An engineered bacterium, biosensor and method of detection thereof

By integrating blocking gRNA and dCas9-SoxS into engineered bacteria, and using the CRISPRa system to activate the promoter-driven CymA-MtrCAB module, highly sensitive recognition of nucleic acid targets, dynamic regulation of gene expression, and real-time output of electrical signals were achieved, overcoming the shortcomings of existing technologies and making it suitable for various detection scenarios.

CN120505261BActive Publication Date: 2026-02-03ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510500387.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2026-02-03
Estimated Expiration
2045-04-21

AI Technical Summary

Technical Problem

Existing biosensing technologies cannot achieve highly sensitive identification of nucleic acid targets, dynamic regulation of gene expression, and real-time output of electrical signals. They cannot achieve continuous monitoring in living organisms or complex environments, and their signal amplification efficiency is low, target adaptability is limited, and stability is poor.

Method used

By integrating blocking gRNA with dCas9-SoxS, the CRISPRa system is used to activate a specific promoter to drive the expression of the CymA-MtrCAB gene module, thereby achieving a direct link between exogenous nucleic acid molecules and electron output. The engineered bacterium Acinetobacter baylyi ADP1 is used as a vector to combine with conductive matrices such as carbon nanotubes or graphene to output electrical signals.

Benefits of technology

It achieves highly sensitive recognition of exogenous nucleic acid molecules, dynamic regulation and signal amplification, stable electrical signal output, short response time, detection limit of approximately 0.7 nM, and current drift rate of less than ±10%, making it suitable for various detection scenarios.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505261B_ABST
    Figure CN120505261B_ABST
Patent Text Reader

Abstract

The application discloses an engineering bacterium, a biosensor and a detection method thereof. The biosensor takes the modified Acinetobacter baylyi ADP1 as a carrier, utilizes the natural nucleic acid uptake capacity thereof, and can autonomously absorb exogenous nucleic acid without external induction; after the nucleic acid is internalized, the hairpin structure restriction of the blocked gRNA is removed, the CRISPRa system is activated, the dCas9-SoxS protein is targeted and combined with the target promoter, the CymA-MtrCAB gene expression is started, and the specific recognition of the nucleic acid sequence is realized. The system integrates the CymA-MtrCAB transmembrane electron conduction module, converts the biological recognition signal into an electrochemical signal output in real time through the membrane protein-mediated electron transfer chain, and establishes a detection path of 'nucleic acid recognition-gene activation-electric response'. The biosensor has the advantages of modular structure, high response specificity, high detection sensitivity, wide environmental adaptability and the like, is suitable for tumor marker detection, wearable health monitoring and other biological molecule recognition scenes, and provides a novel programmable biological perception solution with high universality.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosensing technology, specifically relating to an engineered bacterium, a biosensor, and a detection method thereof. Background Technology

[0002] In recent years, the demand for highly sensitive, real-time dynamic biosensing technologies has become increasingly urgent in fields such as early tumor diagnosis, infectious disease monitoring, and environmental pollution detection. However, traditional detection technologies (such as PCR and ELISA) have significant limitations: PCR relies on target nucleic acid amplification, which is prone to false positives / false negatives due to primer mismatch or amplification deviation (e.g., the detection limit is usually in the picomolar range, making it difficult to identify low-abundance mutations); antibody-based methods such as ELISA are limited by antibody cross-reactivity and cannot directly detect nucleic acid targets. Traditional technologies require complex sample preprocessing (such as DNA extraction and amplification) and offline analysis, making continuous monitoring in vivo or complex environments impossible. Existing sensors mostly rely on static molecular recognition (such as antibody-antigen binding) and cannot dynamically adjust signal output according to changes in target concentration.

[0003] To overcome the aforementioned bottlenecks, the cross-integration of synthetic biology and electrochemical technology has become a research hotspot.

[0004] Synthetic biological sensors: These sensors use engineered bacteria (such as E. coli) to sense environmental signals and output fluorescence or colorimetric signals. However, their sensitivity is limited by optical detection methods (such as fluorescence background noise) and they are difficult to integrate with portable electronic devices.

