Application of OsDS1 gene in creating waterlogging-resistant rice germplasm suitable for direct seeding by genetic engineering method

Abstract

The invention relates to the field of bioengineering, and discloses application of an OsDS1 gene in creating a water-flooding-resistant rice germplasm suitable for direct seeding through a genetic engineering method. The invention firstly discovers that the rice shikimic acid synthetic route starting enzyme coding gene OsDS1 is related to the water logging resistance and direct seeding suitability of rice. On the basis, the OsDS1 is used as a target gene, the expression quantity of the gene is increased through transgenosis or gene editing and other methods so as to create a new rice germplasm, the germplasm has the characteristic that coleoptiles rapidly extend after germination in a water-flooded or non-water-flooded state, and then the direct seeding suitability of the rice is improved.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to an application of an OsDS1 gene in creating flood-resistant and direct-seeding rice germplasm using a genetic engineering method. Background Art

[0002] The shikimate pathway is a core metabolic pathway for the biosynthesis of aromatic amino acids, such as phenylalanine (Phe), tyrosine (Tyr), and tryptophan (Trp), in plants, algae, fungi, and some microorganisms. This pathway consists of seven enzyme-catalyzed reactions. The initial step, catalyzed by 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (DAHPS, known as DHS in Arabidopsis thaliana), involves the condensation of phosphoenolpyruvate (PEP), the end product of the glycolysis pathway, with erythrose-4-phosphate (E4P), the end product of the pentose phosphate pathway, to form 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP) and inorganic phosphate, laying the foundation for the synthesis of aromatic amino acids. DAHPSs are divided into two unrelated types, type I and type II, whose sequence identity is less than 10%. Higher plants such as Arabidopsis, sorghum, and rice belong to type II DAHPS. Arabidopsis has three type II DHS enzymes, AthDHS1, 2, and 3. AthDHS1 has been biochemically characterized as a recombinant protein and has been shown to be resistant to Mn. 2+AthDHS2 is strictly dependent on cofactors and reducing conditions (dithiothreitol, DTT). Tyr and Trp inhibit AthDHS2, but not AthDHS1 or AthDHS3. Mixing AthDHS2 with AthDHS1 or 3 attenuates its inhibitory effect. BY1 (Biomass Yield 1) encodes a DAHPS in sorghum, affecting sorghum biomass and grain yield. There are at least two DAHPS enzymes in rice, OsDAHPS1 and OsDAHPS2. A study by Wang Huimei et al. (Wang, H., Shi, Y., Zhang, X., Xu, X., & Wu, JL (2020). Characterization of a Novel Rice Dynamic Narrow-Rolled Leaf Mutant with Deficiencies in Aromatic AminoAcids. International journal of molecular sciences, 21(4), 1521.) showed that DNRL1 encodes DAHPS, which plays a key role in leaf morphogenesis by mediating the biosynthesis of rice amino acids. Although the DAHPS enzyme has been preliminarily characterized in rice, its specific function remains to be further studied.

[0003] In direct-seeded rice cultivation, submergence tolerance and rapid coleoptile elongation are key factors for achieving efficient production. Rice responds to flooding stress through two strategies: a quiescent strategy and an escape strategy. The quiescent strategy mainly relies on the submergence tolerance locus SUBMERGENCE 1 (SUB1), which involves hormone signaling interactions between jasmonic acid (JA), auxin (IAA), ethylene, gibberellin (GA) and brassinosteroids (BR), conserving carbohydrates by restricting the elongation of the aboveground part until the waterlogging damage is relieved. In contrast, the escape strategy relies on rapid coleoptile elongation in the early stages of seed germination. As a tubular tissue formed before the first leaf appears, the coleoptile determines the maximum depth suitable for sowing. Under flooding conditions, rapid coleoptile elongation can help seedlings reach the water surface to obtain oxygen, thereby supporting the subsequent development of leaves and roots.

[0004] Several genes have been shown to be involved in accelerating coleoptile elongation. For example, trehalose-6-phosphate phosphatase (OsTPP7) enhances rice tolerance to anaerobic germination by elongating the coleoptile. Variation in calcineurin B subunit-like protein 10 (OsCBL10) affects coleoptile length and seedling survival under flooding conditions. The 14-3-3 protein OsGF14h acts as a regulatory switch, enhancing flooding tolerance by increasing coleoptile length by balancing abscisic acid (ABA) and GA signaling. The uridine diphosphate glucosyltransferase OsUGT75A modifies ABA and JA by glycosylation, thereby reducing free ABA and JA levels and promoting submerged germination and coleoptile elongation. The ethylene signaling regulator ETHYLENE INSENSITIVE 3-LIKE 1 / 2 (OsEIL1 / 2) induces the expression of reactive oxygen species scavenging genes, thereby promoting coleoptile elongation and inhibiting its radial expansion. Furthermore, the peroxisomal CA-CoA ligases OsCNL1 / 2 involved in salicylic acid (SA) biosynthesis are significantly induced during deep water immersion. Elevated SA triggers a GH3-dependent auxin conjugation reaction, alleviating the inhibitory effect of IAA on germination. Despite these advances, the specific mechanisms of IAA- and JA-mediated rice coleoptile elongation remain to be further investigated.

[0005] As the impact of climate change on rice production intensifies and extreme precipitation events increase, direct-seeding rice cultivation faces even more severe challenges from flooding. In direct-seeding rice cultivation, flooding tolerance has become a key factor in improving rice yield and adaptability, directly related to the stability of rice cultivation and farmers' economic benefits. Rapid coleoptile elongation is a key ability for rice to break through the water surface, obtain oxygen, and maintain normal growth in a flooded environment. This process is regulated by multiple factors, among which plant hormones play a central role. Therefore, in-depth research on the molecular mechanisms of rice flooding tolerance, especially the plant hormone regulatory mechanisms, is of great significance for rice variety improvement.

[0006] At the same time, applying plant hormone regulation mechanisms to cultivate new rice germplasms that are tolerant to flooding and suitable for direct seeding is crucial for ensuring global food security, optimizing agricultural planting structures, and promoting sustainable agricultural development. Amidst a growing global population, a stable food supply is fundamental to human development. New rice germplasms that are tolerant to flooding and suitable for direct seeding can effectively reduce yield losses caused by flooding, providing strong support for increasing grain production. Regarding planting structures, these new germplasms can adapt to a wider range of growing environments, expand rice cultivation areas, and improve land utilization, particularly in flood-prone areas. From the perspective of sustainable agricultural development, these new germplasms reduce the cost of reseeding due to flooding, minimize the waste of agricultural resources, and reduce the use of chemical pesticides, thus helping to protect the ecological environment and achieve green agricultural development. Summary of the Invention

[0007] To address the above-mentioned technical problems, the present invention provides a method for using the OsDS1 gene in genetically engineering rice germplasms to create flooding-tolerant and direct-seeding-suitable rice. This invention, for the first time, discovered that the gene encoding the initial enzyme in the rice shikimate biosynthesis pathway, OsDS1, is associated with flooding tolerance and direct-seeding suitability. Based on this, the present invention utilizes OsDS1 as a target gene, increasing its expression through transgenic or gene editing methods to create new rice germplasms characterized by rapid coleoptile elongation after germination, whether in flooded or non-flooded conditions, thereby improving rice suitability for direct-seeding.

[0008] The specific technical solutions of the present invention are: In a first aspect, the present invention provides an application of the OsDS1 gene in improving rice flooding tolerance or direct seeding suitability: improving rice flooding tolerance or direct seeding suitability by overexpressing the DAHPS2 protein in rice. The full-length cDNA nucleotide sequence of the OsDS1 gene is shown in SEQ ID NO: 1.

[0009] The present invention cloned a dwarf male sterility gene, OsDS1, in rice, encoding the DAHPS2 protein. The present invention discovered for the first time that increasing the expression of OsDS1 in rice allows for rapid coleoptile elongation after germination, whether in submerged or non-submerged conditions. This, in turn, improves the tolerance of rice to direct seeding at both normal and low temperatures, and enhances direct seeding efficiency.

