3 on OMA medium was observed. Gram staining was performed, and bacterial morphology was observed using a scanning electron microscope.
[0036] Physiological and biochemical indicators of the strains were determined according to the Bergey's Manual of Bacterial Identification and the Manual of Common Bacterial Systematic Identification. These included starch hydrolysis, catalase reaction, VP reaction, H2S production, methyl red reaction, citrate utilization, nitrate reduction, casein hydrolysis, gelatin hydrolysis, phenylalanine dehydrogenase detection, and common carbon source utilization.
[0037] (2) Molecular identification of strain Apcs-3 The strain was inoculated into OMA liquid medium and cultured at 28°C and 180 rpm for 2 days. DNA was extracted using the SDS method, and the 16S rDNA gene sequence of the strain was amplified using primers PAF (AGAGTTTGATCCTGGCTCAG, SEQ ID NO. 1) and PHR (AAGGAGGTGATCCAGCCGCA, SEQ ID NO. 2). The reaction system consisted of 2xTaq PCR Mix 25 µL, ddH2O 22 µL, Primer-F 1 µL, Primer-R 1 µL, and DNA 1 µL. The amplification procedure was as follows: initial denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min. PCR amplification products were electrophoresed on 1% agarose gels, stained with ethidium bromide (EB), and visualized on a gel imager. Products with clear bands were sent to Beijing Liuhe BGI Genomics Co., Ltd. for purification and sequencing. Sequencing results were compared using BLAST comparisons against the NCBI database, and a phylogenetic tree was constructed using the neighbor-joining method using MEGA11 software.
[0038] The morphological characteristics are shown in Table 1 and Figure 3 As shown, scanning electron microscopy revealed continuous aerial hyphae, rod-shaped spores, long spore chains, and wrinkled surfaces on the spores and spore hyphae. Growth on Gao's No. 1 and NA media produced a pale yellow soluble pigment. Gram staining was positive, suggesting that the strain is Streptomyces.
[0039] Table 1 Growth status of strains on five culture media Note: “+” indicates that the strain has a poor growth trend; “++” indicates that the strain has a medium growth level; “+++” indicates that the strain has a relatively good growth trend.
[0040] The results of physiological and biochemical identification are shown in Table 2 and Figure 4The results showed that strain Apcs-3 was a Gram-positive bacterium, positive in the catalase test, and did not produce melanin pigments during metabolism. It was able to decompose gelatin, and the results of starch hydrolysis, VP reaction, methyl red reaction, casein hydrolysis and phenylalanine dehydrogenase were all negative. The results of catalase reaction, nitrate reduction reaction and citrate utilization were all positive. It could grow normally on LB medium containing 1%-7% NaCl and under pH 5-8 conditions. It could utilize fructose, sucrose, sorbitol, mannitol, arabinose, glucose and xylose.
[0041] Based on the results of physiological and biochemical tests and morphological characteristics, the strain was preliminarily identified as Kingdom Bacteria, Phylum Actinomycetes, Class Actinomycetes, Order Actinomycetales, Family Streptomycetes, Streptomyces ( Streptomyces sp.).
[0042] Table 2 Physiological and biochemical characteristics identification Note: “+” represents a positive reaction, and “-” represents a negative reaction.
[0043] (3) Molecular biological identification The 16S rRNA gene sequence of strain Apcs-3 is 1463 bp long. After submitting the sequence to NCBI, BLAST comparison revealed that the 16S rRNA gene sequence of strain Apcs-3 is 92% similar to that of Streptomyces alboflavin.
[0044] Based on the results of colony morphology, physiological and biochemical analysis, and molecular biology, the strain Apcs-3 was identified as Streptomyces alboflavinus ( Streptomyces albidoflavus ).
[0045] Example 2 Determination of the inhibitory effect of Apcs-3 on potato scab The purified Apcs-3 strain and scab pathogens of different colors and regions were streaked onto OMA solid medium for activation. After 2 days, single colonies were picked and inoculated into OMA liquid medium. The culture was shaken at 180 r / min for 48 h to obtain the biocontrol bacteria fermentation liquid for use. The bacterial liquid concentration was 1×10 8 CFU·g -1 Potato scab pathogens were picked and smeared on OMA plates. A sterilized Oxford cup was placed in the center of the plate, and 200 μL of biocontrol bacteria fermentation liquid was dropped into the Oxford cup. Sterile distilled water was added to the Oxford cup as a blank control. Each treatment was repeated three times, and the diameter of the inhibition zone was measured after incubation at 28°C for 7 days.