[0005] CRISPR-Cas systems (such as Cas12 / 13) have been used for nucleic acid detection, but they rely on the release of reporter molecules after target cleavage (such as hydrolysis of ssDNA fluorescent probes), resulting in low signal amplification efficiency and inability to couple electronic signal output.

[0006] Electrochemical biosensors based on oxidoreductases (such as horseradish peroxidase) or conductive nanomaterials can directly output electrical signals, but they suffer from problems such as poor stability (easy enzyme inactivation) and limited target adaptability (depending on fixed probes).

[0007] In recent years, microbial electrochemical systems (such as the CymA-MtrCAB electron transport chain of Shewanella) have emerged in the field of bioenergy, converting metabolic activity into electric current through transmembrane electron transport. However, such systems have not yet been integrated with gene editing technology, failing to achieve specific triggering and signal amplification of target molecules (such as RNA or DNA). Furthermore, while natural DNA-taking strains (such as Acinetobacter baylyi ADP1) have been used for environmental DNA capture, their transformation mechanisms have not been systematically developed into sensor carriers, particularly lacking integration with CRISPR activation (CRISPRa) and the electron transport chain. Current technologies have not yet solved the problem of full-chain integration from highly sensitive nucleic acid target recognition to dynamic regulation of gene expression to real-time electrical signal output. Summary of the Invention

[0008] To address the shortcomings of existing technologies in achieving a complete chain integration of highly sensitive nucleic acid target recognition, dynamic regulation of gene expression, and real-time output of electrical signals, this invention proposes a biosensor and detection method based on engineered bacteria.

[0009] This invention represents the first realization of an electron transport system triggered by exogenous nucleic acid molecules. By integrating a blocking gRNA (BgRNA) with dCas9-SoxS, when an exogenous nucleic acid molecule (such as KRAS G12D mutant RNA) binds to the BgRNA, the hairpin structure unwinds, and the gRNA guides the dCas9-SoxS complex to activate a promoter near a specific site. The promoter activated by the CRISPRa system drives the expression of the CymA-MtrCAB gene module. The encoded multi-component membrane localization protein achieves transmembrane electron transfer through the synergistic effect of heme cofactor, ultimately exporting intracellular electrons to an external electrode, forming a measurable electrical signal. This mechanism establishes a direct link between exogenous nucleic acid molecules and the electron export system, exhibiting dynamic regulation and signal amplification capabilities. The theoretically estimated detection limit is approximately 0.7 nM (calculated with a signal-to-noise ratio S / N=3), the response time is no more than 30 minutes, and the current drift rate is less than ±10%.

[0010] The technical solution of the present invention is to provide an engineered bacterium, including a protein that takes up exogenous nucleic acid molecules;

[0011] And, dCas9-SoxS fusion protein and blocking gRNA (BgRNA) linked to dCas9-SoxS fusion protein.

[0012] The BgRNA unlocks the hairpin structure by binding to exogenous nucleic acid molecules, guiding the dCas9-SoxS fusion protein to target a specific promoter and initiate the transcription of transmembrane electron transport proteins. These transmembrane electron transport proteins include CymA, MtrA, MtrB, and MtrC proteins. The hairpin structure region of the blocking gRNA (BgRNA) contains a sequence that is completely complementary to the exogenous nucleic acid molecule and a sequence that is complementary to the target site. The target site is located upstream of the specific promoter, enabling the dCas9-SoxS complex to accurately anchor and enhance the recruitment efficiency of RNA polymerase, thus achieving specific structural unlocking.

[0013] Furthermore, the proteins that take up exogenous nucleic acid molecules are comEA (recognize exogenous DNA), comEC (transmembrane DNA import), and comP (assist DNA stability).

[0014] Furthermore, the engineered bacteria are carried by Acinetobacter baylyi ADP1.

[0015] Furthermore, the exogenous nucleic acid molecule is a mutant of the KRAS, NRAS, or BRAF gene or circulating tumor DNA (ctDNA).