[0010] Furthermore, the nucleotide sequence of the complete gene expression unit of the OsDS1 gene is shown in SEQ ID NO: 2.

[0011] In a second aspect, the present invention provides an artificially modified OsDS1 gene capable of highly expressing DAHPS2 protein in rice: based on the nucleotide sequence of the complete gene expression unit of the OsDS1 gene as shown in SEQ ID NO: 2, the number of regulatory elements DS1-7 (ATAGATACGA) is increased.

[0012] The transcription factor OsDS1PR1 positively regulates OsDS1 expression by binding to the DS1-7 element in the OsDS1 promoter. This study utilizes precision editing technology to modify the structure and number of DS1-7 elements in the OsDS1 promoter to create a novel, exogenous, and superior rice germplasm with high OsDS1 expression. This germplasm, like OsDS1-overexpressing rice, improves flooding tolerance and direct seeding suitability.

[0013] Preferably, the artificially modified OsDS1 gene has a nucleotide sequence of one of SEQ ID NOs: 4-6.

[0014] In a third aspect, the present invention provides the use of the artificially modified OsDS1 gene in improving the flooding tolerance or direct seeding suitability of rice: the flooding tolerance or direct seeding suitability of rice is improved by overexpressing the DAHPS2 protein in rice.

[0015] In a fourth aspect, the present invention provides a vector for overexpressing the OsDS1 gene, wherein the vector contains a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 4-6.

[0016] Preferably, the vector is obtained by using pCAMBIA1300-GFP-FLAG as the basic vector, and inserting the nucleotide sequence shown in SEQ ID NO: 1 between the KpnI restriction site of the basic vector; or using ePE2 (pHUC411-cMYL-PEmaxNC) as the basic vector, and modifying DS1-7 in the promoter sequence of SEQ ID NO: 2 to contain the nucleotide sequence shown in SEQ ID NO: 4-6.

[0017] In a fifth aspect, the present invention provides a host cell containing an OsDS1 gene, wherein the host cell contains the nucleotide sequence shown in SEQ ID NO: 1.

[0018] In a sixth aspect, the present invention provides the use of the above-mentioned OsDS1 gene or the artificially modified OsDS1 gene in creating a new rice germplasm with the characteristics of flooding resistance and suitable for direct seeding: using the OsDS1 gene having the nucleotide sequence shown in SEQ ID No: 1-2 as the target gene, the expression level of the OsDS1 gene is increased by genetic modification or gene editing, thereby obtaining a new rice plant with the characteristics of flooding resistance and suitable for direct seeding.

[0019] Preferably, an overexpression vector containing the nucleotide sequence shown in SEQ ID No: 1 or SEQ ID No: 2 is transformed into rice cells, thereby obtaining new rice plants that are resistant to flooding and suitable for direct seeding.

[0020] Furthermore, the transformation method is to transform the vector into Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice.

[0021] In the seventh aspect, the present invention provides a method for improving the characteristics of rice resistant to flooding and suitable for direct seeding: a gene having a nucleotide as shown in SEQ ID No: 1 or SEQ ID No: 2 is used as a target gene, and the expression level of the gene is increased by genetic modification or gene editing, thereby improving the characteristics of rice resistant to flooding and suitable for direct seeding.

[0022] Preferably, the number of OsDS1 gene regulatory elements DS1-7 (ATAGATACGA) in the nucleotide sequence shown in SEQ ID No: 2 can be increased by precise editing technology to achieve the purpose of high expression of the OsDS1 gene.

[0023] In a specific experiment, the present invention provides a precision editing vector containing the above-mentioned gene OsDS1 regulatory element DS1-7 (ATAGATACGA), and uses the pHUC411-cMYL-PEmaxNC (ePE2) precision editing system as the basic vector to construct the ePE2-DS1-7X3 vector and transform it into the indica rice variety "Huazhan" to obtain precision editing rice without exogenous components.

[0024] Compared to existing technologies, the present invention has the following beneficial effects: It is the first to discover that the gene encoding the initial enzyme in the rice shikimate biosynthesis pathway, OsDS1, is associated with rice's waterlogging tolerance and suitability for direct seeding. Based on this, the present invention utilizes OsDS1 as a target gene, increasing its expression through transgenic or gene editing methods to create new rice germplasm. This new germplasm exhibits the characteristic of rapid coleoptile elongation after germination, whether in submerged or non-submerged conditions, thereby improving rice's suitability for direct seeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figures show the phenotypes of the rice dwarf sterile mutant ds1 and the wild type at the germination, seedling, and maturity stages; among them: (A) is the phenotype of the wild type and mutant at the germination stage; (B) is the phenotype of the wild type and mutant at the seedling stage; (C) is the close-up root phenotype of the wild type and mutant at the seedling stage; (D) is the phenotype of the wild type and mutant at the maturity stage; (E) is the close-up leaf phenotype of the wild type and mutant at the maturity stage; (F) is the close-up panicle phenotype of the wild type and mutant at the maturity stage; (G) is the close-up spikelet and anther iodine staining phenotype of the wild type and mutant at the maturity stage.

[0026] Figure 2 Schematic diagram of the location and mutation site of the OsDS1 gene; wherein: (A) is the preliminary location map of the OsDS1 gene on rice chromosome 7; (B) is the fine location map of the OsDS1 gene; (C) is the candidate gene analysis and mutation site analysis map of the OsDS1 gene location interval; (D) is the gDNA genome level mutation site sequence analysis map of the OsDS1 gene in the wild type and mutant; (E) is the cDNA genome level mutation site sequence analysis map of the OsDS1 gene in the wild type and mutant; (F) is the protein level mutation site sequence analysis map of the OsDS1 gene in the wild type and mutant.

[0027] Figure 3The complementation map and phenotype of the OsDS1 gene; among them: (A) is the map of the complementation vector pCAMBIA1300-DS1; (B) is the phenotype of T2 transgenic rice plants in the functional complementation experiment, from left to right are the wild type, mutant and mutant transgenic strain transformed with the complementation vector.

[0028] Figure 4 Schematic diagram of the OsDS1 knockout target sequence and phenotype; where: (A) is a schematic diagram of the OsDS1 knockout target sequence; (B) is a sequence diagram of the wild plant OsDS1cas1 containing the Cas9 / sgRNA structure. The 20nt target sequence of the Cas9 / sgRNA complex is marked in blue, and the PAM site is marked in orange. For the DNA sequence mutated by Cas9 / sgRNA, the inserted nucleotides are shown in green, and the deleted nucleotides are shown as red dashed lines; (C) is a sequence diagram of the wild plant OsDS1cas2 containing the Cas9 / sgRNA structure. The 20nt target sequence of the Cas9 / sgRNA complex is marked in blue, and the PAM site is marked in orange. For the DNA sequence mutated by Cas9 / sgRNA, the deleted nucleotides are shown as red dashed lines; (D) is a phenotype diagram of mature plants containing mutant OsDS1Cas9 / sgRNA structures, with the wild type and three mutant plants from left to right.

[0029] Figure 5 Figure 2 is the overexpression map and phenotype of the OsDS1 gene; (A) is the map of the overexpression vector pCAMBIA1300-GFP-FLAG-DS1; (B) is the phenotype of the T2-overexpressing transgenic rice plants during the germination period, from left to right: the wild type and three overexpressing lines; (C) is the coleoptile length of the wild type and T2-overexpressing transgenic rice plants during the germination period; (D) is the radicle length of the wild type and T2-overexpressing transgenic rice plants during the germination period.