[0046] The results are as follows Figure 1As shown in Table 3, the antibacterial diameter of Apcs-3 against potato scab reached 25.03 mm ± 0.88 mm, with an inhibition rate of 31.03%. Streptomyces from other regions and colors had no inhibitory effect on potato scab.
[0047] Table 3 Antagonistic effect of strains against potato scab in confrontation culture Note: “-” means no inhibitory effect.
[0048] Example 3 Determination of the antibacterial spectrum of strain Apcs-3 The plate standoff method was used. Pathogen strains (see Table 4) were inoculated into PDA (polystyrene-doped diatoms) and cultured at 28°C for 3 days. A 6-mm-diameter bacterial cake was taken from the edge of the colony using a microporator and placed in the center of the plate. Four symmetrical spots were then applied 2.5 cm from the pathogen cake. A control plate inoculated with the pathogen alone was used. Each treatment was replicated three times. After 3 days of culture, the width of the inhibition zone was measured, and the inhibition rate was calculated.
[0049] The antagonistic effect of Apcs-3 on plant pathogenic fungi was determined. The results are shown in Table 2 and Figure 2 As shown in Figure 2, Apcs-3 has a strong inhibitory effect on potato scab and early blight ( Alternaria solani )、Triticum fusarium ( Fusarium gramineae )、Corn Curvularia spp. ( Curvularia lunate ), Bipolaris maydis ( Bipolaris maydis ), cucumber target spot pathogen ( Corynespora cassicola )、Pepper Anthracnose ( Colletotrichum capsici )、Eggplant brown streak pathogen ( Phomopsis vexans ) also has a good antagonistic effect and has a good broad spectrum.
[0050] Table 4 Antibacterial spectrum of Apcs-3 Note: Values are the mean ± standard deviation of three replicates. The growth inhibition rate was tested using Duncan's Multivariate Range Test. In the same column, the same mean value before the same letter indicates no significant difference.
[0051] Example 4 Sensitivity assay of Apcs-3 to common chemical agents The paper strip method was used to determine the drug sensitivity of antagonistic bacteria to common chemical agents. The antagonistic bacteria were inoculated into LB liquid medium and cultured at 28°C and 180 rpm for 48 h. The bacterial solution concentration was adjusted to 1×10 8 CFU·g -1Pipette 50 µL of the bacterial solution and evenly spread it on the culture medium, then air dry. Use sterile tweezers to inoculate a sterilized filter paper disc in the center of the plate. Set the concentration of the drug in three gradients: 10 mg / mL, 100 mg / mL, and 1000 mg / mL. Add 20 µL of the chemical agent (see Table 5) to each filter paper disc. Add an equal amount of sterile water as a blank control. Repeat each treatment three times.
[0052] The results are shown in Table 5. Tebuconazole, Zhongshengmycin, difenoconazole, fludioxonil, and boscalid all had a certain inhibitory effect on strain Apcs-3, and the inhibition rate of strain growth was positively correlated with the increase in concentration. Among them, fludioxonil and Zhongshengmycin had an inhibitory effect on strain growth at 10 mg / mL, while carbendazim, azoxystrobin, thiamethoxam, thiophanate-methyl, and oxamectin had no effect on the growth of strain Apcs-3.
[0053] Table 5 Sensitivity to common Apcs-3 chemicals Note: “-” indicates that the fungicide has no effect on the growth of antagonistic bacteria; “+” indicates that the fungicide affects the growth of antagonistic bacteria, but the degree of effect is less than “++”; “++” (<2 mm) indicates that the fungicide slightly inhibits the growth of antagonistic bacteria; “+++” (2 mm-10 mm) indicates that the growth of antagonistic bacteria is severely inhibited.
[0054] Example 5 Determination of the sensitivity of Apcs-3 to antibiotics The susceptibility of antagonistic bacteria Apcs-3 to common antibiotics was determined by the paper strip method. Antagonistic bacteria were inoculated into MH medium and cultured at 28°C and 180 rpm for 48 h. The bacterial solution concentration was adjusted to 1×10 8 CFU·g -1 Pipette 50 µL of the suspension and evenly spread it on the culture medium, then allow to dry. Use sterile tweezers to inoculate the drug-sensitive paper disc in the center of the plate. After incubation at 28°C for 18 h, measure the size of the inhibition zone. Use sterile water as a blank control. Repeat each treatment three times. Measure the diameter of the inhibition zone and interpret the results according to the Standard for Antimicrobial Susceptibility Testing by Disk Method (WST 125-1999) and the National Committee for Clinical Laboratory Standards (NCCLS) standards.