[0016] After binding to exogenous nucleic acid molecules, the hairpin structure of BgRNA is deconstructed to form effective gRNA, which guides the dCas9-SoxS fusion protein to specifically bind to the recognition site upstream of the target promoter, thereby activating the transcriptional expression of the CymA-MtrCAB module driven by that promoter.

[0017] The second technical solution of the present invention is to provide a method for preparing the above-mentioned engineered bacteria, which includes the following steps: (1) constructing a DNA fragment containing a blocking gRNA expression cassette, a dCas9-SoxS fusion protein expression module and a target site, a specific promoter and a CymA-MtrCAB transmembrane electron transport protein module (containing CymA, MtrA, MtrB and MtrC), and connecting ADP1 homologous arms (targeting neutral sites of the ADP1 genome) at both ends of the fragment.

[0018] The construct obtained in step 1 was added to an Acinetobacter baylyi ADP1 bacterial culture with OD600 ≈ 0.4 and incubated at room temperature for 2 hours to achieve natural transformation and homologous recombination integration.

[0019] The third technical solution of the present invention is to provide a biosensor based on the above-mentioned engineered bacteria, including a conductive substrate and engineered bacteria located on the conductive substrate; electrons generated by the engineered bacteria are output to the outside through the conductive substrate.

[0020] Furthermore, the conductive matrix is ​​a conductive interface material such as carbon nanotubes, graphene, or metal electrodes, providing an electrical signal receiving platform for the electronic output of microorganisms.

[0021] dCas9 is a Cas9 protein without nuclease activity, expressed in a fusion form with the transcription activator SoxS, forming a complex with transcriptional activation capabilities. gRNA, acting as the guide element of the CRISPRa system, binds to the target sequence in the target promoter region, guiding dCas9 to precisely locate a specific site, thereby achieving specific promoter activation. This design allows the expression of CymA-MtrCAB protein to be completely controlled by the CRISPRa system, effectively avoiding the non-specific initiation risks associated with traditional induction systems (such as IPTG, L-arabinose, etc.).

[0022] In this system, gRNA targets and binds to specific sites in the upstream regulatory region near the promoter, guiding the dCas9-SoxS complex to locate and activate the target promoter, thereby achieving promoter-dependent expression of the CymA-MtrCAB module. This promoter can drive the transcription of multi-component membrane proteins with electron transfer functions through the bacterial internal protein expression mechanism, thus significantly improving the efficiency of bacterial transmembrane electron transport.

[0023] CymA is located in the intracellular membrane and serves as a key element for electron transfer from the cytoplasm to the superoxide zone. After its expression, it works in conjunction with MtrA, MtrB, and MtrC to form a transmembrane electron transport pathway, ultimately transferring electrons generated by cell metabolism from the intracellular space to the outer membrane. Through the contact between the outer membrane protein MtrC and the conductive matrix, direct electron transport between the engineered bacteria and the external electrode is achieved, generating a stable electrochemical output signal.

[0024] The third technical solution of the present invention provides a detection method based on the above-mentioned biosensor system, comprising the following steps:

[0025] (1) The sample containing exogenous nucleic acid molecules was brought into contact with the engineered bacterial module to induce the uptake of exogenous nucleic acid molecules under normal temperature conditions;

[0026] (2) Exogenous nucleic acid molecules bind to BgRNA, deconstruct its hairpin structure, and form effective gRNA; gRNA guides dCas9-SoxS fusion protein to bind to a specific site in the upstream regulatory region of the target promoter, activating the transcription and expression of the downstream CymA-MtrCAB module;

[0027] (3) After CymA-MtrCAB is expressed, a transmembrane electron transport pathway is formed inside and outside the cell. Electrons are transported to the electrode interface through the conductive matrix and the output signal is collected by an electrochemical device.

[0028] (4) Quantitatively analyze the concentration level of the target exogenous nucleic acid molecules in the sample based on the output electrical signal.

[0029] Furthermore, the electrochemical device is a voltammeter or amperometer, used to realize real-time acquisition and intensity analysis of electronic output signals.