[0030] Figure 6The waterlogging phenotype and low-temperature waterlogging phenotype of OsDS1 overexpressing plants; (A) is the phenotype of wild-type and overexpressing T2-positive transgenic rice plants after 10 days of 5 cm waterlogging; (B) is the coleoptile length of wild-type and overexpressing T2-positive transgenic rice plants after 10 days of 5 cm waterlogging; (C) is the phenotype of wild-type and overexpressing T2-positive transgenic rice plants after 18 days of 15℃+5 cm waterlogging; (D) is the phenotype of wild-type and overexpressing T2-positive transgenic rice plants after 15℃+5 cm waterlogging Coleoptile length after 18 days; (E) Germination rate of wild-type and overexpressing T2-positive transgenic rice plants after 18 days of flooding at 15℃+5cm; (F) Phenotype of wild-type and overexpressing T2-positive transgenic rice plants after 36 days of flooding at 15℃+5cm; (G) Coleoptile length of wild-type and overexpressing T2-positive transgenic rice plants after 36 days of flooding at 15℃+5cm; (H) Germination rate of wild-type and overexpressing T2-positive transgenic rice plants after 36 days of flooding at 15℃+5cm.

[0031] Figure 7 The field flooding phenotypes and temperature changes of OsDS1 overexpressing plants; among them: (AI) are the phenotypes of wild-type and overexpressing T2-positive transgenic rice plants after 0, 1, 14, 16, 17, 18, 19, 20, and 23 days of 5 cm flooding in the field in Lingshui County, Hainan Province; (J) is the temperature change diagram of the field in Lingshui County, Hainan Province after 24 days of 5 cm flooding.

[0032] Figure 8 The figures show the results of the positive regulation of OsDS1 expression by the transcription factor OsDS1PR1; wherein: (A) is a schematic diagram of the bimolecular luciferase vector; (B) is a diagram showing the results of bimolecular luciferase transformation into protoplasts; (C) is a diagram showing the results of bimolecular luciferase transformation into tobacco; (D) is a schematic diagram of the sequence of the OsDS1PR1 binding site OsDS1-7 on the OsDS1 promoter; (E) is a schematic diagram and results of the yeast one-hybrid vector; (F) is a diagram showing the results of the gel shift assay; (G) is a diagram showing the results of bimolecular luciferase transformation into protoplasts, 1-248bp is the core promoter region of OsDS1, and CK is pGreen0800-LUC+OsDS1PR1GFP; (H) is a diagram showing the results of bimolecular luciferase transformation into protoplasts, OsDS1PR1 is a positive regulatory factor of OsDS1, and CK is pGreen0800-LUC+OsDS1PR1GFP.

[0033] Figure 9The modified sequence diagram of OsDS1 promoter and its expression level and flooding treatment phenotype; wherein: (A) is the precise editing sequence diagram of OsDS1-7ePE2, with the target sequence highlighted in blue, the replaced nucleotides shown in red, and the deleted nucleotides shown in green dashed lines; (B) is the relative expression level of OsDS1 in the wild type and six independent DS1-7X3 edited plants without exogenous components; (C) is the phenotype of the wild type and three independent DS1-7X3 edited plants without exogenous components after 5 cm flooding for 8 days; (D) is the coleoptile length of the wild type and three independent DS1-7X3 edited plants without exogenous components after 5 cm flooding for 8 days; (E) is the germination rate of the wild type and three independent DS1-7X3 edited plants without exogenous components after 5 cm flooding for 8 days. DETAILED DESCRIPTION

[0034] The present invention will be further described below with reference to the embodiments.

[0035] Overall embodiment In a first aspect, the present invention provides an application of the OsDS1 gene in improving rice flooding tolerance or direct seeding suitability: improving rice flooding tolerance or direct seeding suitability by overexpressing the DAHPS2 protein in rice. The full-length cDNA nucleotide sequence of the OsDS1 gene is shown in SEQ ID NO: 1.

[0036] Furthermore, the nucleotide sequence of the complete gene expression unit of the OsDS1 gene is shown in SEQ ID NO: 2.

[0037] In a second aspect, the present invention provides an artificially modified OsDS1 gene capable of highly expressing DAHPS2 protein in rice: based on the nucleotide sequence of the complete gene expression unit of the OsDS1 gene as shown in SEQ ID NO: 2, the number of regulatory elements DS1-7 (ATAGATACGA) is increased.

[0038] Preferably, the artificially modified OsDS1 gene has a nucleotide sequence of one of SEQ ID NOs: 4-6.

[0039] In a third aspect, the present invention provides the use of the artificially modified OsDS1 gene in improving the flooding tolerance or direct seeding suitability of rice: the flooding tolerance or direct seeding suitability of rice is improved by overexpressing the DAHPS2 protein in rice.

[0040] In a fourth aspect, the present invention provides a vector for overexpressing the OsDS1 gene, wherein the vector contains a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 4-6.

[0041] Preferably, the vector is obtained by using pCAMBIA1300-GFP-FLAG as the basic vector, and inserting the nucleotide sequence shown in SEQ ID NO: 1 between the KpnI restriction site of the basic vector; or using ePE2 (pHUC411-cMYL-PEmaxNC) as the basic vector, and modifying DS1-7 in the promoter sequence of SEQ ID NO: 2 to contain the nucleotide sequence shown in SEQ ID NO: 4-6.

[0042] In a fifth aspect, the present invention provides a host cell containing an OsDS1 gene, wherein the host cell contains the nucleotide sequence shown in SEQ ID NO: 1.

[0043] In a sixth aspect, the present invention provides the use of the above-mentioned OsDS1 gene or the artificially modified OsDS1 gene in creating a new rice germplasm with the characteristics of flooding resistance and suitable for direct seeding: using the OsDS1 gene having the nucleotide sequence shown in SEQ ID No: 1-2 as the target gene, the expression level of the OsDS1 gene is increased by genetic modification or gene editing, thereby obtaining a new rice plant with the characteristics of flooding resistance and suitable for direct seeding.

[0044] Preferably, an overexpression vector containing the nucleotide sequence shown in SEQ ID No: 1 or SEQ ID No: 2 is transformed into rice cells, thereby obtaining new rice plants that are resistant to flooding and suitable for direct seeding.

[0045] Furthermore, the transformation method is to transform the vector into Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice.

[0046] In the seventh aspect, the present invention provides a method for improving the characteristics of rice resistant to flooding and suitable for direct seeding: a gene having a nucleotide as shown in SEQ ID No: 1 or SEQ ID No: 2 is used as a target gene, and the expression level of the gene is increased by genetic modification or gene editing, thereby improving the characteristics of rice resistant to flooding and suitable for direct seeding.

[0047] Preferably, the number of OsDS1 gene regulatory elements DS1-7 (ATAGATACGA) in the nucleotide sequence shown in SEQ ID No: 2 can be increased by precise editing technology to achieve the purpose of high expression of the OsDS1 gene.

[0048] In a specific experiment, the present invention provides a precision editing vector containing the above-mentioned gene OsDS1 regulatory element DS1-7 (ATAGATACGA), and uses the pHUC411-cMYL-PEmaxNC (ePE2) precision editing system as the basic vector to construct the ePE2-DS1-7X3 vector and transform it into the indica rice variety "Huazhan" to obtain precision editing rice without exogenous components.

[0049] More specifically, the specific technical steps for implementing the present invention are as follows: 1. Isolation and genetic analysis of the rice dwarf sterile mutant dsl: The rice dwarf sterile mutant dsl in the present invention is a mutation produced by EMS (Ethyl Methyl Sulfonate) in the rice super rice excellent restorer line indica rice variety Huazhan ( Figure 1 Through backcrossing experiments with wild-type rice, it was shown that the ds1 mutant was controlled by a recessive single gene.

[0050] 2. Map-based cloning of the OsDS1 gene that controls dwarf sterility in rice: 1) Preliminary localization of the OsDS1 gene: To isolate the OsDS1 gene, the present invention first constructed a mapping population by crossing ds1 with the japonica rice variety Wuyunjing No. 7 (Japonica), self-pollinating the F1 generation, and preparing the F2 generation mapping population. Mutant plants were selected from the mapping population, and the OsDS1 locus was preliminarily located by positional cloning using molecular markers such as STS and SSR. The locus was preliminarily located at the end of the long arm of chromosome 7, between markers C998-78 and C998-3. Figure 2 A.