[0055] Sixteen common antibiotics were selected for investigation. Apcs-3 showed sensitivity to these antibiotics (S), doxycycline, ceftriaxone, cefoperazone, kanamycin, cefazolin, cefuroxime sodium, tetracycline, amikacin, and minocycline. It showed intermediate sensitivity (I) to the remaining five antibiotics and was insensitive (R) to ampicillin (Table 6).
[0056] Table 6 Apcs-3 sensitivity to antibiotics Note: S means sensitive, the diameter of the inhibition zone is greater than 25 mm; I means intermediate, the diameter of the inhibition zone is 16-25 mm; R means insensitive, the diameter of the inhibition zone is less than 16 mm.
[0057] Example 6 Apcs-3 antagonist enzyme activity assay Different culture media were used to detect protease, pectinase and cellulase.
[0058] Use skim milk culture medium to detect protease production. The antagonistic bacteria were spotted in the center of the skim milk culture medium plate and cultured in an incubator at 28°C for 48 h. If a transparent circle was produced around the antagonistic bacteria, it was considered positive, indicating that protease could be produced. The diameter of the transparent area was recorded.
[0059] Pectinase activity was detected by culturing strains in pectinase medium. Antagonistic bacteria were spotted in the center of the pectinase medium plate and cultured at 28°C for 48 h. If a transparent zone was formed around the antagonistic bacteria, it was considered to have produced pectinase activity and was positive. The diameter of the transparent zone was recorded.
[0060] Cellulase activity was tested using carboxymethyl cellulose medium. Antagonistic bacteria were spotted onto the center of a carboxymethyl cellulose medium plate and incubated at 28°C for 72 h. The plate was then stained with 1 mg / mL Congo red for 15 min and rinsed with 1 mol / L NaCl. A clear zone formed around the antagonistic bacteria, indicating cellulase activity and a positive result. The diameter of the clear zone was recorded. Each treatment was replicated three times.
[0061] like Figure 6 As shown, strain Apcs-3 is able to produce protease.
[0062] Example 7 Determination of the growth-promoting properties of Apcs-3 Different culture media were used to detect whether the strain had the ability to promote nitrogen, solubilize phosphorus and solubilize potassium.
[0063] Nitrogen-promoting ability test: inoculate the antagonistic bacteria into the center of the nitrogen-fixing culture medium and culture at 28°C for 5 days. Observe the growth of the strain and whether there is a transparent zone to determine the nitrogen-promoting ability of the strain.
[0064] Phosphate solubilization ability test: The strain was inoculated into phosphate solubilization medium and cultured at 28°C for 5 days. The growth of the strain and the formation of transparent zones were observed to determine the phosphate solubilization ability of the strain.
[0065] Potassium-solubilizing ability test: Antagonistic bacteria were inoculated into potassium-solubilizing culture medium and cultured at 28°C for 5 days. The growth of the strain and the formation of transparent zones were observed to determine the potassium-solubilizing ability of the strain.
[0066] like Figure 6 As shown, after the strain was cultured in different culture media, no changes were observed in the nitrogen-promoting, phosphorus-solubilizing, and potassium-solubilizing media, indicating that the strain did not have the ability to promote nitrogen, solubilize phosphorus, and solubilize potassium.
[0067] Example 8 Volatile substance detection The detection of antagonistic related volatile substances adopts the plate inversion method, that is, one plate is inoculated with potato early blight, and one plate is inoculated with antagonistic bacteria. The two plates are inverted and sealed, and the results are observed and recorded after co-culture at 28°C for 5-7 days. The blank plate and the pathogen plate with the plates inverted and sealed are used as blank controls. Each treatment is repeated more than three times. The antagonistic bacteria are inoculated in LB medium, the potato early blight is inoculated in PDA medium, and the fungus is inoculated using a 6 mm diameter punch to punch out a bacterial cake and inoculate it in the center of the plate. LB medium is used for the culture of antagonistic bacteria, and a pipette is used to draw 100 μL of bacterial suspension (10 7 CFU . g -1 ) evenly spread on the plate.
[0068] like Figure 7 As shown, the strain does not produce volatile substances, and the early blight pathogen colonies did not change after treatment, indicating that the strain's lack of volatile substances has no effect on the early blight pathogen colonies.