[0030] The advantages of this invention are:

[0031] (1) A pioneering dynamic regulatory mechanism based on blocking gRNA (BgRNA) for CRISPRa-SoxS: By constructing BgRNA with a hairpin structure, the hairpin block can be released after binding to the target exogenous nucleic acid molecule (such as tumor mutant RNA), forming an effective gRNA that guides the anchoring site of the dCas9-SoxS complex; this complex activates the transcriptional expression of the downstream CymA-MtrCAB gene module. The expressed protein achieves a highly sensitive dynamic detection pathway from exogenous nucleic acid recognition to electrical signal output via a membrane localization electron transfer mechanism mediated by heme cofactor.

[0032] (2) Using SoxS as a transcription activator, a direct transcriptional control pathway from recognition to output is established: The CRISPRa system formed by the fusion of dCas9 and SoxS can be targeted to the upstream region of the target promoter via gRNA. SoxS then directly recruits RNA polymerase to start the transcription of the CymA-MtrCAB module, establishing a direct expression regulation pathway between exogenous signal recognition and electron output, thereby improving the signal response speed and system integration.

[0033] (3) Achieving programmability and scenario expansion of the target recognition module: The BgRNA structure design has modular characteristics, and the sequence of the hairpin region can be customized according to the nucleic acid sequence to be tested, thereby adapting to different target molecules (such as KRAS, NRAS, BRAF mutants or ctDNA, etc.). This mechanism supports the rapid reconstruction and application switching of the sensing system in various detection scenarios, demonstrating good target versatility and engineering flexibility. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of the reaction in an embodiment of the present invention. Detailed Implementation

[0035] The following examples are provided to further illustrate the present invention and are intended to explain the invention, not to limit its scope. Unless otherwise specified, all figures are expressed in parts by weight and weight percentages.

[0036] The plasmid used in this application is a product already available in the art, and it is used to load the inserted gene.

[0037] Unless otherwise specified, the raw materials used in this invention are all conventional commercially available products; unless otherwise specified, the methods used in this invention are all conventional methods in the field.

[0038] The embodiments of the present invention will be further described below with reference to several examples.

[0039] It should be understood that the described embodiments are merely some, not all, of the embodiments in this application. All other embodiments obtained by those skilled in the art based on the embodiments in this application without inventive effort are within the scope of protection of this application.

[0040] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0041] Example 1

[0042] 1. Construction of biosensor bacteria:

[0043] The Acinetobacter baylyi ADP1 strain (ATCC 33305), which has natural DNA uptake capabilities, was selected as the host.

[0044] (1) Cultured in LB liquid medium at 30℃ and 250 rpm until the logarithmic growth phase (OD600 ≈0.4).

[0045] (2) Construct a DNA fragment containing a blocking gRNA expression cassette (including a hairpin structure), a dCas9-SoxS fusion protein expression module, and a CymA-MtrCAB transmembrane electron transport protein module (containing CymA, MtrA, MtrB, and MtrC), and connect approximately 1000 bp ADP1 homologous arms (targeting neutral sites in the ADP1 genome) to both ends of the fragment. Add the construct to a bacterial culture with OD600 ≈ 0.4 at a final concentration of 100 ng / μL and incubate at room temperature for 2 hours to achieve natural transformation and homologous recombination integration. The hairpin structure region of the blocking gRNA (BgRNA) contains a sequence that is completely complementary to the exogenous nucleic acid molecule (KRASG12D mutant mRNA) and a sequence that is complementary to the target site. The target site is located upstream of the promoter corresponding to the transmembrane electron transport protein gene module.

[0046] The blocking gRNA expression cassette, the dCas9-SoxS fusion protein expression module, and the DNA fragment containing the Target site, a specific promoter, and the CymA-MtrCAB transmembrane electron transport protein module (containing CymA, MtrA, MtrB, and MtrC) were all introduced via plasmids.

[0047] The sequence of the blocking gRNA expression cassette is shown in SEQ ID NO.1, and is: TTTACGGCTAGCTCAGTCCTAGGTACTATACTAGTGCTGATGGCGTAGGCAAGAGACGACTCAGCATCCGTTCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTTT.