[0051] 2) Fine mapping and prediction of the OsDS1 gene: By analyzing the BAC sequence between markers C998-78 and C998-3, new SSR and STS markers were developed to precisely locate OsDS1 within the 58-kb range between markers C998-20 and C998-1 on BAC B1056G08. Figure 2 B), analyze the open reading frame (ORF) of this segment to speculate the candidate gene, sequence the entire mapping interval, and clarify the mutation mode of the candidate gene. The sequencing results showed that there was a single base substitution (G1407C) in the 5th exon of LOC_Os07g42960 in ds1, resulting in an amino acid change (M469I) ( Figure 2 CF).

[0052] 3) Identification and functional validation of the OsDS1 gene: To verify the function of candidate genes, Figure 3The complementary vector shown in A was introduced into the hybrid ds1 by transgenic technology. The results showed that the present invention obtained a transgenic rice that restored the mutant to a normal phenotype ( Figure 3 B). In addition, the inventors also designed two knockout target sites (cas1, cas2), and after knocking out these two target sites in the Nipponbare background, they obtained knockout materials with different mutation patterns. The phenotype of the knockout materials was similar to that of ds1 ( Figure 4 The results showed that the OsDS1 gene was cloned correctly, and the amino acid sequence analysis showed that OsDS1 encodes DAHPS2, the initiator of shikimate biosynthesis.

[0053] Three applications of OsDS1 gene: In order to further explore the application scenarios of the OsDS1 gene, the inventors constructed Figure 5 The overexpression vector shown in A was used to obtain DS1 gene overexpression plants through rice Agrobacterium transformation technology ( Figure 5 B) The elongation rates of coleoptile and radicle of OsDS1 overexpressing plants during germination were significantly higher than those of wild type ( Figure 5 C, D), water flooding and low temperature water flooding experiments proved that the present invention obtained water flooding resistant rice plants suitable for direct seeding ( Figure 6 AH). Field flooding experiments further demonstrated that high expression of OsDS1 can increase the elongation rate of rice coleoptiles after germination under low temperature and flooding conditions, thereby improving the direct seeding emergence rate ( Figure 7 AJ). Bimolecular luciferase assay, yeast one-hybrid assay and gel shift assay demonstrated that OsDS1PR1 binds to the OsDS1 promoter DS1-7 (ATAGATACGA) ( Figure 8 AF), the inventors subsequently determined that -1 to -248 contained the core promoter region of OsDS1 through Luciferase experiments ( Figure 8 G), further experiments found that as the number of repeats of OsDS1PR1 binding site DS1-7 increased, the LUC / REN ratio increased linearly ( Figure 8 H), indicating that OsDS1PR1 is a positive regulatory factor of OsDS1, promoting the expression of OsDS1. By modifying the OsDS1 promoter with precise editing technology, an OsDS1-edited plant without exogenous components was created ( Figure 9 A), qRT-PCR results showed that the expression level of OsDS1 in these editing-positive plants was significantly increased ( Figure 9 B) After flooding, the coleoptiles of these gene-edited germplasms rapidly elongated ( Figure 9 C, D), the germination rate increased significantly ( Figure 9E), indicating that this germplasm has great application prospects in the breeding of new varieties suitable for direct seeding, and provides important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.

[0054] The present invention utilizes the rice dwarf sterile mutant ds1, whose related gene encodes a protein that mainly affects the elongation rate of the coleoptile after rice germination. The present invention cloned the OsDS1 gene in rice through map-based cloning technology, which encodes the DAHPS2 protein, the initiator enzyme of the shikimic acid synthesis pathway. Overexpression of OsDS1 significantly improves the direct seeding and flooding tolerance of rice. In addition, the present invention also demonstrated that OsDS1PR1 positively regulates the expression of OsDS1 through bimolecular luciferase experiments, yeast one-hybrid experiments and gel migration experiments, and modified the OsDS1 promoter regulatory element DS1-7 (ATAGATACGA) through precise editing technology to create edited plants without exogenous components, providing important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.

[0055] In summary, the present invention utilized the rice dwarf sterile mutant ds1 and cloned the OsDS1 gene, encoding the DAHPS2 protein, the initiator of the shikimic acid biosynthesis pathway, in rice through map-based cloning technology. This demonstrated for the first time that the OsDS1 gene is involved in flooding tolerance in rice. It was also discovered for the first time that overexpression of OsDS1 can significantly improve the direct seeding and flooding tolerance of rice. Furthermore, the present invention demonstrated for the first time through bimolecular luciferase assays, yeast one-hybrid assays, and gel shift assays that OsDS1PR1 positively regulates the expression of OsDS1. Furthermore, by modifying the OsDS1 promoter through precision editing technology, the present invention created for the first time a new direct seeding rice germplasm with high OsDS1 expression and no exogenous components, providing important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.

[0056] Specific Examples and Comparative Examples Example 1: 1. Rice materials: The rice (Oryza sativa L.) mutant ds1 was originally derived from the wild indica rice variety "Huazhan (HZ)".

[0057] The rice seedling dwarf sterile mutant ds1 was derived from a mutation induced by EMS in Huazhan (e.g. Figure 1 The mutant was obtained in Zhejiang Province, China.

[0058] The mutagenesis method is specifically as follows: soaking rice seeds in 1.5% EMS for 8 hours, rinsing with clean water and germinating normally; selecting the extreme dwarf mutant ds1 in the M1 generation, and using ds1 heterozygous plants for population construction and gene mapping after stable inheritance for multiple generations.

[0059] 2. Analysis and Localization Population: Plants heterozygous for the ds1 mutant were crossed with the japonica rice variety Wuyunjing No. 7. The F1 generation was self-pollinated to create an F2 generation localization population. From this population, 2,100 ds1 mutant plants were selected as the localization population. Approximately 1 gram of young leaves from each plant at the three-leaf stage were collected for total DNA extraction.

[0060] 3. Localization of OsDS1 gene using SSR and STS markers Genomic DNA for gene mapping was extracted from rice leaves using a rapid rice trace DNA extraction method. Approximately 0.2 g of rice leaves were frozen in liquid nitrogen, ground into a powder in a 5 cm diameter mortar, and transferred to a 1.5 ml centrifuge tube for DNA extraction. The resulting DNA precipitate was dissolved in 150 μl of ultrapure water. 2 μl of DNA sample was used for each PCR reaction.

[0061] Preliminary localization of the OsDS1 gene: Twenty-one recessive individuals were selected from an F2 population derived from a combination of heterozygous ds1 mutant plants and the japonica rice variety Wuyunjing 7. Based on a molecular genetic map created using published japonica and indica rice genome data, SSR primers were selected that were approximately evenly distributed on each chromosome. PCR amplification was performed under known reaction conditions. PCR products were separated by 5% agarose gel electrophoresis and stained with ethidium bromide (EB) to detect polymorphisms. OsDS1 was preliminarily localized between two STS markers, C998-78 and C998-3, on the long arm of chromosome 7 (e.g., Figure 2 (as shown in A).

[0062] Note: The 21 recessive individuals in the F2 population of the combination of the above-mentioned ds1 mutant heterozygous plants and the japonica rice variety Wuyunjing No. 7 are included in the 2100 mutant plants. The present invention first uses 21 plants for preliminary positioning, and then expands the population to 2100 plants for fine positioning and gene cloning.

[0063] Fine mapping of the OsDS1 gene: A total of 2100 recessive mutant individuals were selected from the F2 population of ds1 mutant heterozygous plants combined with the japonica rice variety Wuyunjing 7. Based on the initial positioning, SSR and STS markers were further designed, and finally OsDS1 was precisely located within a 58-kb range on BAC number B1056G08 ( Figure 2 B), the molecular markers on both sides are C998-20 and C998-1, and the primer sequences are: C998-20: F: TTCAAGCTTCACAAGGAGACTAAA; R: TCATGGAATCAATCCAGCAT; C998-1: F: GAAGCCATCAGCTGCCTAGT; R: ACCGGTGTGGACGAAGGT.