[0069] Example 9 Effects on potato seedlings Apcs-3 was inoculated into OMA liquid culture medium and cultured on a shaker at 28°C and 180 r / min for 2 days to obtain bacterial suspension, which was then diluted to 1×10 8 CFU·g -1 Sprouted potato tubers disinfected with sodium hypochlorite were planted in 18 cm × 15 cm pots filled with a sterilized substrate:vermiculite (2:1) ratio, with one tuber per pot (each tuber containing one bud). Simultaneously with the seed potatoes, 100 mL of Apcs-3 culture solution was added to each pot. A total of 15 pots were grown in a greenhouse (15°C–25°C). After 30 days, the tubers were removed from the pots, and the tuber germination rate, fresh weight, and dry weight of the seedlings were measured.
[0070] The results are shown in Table 7 and Figure 8 As shown in the data, after treatment with the fermentation broth of strain Apcs-3, the seedling height was 12.27 cm ± 1.60 cm, and the fresh weight and dry weight were 5.77 g ± 2.44 g and 0.59 g ± 0.21 g, which were all higher than those of the control, indicating that strain Apcs-3 has the effect of promoting the growth of potato seedlings.
[0071] Table 7 Effects on potato seedlings Note: The data are expressed as "mean ± standard deviation". Means marked with different letters indicate significant differences at the significance level of P < 0.05.
[0072] Example 10 Effect on the prevention and control of potato scab: The experimental field was a continuous potato cropping field, and the incidence of potato scab in the previous year was greater than 50%. Apcs-3 was inoculated into OMA liquid culture medium and cultured in a shaker at 28°C and 180 rpm for 2 days. The concentration was adjusted to 1×10 8 CFU·g -1 The application method is a combination of seed soaking and in-furrow application. Healthy, sprouting potato tubers were surface disinfected and then soaked in the bacterial solution for 30 minutes before sowing. Plants were spaced 30 cm apart and row widths were 50 cm wide. After sowing, each plant was irrigated with 100 mL of bacterial solution. 100 plants were treated, with three replicates set up in the same plot. Water treatment served as a blank control. Normal field management was maintained without the application of any other pesticides. After 70 days, at potato harvest time, the incidence rate, disease index, and control efficacy were assessed.
[0073] After two years of field trials, the average control effect of Apcs-3 bacterial liquid on potato scab was 65.78%.
[0074] Table 8 The control effect of Apcs-3 bacterial solution on potato scab Note: The data are expressed as "mean ± standard deviation". Means marked with different letters indicate significant differences at the significance level of P < 0.05.
[0075] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.
[0076] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0077] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. A Streptomyces alboflavin, characterized in that The Streptomyces alboflavin is Apcs-3, and the strain is deposited in the General Microbiology Center of China Culture Collection Administration of Microorganisms with the deposit number of CGMCC NO.33439.
2. A bacterial liquid, characterized in that: Including the Apcs-3 described in claim 1.
3. The use of Streptomyces alboflavin in inhibiting plant pathogens, characterized in that: The Streptomyces alboflavin is the Apcs-3 described in claim 1.
4. The use according to claim 3, characterized in that The plant pathogens are: potato scab pathogen, potato early blight pathogen ( Alternaria solani )、Triticum fusobacteria( Fusarium graminearum )、Corn Curvularia spp. ( Curvularia lunata ), Bipolaris maydis ( Bipolaris maydis )、Cucumber damping-off pathogen ( Pythium aphanidermatum )、Cucumber wilt pathogen ( Fusarium oxysporum ), cucumber target spot pathogen ( Corynespora cassiicola )、Pepper Anthracnose ( Colletotrichum capsici )、Eggplant brown streak pathogen ( Phomopsis vexans ) and tobacco root rot pathogen ( Fusarium solani ) one or more.
5. The application of Streptomyces alboflavin in preventing and controlling potato scab is characterized in that: The Streptomyces alboflavin is the Apcs-3 described in claim 1.
6. The use according to claim 5, characterized in that When preventing and controlling potato scab, the white-flavor Streptomyces is applied to potato seedlings.
7. The use according to claim 6, characterized in that The application concentration of the Streptomyces alboflavin was 1×10 7 CFU·g -1 ~1×10 9 CFU·g -1 The application amount is 100 mL / plant to 200 mL / plant.
8. The use according to claim 5, characterized in that When preventing and controlling potato scab, the white-flavor Streptomyces is used to soak potato seeds, and the soaked seeds are irrigated after sowing.
9. The use according to claim 8, characterized in that The root irrigation concentration of the Streptomyces alboflavin was 1×10 7 CFU·g -1 ~1×10 9 CFU·g -1 The root irrigation amount is 100 mL / plant to 200 mL / plant.
Citation Information
Patent Citations
Streptomyces albidoflavus and application thereof
CN119020229A