Application of wheat receptor-like protein kinase TaHDRLK-1D1 gene in regulation and control of heading stage of plant
By mining and utilizing the wheat receptor protein kinase TaHDRLK-1D1 gene, and regulating the wheat heading stage through overexpression or knockout, the problem of insufficient gene resources in the existing technology is solved, precise regulation of the wheat heading stage is achieved, and wheat yield and stress resistance are improved.
Patent Information
- Application Number
- CN202510719246.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-08-19
AI Technical Summary
The existing technology has insufficient genetic resources in regulating the wheat heading period, insufficient functional analysis and utilization of genetic diversity, making it difficult to effectively deal with the problem of yield reduction caused by extreme weather.
The wheat receptor protein kinase TaHDRLK-1D1 gene was mined and used to regulate the plant heading stage through overexpression or knockout, and gene editing was used to achieve delay or advancement of the heading stage.
It provides candidate genes to regulate the wheat heading period, help cultivate new crop varieties that adapt to different ecological environments, and improve wheat yield stability and stress resistance.
Smart Images

Figure CN120505355A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and more particularly to application of wheat receptor protein kinase TaHDRLK-1D1 gene in regulating the heading period of plants. Background Art
[0002] Wheat heading stage is a key breeding target trait, closely linked to the growth period and directly influencing many agronomic traits, including yield, disease resistance, and stress tolerance. Wheat plants during this period are particularly sensitive to external factors, such as temperature, light, and humidity. With climate change and the emergence of extreme weather, the adverse effects of temperature on wheat heading are becoming increasingly severe. Extreme weather conditions, such as late spring frosts, during the jointing and heading stages can severely damage wheat growth (Gao Zhenxian et al., 2023). Late spring frosts significantly impact wheat ear differentiation, flower bud differentiation, and grain setting, resulting in earless, white, incomplete, and green ears, ultimately leading to yield reductions. Depending on the severity of frost damage, yield reductions range from 10% to 30%. In my country, strong-gluten wheat varieties generally have poor resistance to late spring cold weather. Studies have found that the strong-gluten wheat varieties Fengdecun No. 5 and Zhengmai 366 will have 77.0% and 81.3% frozen ear rates when encountering late spring cold weather, resulting in a sharp decline in wheat yield and quality (Ou Xingqi et al., 2020; Qin Maomao et al., 2021).
[0003] Wheat heading period is a complex agronomic trait that is influenced by a variety of external environmental factors as well as the genetics of the crop itself. An appropriate heading period will help wheat avoid potential natural disasters. In addition to cloning several key vernalization and photoperiod genes, researchers have also located multiple major and minor loci, enriching the genetic regulatory network of wheat heading period (Liu Chunyi et al., 2023). However, existing genetic resources still have significant deficiencies in functional analysis, utilization of genetic diversity, development of molecular markers, application of gene editing technology, and translation into breeding practice. Therefore, identifying key genes that regulate wheat heading period and analyzing their mechanisms of action, as well as creating mutants and screening for superior allelic variants, are of great significance for precisely regulating wheat heading period to cope with extreme weather hazards and ensure high and stable wheat yields.
[0004] References:
[0005] Gao Zhenxian, Cao Qiao, Shan Zilong, Fu Xiaoyi, Han Ran, He Mingqi, Shi Zhanliang, et al. Preliminary study on the impact of late spring cold on 323 winter wheat germplasm resources. Crop Journal, 2023, 1: 86-93.
[0006] Ou Xingqi, Li Lu, Li Xinhua, Wang Dengdi, Wang Zijuan, Ouyang Juan, Liu Yuanhai. Analysis of late spring cold tolerance traits of strong-gluten wheat varieties. Seed, 2020, 39:137-141.
[0007] Qin Maomao, Liu Yanxi, Zhang Kun, Zhao Mengqi, Zhou Zhengfu, Wu Zhengqing, Chen Feng, et al. Effects of late spring cold on the quality of high-quality strong-gluten wheat variety Zhengmai 366. Henan Agricultural Sciences, 2021, 50: 42-48.
[0008] Liu Chunyi, Yang Qian, Zhang Yixiao, Zhang Xiangfen, Zhang Bingyang, Shi Chaonan, Zhao Lei, et al. Research progress on genetic regulation of wheat heading period. Journal of Triticum Crop Science, 2023, 43: 992-997. Summary of the Invention
[0009] In view of this, the present invention provides the use of the wheat receptor protein kinase TaHDRLK-1D1 gene in regulating the heading period of plants.
[0010] The wheat receptor protein kinase TaHDRLK-1D1 gene is derived from common hexaploid wheat (Triticum aestivum L.).
[0011] In order to achieve the above object, the present invention adopts the following technical solutions:
[0012] Application of the wheat receptor protein kinase TaHDRLK-1D1 gene in regulating the heading period of plants, wherein the nucleotide sequence of the TaHDRLK-1D1 gene is shown in SEQ ID No. 1;
[0013] Or a nucleotide sequence with a homology of more than 90% to the nucleotide sequence of SEQ ID No. 1, and encoding the amino acid as shown in SEQ ID No. 3.
[0014] Those skilled in the art can readily mutate the nucleotide sequence of the TaHDRLK-1D1 of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 90% or greater identity with the nucleotide sequence of the TaHDRLK-1D1 of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the TaHDRLK-1D1 protein of the present invention and have the same protein function.
[0015] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 90% or greater identical to a nucleotide sequence encoding a protein consisting of the amino acid sequence set forth in SEQ ID No. 3 of the present invention. Identity can be assessed using DNAMAN software. Using DNAMAN software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess identity between related sequences.