[0064] Note: Primer sequences are shown in Table 1.

[0065] Table 1. Location marker sequences of OsDS1 gene Marke Primers(5'to3') Sense Anti-sense B7-12 TCAAGGTCGACATGTTAGGTATGC AACCCTATCACCTGAGAAACATCC B7-13 ACAGTATCCAAGGCCCTGG CACGTGAGACAAAGACGGAG B7-14 TGGAAGTTTCCTGGCGATAG TGGTTGGACTGAAAAGTCCC C998-1 GAAGCCATCAGCTGCCTAGT ACTCGGTGTGGACGAAGGT C998-3 GCTGAACCAGCAGCCTTTAC CCCAGATCATTGCCTCTGTT C998-4 TTTGATTCAGTTAAATGCTTTCAT CTGCATTCGCTTTTCCTTCT C998-10 GTCCTGCTTTGGGCAGTAAA TGGCAAAACCACATAAATCG C998-20 TTCAAGCTTCACAAGGAGACTAAA TCATGGAATCAATCCAGCAT C998-22 TGATCTACCTGCCCAACTGA TGGCCAATTGTTTTGACCTA C998-23 TTGGCTGACAGATTTACGAATG TGATTGCACTTAAAATGGAACG C998-25 CTTGCAATGCTAGGTGTTTTT CAATTCACACGTACAAAAACCA C998-43 TGGAATTATCTGGTTGCCAAG CCGTTGAACAACAACAGCAC C998-45 GTTTTCCGCCCAAAACTGTA CGATCTGATGAGCACGTTTTT C998-64 CTGCTCCGATTCTTGAGACC GACCACGTCGAGCTTCTCC C998-66 GAAGCGCACGTATTCCTAGC GCAGCTAATCAGCAATTGACC C998-74 GGATGGGGTGATGGGAAC CGTCATGGACCACGGAATA C998-78 TTGACAGCATTGCCATAGGA TCCCTTGTTGATTCACGGTAG 4. Gene prediction and comparative analysis: According to the results of fine mapping, a total of 6 candidate genes were found within the 58-kb interval ( Figure 2 C). Based on the number of recombinants on both sides of the mapping interval, sequencing primers for each gene were designed. Candidate genes were amplified from the genomes of ds1 and wild-type varieties using PCR and sequenced. A single base substitution (G1407C) was found in the fifth exon of LOC_Os07g42960 in ds1, resulting in an amino acid change (M469I) ( Figure 2 DF). Three replicates were performed using different mutant plants and plants with mutant phenotypes within the population, and the mutation site was found to be stable (see Table 2 for sequencing primer sequences). Based on the gene annotation information for BAC number B1056G08, this gene is predicted to encode phospho-2-dehydro-3-deoxyheptonate aldolase, a chloroplast precursor putative, expressing the DAHPS2 protein, an initiator of the shikimate biosynthesis pathway. This gene, named OsDS1, is 3239 bp long and contains five exons and four introns. The rice OsDS1 gene shares 90% homology with the sorghum and maize protein genes.

[0066] The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 3 in the sequence listing.

[0067] The cDNA of the gene is shown as SEQ ID NO: 1, and the gDNA is shown as SEQ ID NO: 2.

[0068] Table 2. Sequencing primer sequences of OsDS1 gene Example 2: Plant transformation: Using the genome of the indica rice variety "Huazhan" as a template, primers were designed according to the target gene: 42960COMF-5'-tatgaccatgattacgaattcGGAAGCTAAGCTAAGGAGTAGGAGAA-3' 42960COMR-5'-ccgggtaccgagctcgaattcTATTGGGTTGGTCCGGTCTCA-3'.

[0069] The PCR amplification system was as follows: 50 μL PCR reaction system: template DNA 2 μL; 2× PCR buffer 25 μL; 2 mmol dNTP (Roche) 10 μL; KODFX (TOYOBO) enzyme 1 μL; 10 μM Primer F 3 μL; 10 μM Primer R 3 μL; ddH2O 6 μL; PCR amplification conditions were: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 4 min for a total of 35 cycles; extension at 68°C for 10 min, and insulation at 15°C.

[0070] Note: The genome of the indica rice variety "Huazhan" was used as a template.

[0071] After PCR amplification, electrophoresis separation was performed to recover a DNA fragment of 6988 bp. pCAMBIA1300 (p1300) was digested with EcoRI and homologous recombination was performed to obtain the complementary vector pCAMBIA1300-DS1. This clone covers the entire genomic region of the ORF (i.e., contains the nucleotide sequence shown in SEQ ID No: 2), as well as a 2749-bp promoter sequence upstream of the ATG and a 1000-bp terminator sequence downstream of the TAA (e.g., Figure 3 (as shown in A).

[0072] This plasmid was transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice. The inventors used mature seeds of mutant heterozygous plants to induce callus tissue. After culturing on an induction medium for 3 weeks, vigorously growing calli were selected as recipients for transformation. Rice calli were infected with the EHA105 strain containing a binary plasmid vector. After co-cultivation in the dark at 25°C for 3 days, they were cultured on a screening medium containing 300 mg / L hygromycin. Resistant calli were selected and cultured on a pre-differentiation medium containing 250 mg / L hygromycin for about 10 days. The pre-differentiated calli were transferred to a differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about a month. Plant identification and continuous observation found that compared with mutants of the same period, the growth state of the transgenic plants returned to normal.

[0073] Through the above transgenic technology, the results showed that the present invention obtained transgenic rice that restored the mutant to normal phenotype ( Figure 3 B).

[0074] Note: The formulas of the various culture media mentioned above can be found in Toki S., Hara N., Ono K., Onodera H., Tagiri A., Oka S., Tanaka H. (2006) Early infection of scutellum tissue with Agrobacterium allows high-speed transformation of rice. The Plant Journal 47: 969-976.

[0075] Example 3: OsDS1 gene function verification: According to the prediction in the Rice Genome Annotation Project (RGAP, https: / / www.ricedata.cn / gene / index.htm), OsDS1 (LOC_Os07g42960) encodes phospho-2-dehydro-3-deoxyheptonate aldolase, chloroplast precursor, putative, expressed, 5 exons and 4 introns, with a gDNA length of 3239 bp and a cDNA length of 1614 bp. To further verify whether the DS1 mutation is the main cause of the ds1 mutant phenotype, the inventors designed two target sequences (cas1, cas2) on the second exon of DS1 ( Figure 4 A), the target sequence primer sequence is: gR1tF-cas1-5'-gcaTTCATGGATCACAGCGAACAgttttagagctagaaatagcaagttaaaataag-3'; tR1tR-cas1-5'-TGTTCGCTGTGATCCATGAATGCACCAGCCGGGAATCGAAC-3'; gR1tF-cas2-5'-gcaTACAGGGGAGACAACATCAAgttttagagctagaaatagcaagttaaaataag-3'; tR1tR-cas2-5'-TTGATGTTGTCTCCCCTGTATGCACCAGCCGGGAATCGAAC-3'.

[0076] After knocking out these two target sites in the Nipponbare background using CRISPR / Cas9 technology, knockout materials with different mutation patterns were obtained. The phenotype of the knockout materials was similar to that of ds1 ( Figure 4 BD).

[0077] These results indicate that mutation of the OsDS1 gene is the main cause of the ds1 mutant phenotype.

[0078] Note: The CRISPR / Cas9 gene editing vector pCAR2-Cas9 mentioned above was provided by Liu Yaoguang's research group at South China Agricultural University.