[0048]

[0049] The target site and promoter sequence are shown in SEQ ID NO.3, specifically: AGCATTTGCGATCATTCACGCAGCGCTTATTCAGTTGCTCACTGCGATGTCATAATCATCGCTACGAGCTGTGAAAGATGCATAAAGCTCGTACGACGCGTTCGCTCGTCTCCTCACTTCTCCTACGACTCAGCATCCGTTCTCCGTCGTCTTGAAGTTGCGATTATAGA TTGAC AGCTAGCTCAGTCCTAGGGATTGTGCTAGC.

[0050]

[0051] (3) After incubation for 2 hours, the samples were plated on LB agar plates containing kanamycin (50 μg / mL) and incubated overnight at 30°C. Positive clones were identified by PCR to determine the integration site and by RT-qPCR to verify the transcriptional expression.

[0052] A sensor engineering strain (denoted as ADP1-KRAS-sensor) that can stably express the ternary module was obtained.

[0053] 2. mRNA triggering assay design:

[0054] In the target sample detection stage, the constructed ADP1-KRAS-sensor strain was exposed to a simulated body fluid environment, and a specific sequence of KRAS G12D mutant mRNA was added as a triggering factor.

[0055] The experimental system is as follows:

[0056] project Conditions and Composition Detecting bacterial cells <![CDATA[ADP1-KRAS-sensor,10 7 CFU / mL]]> culture medium <![CDATA[M9 minimal medium + 0.2% glucose + 1 mM MgSO4]]> mRNA input Synthesize KRAS G12D mutant mRNA at a final concentration of 0–100 nM. Incubation temperature and time Incubate at 37°C for 1 hour control group mRNA-free group + wild-type KRAS mRNA group (100 nM)

[0057] KRAS mutant mRNA binds to and opens the hairpin structure of blocking gRNA, restoring its ability to guide dCas9-SoxS and inducing transcription of downstream CymA-MtrCAB protein expression by a specific promoter.

[0058] 3. Electronic output and signal detection system

[0059] The CymA-MtrCAB module completes the electron transmembrane transfer process within the cell: CymA transfers metabolic electrons to MtrA within the membrane; MtrB assists in electron transmembrane transport; MtrC outputs electrons to the surface of a standard metal electrode (such as an ITO glass electrode or an Au / Pt thin film electrode); the electrode is connected to a voltammeter to collect the electrical signal output.

[0060] The experiment used a three-electrode system: the working electrode was an Au thin-film electrode; the reference electrode was Ag / AgCl; the auxiliary electrode was a Pt wire; and the electrolyte was PBS buffer (pH 7.4).

[0061] Electrochemical measurement method: Chronoamperometry (constant potential: +0.2 V), acquiring current change curves, recording time 5 minutes.

[0062] 4. Experimental Results and Performance Evaluation

[0063] Under the established system conditions (KRAS G12D mutant mRNA concentration range of 0–100 nM, reaction time of 1 hour), the electron output current of the engineered strain ADP1-KRAS-sensor on a standard metal electrode was recorded using electrochemical detection. The experimental results showed:

[0064] As the concentration of KRAS mRNA increases, the current signal gradually strengthens, and the system exhibits a good concentration response trend. The current change is approximately linear in the range of 1–100 nM, and the peak current change within the response range can reach about 5 times. The signals of the blank control group (no mRNA) and the non-specific control group (wild-type KRAS mRNA) are close to the baseline level, indicating that the system has a specific response ability to mutant sequences. The theoretical estimated limit of detection is about 0.7 nM (calculated with a signal-to-noise ratio of S / N=3), and the response time does not exceed 30 minutes. The system has good stability, and the current drift rate is less than ±10% after more than 3 repeated detections.

[0065] Comparative Example 1

[0066] Experimental conditions: The host strain was Acinetobacter baylyi ADP1 (ATCC 33305); the culture medium was LB liquid medium + kanamycin (50 μg / mL); the culture conditions were 30°C, 250 rpm, and cultured until OD600 ≈ 0.4; natural transformation was used, and DNA containing the building block (100 ng / μL) was added to the bacterial culture, incubated at room temperature for 2 hours, and then plated for selection.