[0079] Example 4: Obtaining OsDS1 overexpression lines: 1. Amplification of target fragment 1 μL of cDNA reverse-transcribed from Nipponbare total RNA was used as the amplification template, along with 25 μL of 2× Kod FX DNA polymerase buffer, 8 μL of 2 mM dNTPs, 1 μL of Kod FX DNA polymerase (Toyobo), 3 μL of 10 mM DS1-GFPF (tttaaacaagagctcggtaccATGGCGCTCGCCACCAAC), 3 μL of 10 mM DS1-GFPR (gctcaccatggatccggtaccGAAAGCCAATGGGGGCAA), and 9 μL of sterile water. The final amplification system was 50 μL. After mixing, the following program was run on a PCR instrument: 98℃, 10min; 98°C, 30s; 60°C, 30s; 72°C, 2min; 35 cycles; 72°C, 10 min; store at 4°C. Separate on 1% agarose gel and recover the target fragment of 1611 bp.

[0080] 2. Enzyme digestion of target vector The target vector pCAMBIA1300-GFP-FLAG was digested with KpnI (Takara) using the following digestion system: 5 μL of 10× H buffer, 10 μL of pCAMBIA1300-GFP-FLAG vector, 2 μL of KpnI, 33 μL of sterile water, and 50 μL of the final digestion system. Digestion was carried out at 37°C for 2 hours. The digestion products were separated on a 1% agarose gel and recovered.

[0081] 3. Construction of OsDS1 overexpression vector The fragment recovered in step 1 was ligated into the destination vector recovered in step 2 by homologous recombination. The recombination system was as follows: 8 μL of PCR product; 2 μL of pCAMBIA1300-GFP-FLAG vector recovered by enzyme digestion; 4 μL of 5×CE II Buffer; II 2 μL; sterile water 4 μL; final system 20 μL; ligation at 37°C for 1 hour. Except for the target fragment and expression vector pCAMBIA1300-GFP-FLAG, all other reagents were purchased from Nanjing Novozymes (ClonExpress-II One Step Cloning Kit).

[0082] 10 μL of the ligation product was added to 50 μL of freshly thawed DH5α competent cells, mixed gently, placed on ice for 30 minutes, heat-shocked at 42°C for 45 seconds, and allowed to stand on ice for 2 minutes. 500 μL of antibiotic-free LB was then added and the cells were placed in a 37°C constant temperature shaker at 170 rpm. After one hour of recovery, a Kan-resistant plate was coated. Five white colonies were selected and positive clones were identified by colony PCR using DS1-GFPF / R as primers. The PCR product was 1611 bp in size. Two positive clones were selected and shaken for sequencing. The sequencing primers were s65tF: TTGATGTGGGTTTTACTGATGC and s65tR: GGGAAGCAAATTCTGAACCA. The OsDS1 green fluorescent fusion expression vector pCAMBIA1300-GFP-FLAG-DS1 ( Figure 5 A). The original source of pCAMBIA1300-GFP-FLAG vector is: Ren D, Li Y, Zhao F, Sang X, Shi J, Wang N, Guo S, Ling Y, Zhang C, Yang Z, HeG.MULTI-FLORET SPIKELET1, which encodes an AP2 / ERF protein.determines spikeletmeristem fate and sterile lemma identity in rice.Plant Physiol. 2013;162(2):872-884.

[0083] 4. OsDS1 overexpression vector transformation The constructed pCAMBIA1300-GFP-FLAG-DS1 vector plasmid was transferred into the Agrobacterium tumefaciens strain EHA105 by electroporation to transform rice. The inventors used mature seeds of the indica rice variety "Huazhan" to induce callus tissue. After 3 weeks of culture on the induction medium, the vigorously growing calli were selected as the recipients of the transformation. The rice callus was infected with the EHA105 strain containing the binary plasmid vector, and after co-cultivation for 3 days in the dark and 25°C, it was cultured on a screening medium containing 300mg / L hygromycin. The selected resistant calli were cultured on a pre-differentiation medium containing 250mg / L hygromycin for about 10 days. The pre-differentiated calli were transferred to the differentiation medium and cultured under light conditions. Resistant transgenic plants were obtained in about a month. Identification and continuous observation of the germination period of the overexpression plants found that compared with the wild type of the same period, the elongation rate of the coleoptile and radicle of the transgenic overexpression positive plants was faster ( Figure 5 BD).

[0084] The primer sequences for identifying OsDS1 overexpressing plants are: DS1-OE identification 1F-5'-TTACAAGAATGGGGGCAGAG-3' DS1-OE identification 1R-5'-ACGTTCTGCCCAGTCATTTC-3' DS1-OE identification 2F-5'-CGCCTGGTTCTTCTTTTTCA-3' DS1-OE identified 2R-5′-CAGCTATCCACCGTCCACTT-3′.

[0085] Through the above transgenic technology, the results showed that the present invention has obtained transgenic rice that makes the coleoptile elongation speed of normal plants faster ( Figure 5 BD).

[0086] Example 5: Overexpression of OsDS1 can significantly improve the submergence tolerance of plants: 1. OsDS1 overexpressing plants showed excellent flooding tolerance in the laboratory The inventors conducted a flooding experiment on the wild-type indica rice variety "Huazhan" and OsDS1 overexpression (DS1-OE) plants under laboratory conditions. 300 mature seeds of Huazhan and three OsDS1 overexpression lines were placed in a transparent glass bottle with 5 cm of distilled water. The bottles were then placed in a 26°C incubator with 14 hours of light and 10 hours of darkness. After 10 days of incubation, photographs were taken and coleoptile lengths were measured. This experiment was repeated three times. The results showed that under 5 cm of water, DS1-OE exhibited excellent flooding resistance ( Figure 6 A, B).

[0087] 2. OsDS1 overexpression in plants can still improve flooding tolerance at low temperatures Considering that rice is mostly exposed to relatively low ambient temperatures during direct seeding, which can inhibit rice germination and growth, the inventors subjected DS1-OE to a cold-stress flooding treatment. 200 mature seeds of Huazhan and three OsDS1 overexpression lines were placed in transparent glass bottles with 5 cm of distilled water. The seeds were then placed in a 15°C incubator with 14 hours of light and 10 hours of darkness. After 18 and 36 days of incubation, photographs were taken and the coleoptile length and germination conditions were measured. The results showed that under 15°C treatment and 5 cm of flooding, DS1-OE still had better flooding tolerance than the wild type, with significantly higher coleoptile length and germination rates than the wild type ( Figure 6 CH).

[0088] 3. OsDS1 overexpressing plants showed excellent flooding tolerance in the field The inventors conducted flooding experiments on the wild-type indica rice variety "Huazhan" and OsDS1 overexpressing plants under natural field conditions. A field experiment was conducted in Lingshui County, Hainan Province. The field seedling board was 10.5m long and 0.8m wide, with a total of 4 seedling boards. The surrounding area was ridged with soil and covered with a film to prevent water seepage. 150g of mature seeds of Huazhan and three OsDS1 overexpressing strains were taken and dry-sown in the field. The seeds were then patted into the soil to prevent them from being washed away by water. The next day, after the seeds absorbed water, they were poured with about 5cm of water and continued to be flooded for 23 days before being photographed. The results showed that DS1-OE did have a faster elongation speed and uniform emergence than the wild type under flooding conditions ( Figure 7 AI). At the same time, Hainan was at a low temperature of around 15°C for nearly half of the time during the flood live broadcast. Figure 7 J).

[0089] In summary, overexpression of OsDS1 can significantly improve the plant's flooding tolerance and flooding tolerance in low temperature environments.

[0090] Note: The flooding tests mentioned above are all continuous flooding, and the flooding condition is maintained at about 5 cm after the seeds are sown.

[0091] Example 6: Precision editing of the OsDS1 promoter regulatory element DS1-7 yielded a new rice germplasm suitable for direct seeding: 1. Transcription factor OsDS1PR1 positively regulates OsDS1 expression In order to find the transcription factors that regulate the expression level of OsDS1, the inventors used the PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) website to predict the transcription factors and binding sites of OsDS1. Through luciferase (dual luciferase) experiments, a possible transcription factor LOC_Os01g67770 ( Figure 8 A, B). The dual-luciferase vector plasmid was transiently transformed into Nicotiana benthamiana leaves via Agrobacterium tumefaciens-mediated transformation and incubated in the dark at 28°C for 48 hours. The fluorescence signal was observed using a low-light cooled imaging device (Tanon 5200). The results also confirmed that LOC_Os01g67770 bound to the OsDS1 promoter ( Figure 8 C). Yeast one-hybrid assays further demonstrated that the transcription factor LOC_Os01g67770 binds to the predicted OsDS1 binding site DS1-7 (OsDS1 promoter -226 to -248 bp, element sequence ATAGATACGA) ( Figure 8 D, E), EMSA (gel shift) experiments also confirmed this result ( Figure 8 F). This indicates that LOC_Os01g67770 binds to OsDS1. Since LOC_Os01g67770 has not yet been cloned, the inventors named it OsDS1PR1 (DS1 positive regulator 1).

[0092] The inventors subsequently determined through Luciferase experiments that OsDS1 promoter -1 to -232 bp contains the core promoter region of OsDS1 ( Figure 8 G), further experiments found that as the number of repeats of OsDS1PR1 binding site DS1-7 increased, the LUC / REN ratio increased linearly ( Figure 8 H), indicating that OsDS1PR1 is a positive regulator of OsDS1 and promotes the expression of OsDS1.

[0093] The specific experimental method is: 1) Luciferas experiment (transfection into protoplasts): a) Vector construction: The promoter regions 232 bp, 647 bp upstream of the ATG start codon of OsDS1, DS1-7 (ATAGATACGA), DS1-7X2, DS1-7X3, DS1-7+232 bp, DS1-7X2+232 bp, DS1-7X3+232 bp, and 2700 bp were cloned into the KpnI / SPEI double restriction site upstream of the LUC reporter gene of the pGreen0800-LUC vector to obtain OsDS1. pGreen0800-LUC expression vectors: pDS1-232-LUC, pDS1-248-LUC, pDS1-647-LUC, pDS1-7-LUC, pDS1-7X2-LUC, pDS1-7X3-LUC, pDS1-7+232-LUC, pDS1-7X2+232-LUC, pDS1-7X3+232-LUC, pDS1-LUC. Primer sequences are shown in Table 3. The cDNA reverse-transcribed from Nipponbare total RNA was used as the amplification template, and the amplification primer sequences were OsDS1PR1-GFPF (cttctgcaggagctcggtaccATGGACGCCACCGCCTTC) and OsDS1PR1-GFPR (gctcaccatggatccggtaccGGATGATGCAAAGAGACATTCATC). A 1746 bp OsDS1PR1 target fragment was obtained and recombined into KpnI-digested pCAMBIA1300-GFP-FLAG to obtain the OsDS1PR1 green fluorescent fusion expression vector pCAMBIA1300-GFP-FLAG-OsDS1PR1.

[0094] Table 3. Primer sequences for vector construction b) Rice protoplast extraction and vector transformation: (1) Chop the stems and leaves of 15-day-old rice 9311 seedlings with a sharp blade on a plastic petri dish and transfer them to a clean 200 ml conical flask (generally, 20 ml of enzymatic hydrolysate is used for about 60 plants at a time; the enzymatic hydrolysate should be poured into the flask in advance and distributed according to the size of the flask bottom). Do not put too much into each flask. Incubate in a shaker at 28°C, 70 rpm, for 5 hours.

[0095] (2) Before the enzymatic hydrolysis time is completed, prepare a 40% solution of PEG4000 and dissolve it in a 65°C water bath. Take it out and shake it once in the middle.

[0096] (3) After the enzymatic hydrolysis is completed, add 15 ml of W5 to the bottle where the enzymatic hydrolysis is completed. Use a 200-mesh steel filter to filter out the broken leaves and use a clean plastic culture dish to collect the protoplasts after the enzymatic hydrolysis. Then slowly pour the protoplasts into (or use a pipette tip without the tip) a 50 ml centrifuge tube. After weighing and balancing, place the tube in a horizontal centrifuge at 150 g for 5 minutes to fully collect the protoplasts. After centrifugation, slowly aspirate the supernatant.

[0097] (4) Add 1 ml of W5 solution to the protoplast pellet, slowly and gently tilt to mix and resuspend, then pipette into a 2 ml centrifuge tube using a pipette tip. At this point, there may still be a small amount of unsuspended protoplasts in the 50 ml centrifuge tube. Add another 1 ml of W5 to dissolve them, pipette into the original 2 ml centrifuge tube, and centrifuge at 150 g for 3 min. Remove the supernatant.

[0098] (5) Resuspend with MMG, add 1200 μl of MMG to resuspend, and then dispense into 2 ml centrifuge tubes, with 100 μl per tube.

[0099] (6) Prepare about 10 μg of transformation plasmids (pCAMBIA1300-GFP-FLAG, pCAMBIA1300-GFP-FLAG-OsDS1PR1, pDS1-232-LUC, pDS1-248-LUC, pDS1-647-LUC, pDS1-7-LUC, pDSl-7X2-LUC, pDSl-7X3-LUC, pDSl-7+232-LUC, pDS1-7X2+232-LUC, pDS1-7X3+232-LUC, pDSl-LUC) in a 2 ml centrifuge tube.

[0100] (7) Add 100 μl of resuspended protoplasts, then add 110 μl of 40% PEG and mix well.

[0101] (8) Incubate at 28°C in the dark for 15 minutes.

[0102] (9) Add sufficient W5 to dilute, mix thoroughly, and then centrifuge at 150g for 3 minutes. Slowly remove the supernatant and wash once more with W5 (there will be some loss during this process, but it will not affect the results). Resuspend the resulting pellet in W5 (fill a 2ml tube), mix gently, and transfer to a cell culture plate. Wrap in tin foil and incubate at 28°C in the dark for 14 hours.

[0103] (10) After the incubation time is complete, gently mix the precipitated protoplasts in each well of the culture plate, pipette them into a 2 ml tube, and then centrifuge at 150 g for 3 min. Remove the supernatant and retain about 100 μl of supernatant to resuspend the protoplasts.

[0104] c) Luciferase assay: According to the Dual- The Reporter Assay System kit (Cat. No. E1910) was operated according to the instructions, and the LUC / REN value was measured using an Aomega Gloma fluorometer to calculate the relative LUC activity.

[0105] 2) YIH experiment: a) Vector Construction: The promoter regions 232-248 bp (OsDS1-7), 647 bp, 647-2700 bp, and 2700 bp upstream of the ATG start codon of OsDS1 were cloned into the SalI restriction site of the pLacZi vector to generate the OsDS1 pLacZi expression vectors pLacZi-DS1-7, pLacZi-DS1-647, pLacZi-DS1-647-2700, and pLacZi-DS1-2700. Primer sequences are shown in Table 3. The cDNA reverse-transcribed from Nipponbare total RNA was used as the amplification template, and the amplification primer sequences were OsDS1PR1-pB42ADF (TATGCCTCTCCCGAATTCATGGACGCCACCGCCTTC) and OsDS1PR1-pB42ADR (CTCGAGTCGGCCGAATTCTCAGGATGATGCAAAGAGACATTC), obtaining a 1746 bp OsDS1PR1 target fragment, which was recombined into the EcoRI-digested pB42AD vector to obtain the expression vector pB42AD-OsDS1PR1.

[0106] b) Yeast assay: pLacZi-DS1-7, pLacZi-DS1-647, pLacZi-DS1-647-2700, pLacZi-DS1-2700, and pB42AD-OsDS1PR1 were transformed into the EGY48 strain according to the Coolaber Super Yeast Competence Preparation and Transformation Kit (Cat. No. SK2401-200T) and SD / -Trp / -Ura with Agar (Cat. No. PM2262-10X0.5L). Cultures were taken and photographed after 2 days of incubation at 30°C.