[0067] Modules:

[0068] Comparative examples: representing dCas9 and SoxS respectively;

[0069] This invention employs the dCas9-SoxS fusion protein as the driving force, with the gRNA target located upstream of the cymA promoter.

[0070] mRNA trigger: KRAS G12D synthesize mutant mRNA at a concentration of 10 nM and incubate for 1 hour.

[0071] Detection platform: Three-electrode system, with a gold film (Au) as the working electrode and PBS buffer (pH 7.4).

[0072] Electrochemical detection method: Chronoamperometry, applying a voltage of +0.2 V (vs Ag / AgCl), and collecting the response current.

[0073] Construction method cymA mRNA expression level (relative) Peak response current (μA) Response time (min) Targeting and Consistency SoxS free expression 1.0±0.3 0.7±0.3 Unstable Difference (non-specific) dCas9-SoxS fusion expression 8.2 ± 0.5 5.2 ± 0.2 <30 High (gRNA targeting)

[0074] The results showed that although free SoxS had activation capabilities, it could not achieve site-specific activation of the promoter, resulting in high background expression levels and unstable responses. In contrast, the dCas9-SoxS fusion strategy adopted in this invention, with the help of gRNA targeting, can significantly enhance the expression and electronic output signal of the downstream module (cymA-MtrCAB), demonstrating good response consistency and regulatory precision.

[0075] The above embodiments describe in detail the structure, features, and effects of the present invention. The above description is only a preferred embodiment of the present invention. Any changes made in accordance with the concept of the present invention, or equivalent embodiments modified to have equivalent changes, shall still fall within the scope of protection of the present invention if they do not exceed the scope covered by the specification.

Claims

1. An engineered bacterium, characterized in that, It possesses: proteins that take up exogenous nucleic acid molecules; the proteins that take up exogenous nucleic acid molecules are ComEA, ComEC, and ComP proteins; The engineered bacteria consist of a dCas9-SoxS fusion protein and a blocking gRNA (BgRNA) linked to the dCas9-SoxS fusion protein. The BgRNA unblocks the hairpin structure by binding to exogenous nucleic acid molecules, guiding the dCas9-SoxS fusion protein to target a specific promoter and initiate the transcription of transmembrane electron transport proteins. These transmembrane electron transport proteins include CymA, MtrA, MtrB, and MtrC proteins. The hairpin region of the blocking gRNA (BgRNA) contains a sequence completely complementary to the exogenous nucleic acid molecule and a sequence complementary to the target site, which is located upstream of the specific promoter. The engineered bacteria use Acinetobacter baylyi ADP1 as a vector.

2. The engineered bacteria according to claim 1, characterized in that, The exogenous nucleic acid molecule is a mutant of the KRAS, NRAS, or BRAF gene or circulating tumor DNA (ctDNA).

3. The method for preparing engineered bacteria as described in claim 1, characterized in that, It includes the following steps: (1) Construct a DNA fragment containing a blocking gRNA expression cassette, a dCas9-SoxS fusion protein expression module, and a CymA-MtrCAB transmembrane electron transport protein module containing a target site, a specific promoter, and composed of CymA, MtrA, MtrB and MtrC, and connect ADP1 homologous arms at both ends of it. (2) Add the gene obtained in step 1 to the Acinetobacter baylyi ADP1 bacterial culture and incubate at room temperature for 2 hours to achieve natural transformation and homologous recombination integration.

4. A biosensor based on the engineered bacteria of claim 1, characterized in that, It includes a conductive substrate and engineered bacteria located on the conductive substrate; electrons generated by the engineered bacteria are output to the outside through the conductive substrate.

5. The biosensor according to claim 4, characterized in that, The conductive substrate is carbon nanotubes, graphene, or a metal electrode.

Citation Information

Patent Citations

  • Method for improving extracellular electron transfer by engineering modification of shewanella vesicles

    CN116004690A

  • Genetic manipulation method in bacteria

    US20230340440A1