[0107] 3) EMSA experiments: a) Vector construction: cDNA reverse-transcribed from Nipponbare total RNA was used as the amplification template. The amplification primer sequences were OsDS1PR1-1302bp-His-F (CTGTATTTTCAGGGCCATATGAGTTTTGAGGGACTGGA) and OsDS1PR1-His-R (ACGGAGCTCGAATTCGGATCCTCAGGATGATGCAAAGAG). A 1302bp OsDS1PR1 target fragment excluding the N-terminal 453bp was obtained. The fragment was then recombined into the BamHI / NedI double-digested PET-28a-His vector to obtain the OsDS1PR1 protein expression vector PET-28a-His-OsDS1PR1.

[0108] b) Biotin probe synthesis: Biotin-labeled and non-biotin-labeled probes were synthesized at Zhejiang Shangya Biotechnology Co., Ltd. The primer sequences were: Biotin-OsDS1PR1-pDS1-7-F (GGTCATATAGATACGAAGAAA) and Biotin-OsDS1PR1-pDS1-7-R (TTTCTTCGTATCTATATGACC).

[0109] c) EMSA experiment: Follow the instructions of the DIG Gel Shift Kit (Roche, cat. no. 03353591910). The probe primer was denatured at 95°C for 10 minutes, slowly cooled to 15°C and diluted to a concentration of 100 fmol / μL, then mixed with 100 ng of purified protein and incubated at room temperature for 30 minutes. The sample was placed on a native polyacrylamide gel (6.5%) in 0.5XTBE buffer (45 mM Tris, 45 mM boric acid, and 1 mM EDTA). After electrophoresis at 400 mA for 30 minutes, it was immediately cross-linked with UV for 5 minutes. The membrane was then incubated in blocking solution and DIG antibody solution for 30 minutes each. After thorough washing, the CSPD working solution was applied to the membrane and observed and photographed using a low-light cooled CCD imaging device (Tanon 5200).

[0110] 2. Create new direct-seeding rice germplasm with high expression of OsDS1 and no exogenous components The inventors' results have shown that high expression of OsDS1 can improve the flooding tolerance of rice. Combined with the positive regulation of OsDS1PR1 on OsDS1, and with the increase in the number of repeats of the OsDS1PR1 binding site DS1-7 (ATAGATACGA), the LUC / REN ratio increases linearly ( Figure 8 H), the inventors identified DS1-7 as an ideal modification site and modified the OsDS1 promoter. First, the inventors used the precision editing ePE2 system to edit DS1-7.

[0111] The specific experimental method is as follows: According to the operation method of pHUC411-cMYL-PEmaxNC (ePE2) precision editing system of Wang Kejian's research group, the editing primer sequences are designed as follows: DS1-7X3-PE2-g++(TGCATAAAGTATCTTTTCCAAGTCGTTTC); DS1-7X3-PE2-g--(CTCTGAAACGACTTGGAAAAGATACTTTA); DS1-7X3-RP-PE2-F(GTGCttcgtatctatTCGTATCTATTCGTATCTAtgacctgacttggaaaagataGAACATTT); DS1-7X3-RP-PE2-R(TCAAAAATGTTCtatcttttccaagtcaggtcatATAGATACGAATAGATACGAatagatacgaa).

[0112] The reaction system consisted of 10 μL each of DS1-7X3-PE2-g++ and DS1-7X3-PE2-g (10 μM); 5 μL of T4 DNA ligase buffer; 1 μL of T4 PNK; and 24 μL of sterile water. The final volume was 50 μL. After mixing, the mixture was incubated at 37°C for 1 hour, followed by the addition of 2.5 μL of 1M NaCl. The reaction was performed in a 95°C PCR machine for five seconds, followed by natural annealing for 3 hours. The PCR machine was then turned off and the temperature was allowed to cool naturally to obtain the target fragment. The target fragment was then recombined into pHUC411-cMYL-PEmaxNC (ePE2) digested with BsaI to generate the precise editing vector ePE2-DS1-7X3. The ePE2-DS1-7X3 vector was then transformed into the indica rice variety "Huazhan."

[0113] The inventors envisioned repeating the binding site DS1-7 three times, but the actual editing method they obtained did not repeat DS1-7 three times, but instead resulted in three different editing methods. The first editing method was to repeat DS1-7 once, that is, the promoter sequence of DS1 itself was edited after the original DS1-7, and the "AGAAA" next to DS1-7 was edited into the first half of DS1-7, "ATAGA", and then the next three bases (CTA) were deleted. The subsequent "TACGA" was the second half of DS1-7. In this editing method, DS1-7 was repeated once, and the corresponding editing-positive plant was DS1-7X3-1 (SEQ ID NO: 4). The second editing method was to replace a single base (C replaced by A) after the first editing method, and the corresponding editing-positive plant was DS1-7X3-2 (SEQ ID NO: 5). The third editing method is to replace three bases after the first editing method, "ACT replaced by TAG", which is equivalent to the first half of DS1-7 "ATAGA", that is, DS1-7 repeated once and a half. The corresponding editing-positive plant is DS1-7X3-3,4,5,6 (SEQ ID NO: 6) ( Figure 9 A). qRT-PCR results showed that the expression level of OsDS1 in these editing-positive plants was significantly increased ( Figure 9 B), qRT-PCR primers are pOsDS1F (GACTCCGTGCTCAAGACGAT), pOsDS1R (TTGTTGGCGTTGAACTCCTT). After flooding treatment, these edited plants without exogenous components also showed strong flooding tolerance ( Figure 9 C), after 8 days of flooding with 5 cm water, the coleoptile length and germination rate were significantly higher than those of the wild type ( Figure 9 D, E), indicating that this germplasm has great application prospects in the breeding of new varieties suitable for direct seeding, and provides important molecular targets and germplasm resources for the genetic improvement of crop stress tolerance.

[0114] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0115] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.

Claims

1. OsDS1 The application of the gene in improving the waterlogging tolerance or direct seeding suitability of rice is characterized by: Improve rice's waterlogging tolerance or direct seeding suitability by overexpressing the DAHPS2 protein in rice; described OsDS1 The full-length cDNA nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: described OsDS1 The nucleotide sequence of the complete gene expression unit of the gene is shown in SEQ ID NO:

2.

3. Artificial modification of rice to overexpress DAHPS2 protein OsDS1 A gene characterized by: In the case of SEQ ID NO: 2 OsDS1 Add regulatory elements to the nucleotide sequence of the complete gene expression unit of the gene DS1-7 The number of.

4. The artificial modification according to claim 3 OsDS1 A gene characterized by: It has a nucleotide sequence of any one of SEQ ID NOs: 4-6.

5. The artificial modification according to claim 3 or 4 OsDS1 The application of the gene in improving the waterlogging tolerance or direct seeding suitability of rice is characterized by: Overexpression of DAHPS2 protein in rice can improve the flooding tolerance or direct seeding suitability of rice.

6. An overexpression OsDS1 A gene vector, characterized in that: The vector contains a nucleotide sequence as shown in any one of SEQ ID NOs: 1, 4-6.

7. A OsDS1 A host cell for a gene, characterized in that: The host cell contains the nucleotide sequence shown in SEQ ID NO:

1.

8. The use according to claim 1 or 2 OsDS1 Gene or artificial modification according to claim 3 or 4 OsDS1 The application of the gene in creating new rice germplasm with flooding resistance and direct seeding suitability is characterized by: With the nucleotide sequence shown in SEQ ID No: 1-2 OsDS1 Genes are target genes, which are enhanced by transgenic or gene editing. OsDS1 The expression level of the gene was controlled, thereby obtaining new rice plants with the characteristics of waterlogging resistance and direct seeding suitability.

9. A method for improving the flooding resistance and direct seeding suitability of rice, characterized by: A gene having a nucleotide sequence as shown in SEQ ID No: 1 or SEQ ID No: 2 is used as a target gene, and the expression level of the gene is increased by genetic modification or gene editing, thereby improving the waterlogging resistance and direct seeding suitability of rice.

10. The use according to claim 8 or the method according to claim 9, characterized in that: By adding the nucleotide sequence shown in SEQ ID No: 2 OsDS1 Gene regulatory elements DS1-7 The number of OsDS1 The purpose of high gene expression.

Images