[0016] Use of a protein or a substance that regulates the expression of a gene encoding the protein in regulating the heading period of a plant,
[0017] The amino acid sequence of the protein is shown in SEQ ID No. 3;
[0018] or a protein having the same function as that obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 3;
[0019] Or a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus in the above two cases.
[0020] The protein having the same function as the amino acid sequence of SEQ ID No. 3, wherein one or more amino acid residues are substituted and / or deleted and / or added, is a protein having the same function as the amino acid sequence of the protein of SEQ ID No. 3, and is derived from wheat and has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity to the amino acid sequence of the protein of SEQ ID No. 3. Identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search, the amino acid sequence identity is calculated, and the identity value (%) can be obtained.
[0021] In the above proteins, the 95% or greater homology may be at least 96%, 97%, 98%, or 99% identity. The 90% or greater homology may be at least 91%, 92%, 93%, or 94% identity. The 85% or greater homology may be at least 86%, 87%, 88%, or 89% identity. The 80% or greater homology may be at least 81%, 82%, 83%, or 84% identity.
[0022] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0023] The gene encoding the protein having the same function as the amino acid sequence of SEQ ID No. 3, wherein one or more amino acid residues are substituted, deleted, or added, can be obtained by deleting the codons for one or more amino acid residues from the DNA sequence of SEQ ID No. 2, and / or performing missense mutations of one or more base pairs, and / or attaching a tag to the coding sequence at its 5′ and / or 3′ end. The DNA molecule of SEQ ID No. 2 encodes the protein of SEQ ID No. 3.
[0024] Use of the above-mentioned gene or a biological material related to the above-mentioned protein in regulating the heading period of a plant, wherein the biological material is any one of the following:
[0025] A: nucleotide sequence such as the nucleic acid molecule described above or the nucleic acid molecule encoding the protein described above;
[0026] B: expression cassette containing the nucleic acid molecule described in A;
[0027] C: an expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B;
[0028] D: A recombinant microorganism containing the nucleic acid molecule described in A, or a recombinant microorganism containing the expression cassette described in B, or a recombinant microorganism containing the recombinant vector described in C.
[0029] In the above application, the expression cassette described in B refers to a DNA capable of expressing TaHDRLK-1D1 in a host cell, and the DNA may include not only a promoter for initiating transcription of the TaHDRLK-1D1 encoding gene, but also a terminator for terminating transcription of the TaHDRLK-1D1 encoding gene.
[0030] Existing expression vectors can be used to construct a recombinant vector containing the TaHDRLK-1D1 gene expression cassette. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment.
[0031] In the above application, the vector may be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid may be a pWMB110 vector or a pWMB110-Cas9 vector.
[0032] The recombinant vector in B can specifically be pWMB110::TaHDRLK-1D1. The pWMB110::TaHDRLK-1D1 recombinant vector is obtained by inserting the TaHDRLK-1D1 gene shown in SEQ ID No. 2 into the pWMB110 vector, and pWMB110::TaHDRLK-1D1 can express the TaHDRLK-1D1 protein shown in SEQ ID No. 3.
[0033] In the above applications, the microorganism may be yeast, bacteria, algae or fungi, wherein the bacteria may be Agrobacterium.
[0034] Furthermore, the plant is wheat.
[0035] Furthermore, regulating the heading period of the plant is to delay or advance the heading period of the plant.
[0036] Furthermore, overexpression of the TaHDRLK-1D1 gene can delay the heading period of plants; knockout of the TaHDRLK-1D1 gene can advance the heading period of plants.
[0037] It can be seen from the above technical solutions that, compared with the prior art, the present invention has the following beneficial effects:
[0038] The present invention discloses the amino acid sequence of TaHDRLK-1D1 protein as shown in SEQ ID No.3. Experiments have shown that overexpression strains of the TaHDRLK-1D1 encoding gene can delay the heading period of wheat; knocking out the TaHDRLK-1D1 encoding gene using the CRISPR / Cas9 system can advance the heading period of wheat. The present invention provides candidate genes for cultivating new crop varieties that are adaptable to different ecological environments by exploring key genes that regulate the heading period of wheat. At the same time, it has important theoretical and practical significance for understanding the formation of crop heading period and related yield traits. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0040] Figure 1 This is the PCR amplification result of the TaHDRLK-1D1 gene in Example 1 of the present invention. Different bands represent different annealing temperatures.
[0041] Figure 2 The expression levels of the TaHDRLK-1D1 gene in Example 2 of the present invention at different developmental stages and in different tissue locations of wheat;
[0042] Figure 3 This is the PCR identification result of TaHDRLK-1D1 transgenic wheat in Example 3 of the present invention;
[0043] Figure 4The identification results of the TaHDRLK-1D1 transgenic wheat PAT / BAR gold-labeled rapid immune detection kit in Example 3 of the present invention;
[0044] Figure 5 The transgenic wheat overexpressing TaHDRLK-1D1 in Example 3 of the present invention delays wheat heading, wherein A represents the phenotypic identification of the heading period of the wild type WT and the TaHDRLK-1D1 gene overexpression lines; B represents the transcription level detection results of TaHDRLK-1D1 in the wild type and transgenic lines OE-1, OE-2 and OE-3; C represents the heading time statistics of the wild type WT and the TaHDRLK-1D1 gene overexpression lines;
[0045] Figure 6 This is the CRISPR / Cas9 gene knockout of TaHDRLK-1D1 in Example 4 of the present invention, wherein A represents a schematic diagram of the target site of sgRNA; the black boxes in the gene model represent the exon region of TaHDRLK-1D1; the black short lines represent the intron region of TaHDRLK-1D1; the red arrows represent the target sites, and the PAM and sgRNA target sites are represented by red and black fonts, respectively; B represents a PCR-RE detection diagram of the mutant, 1: PCR amplification product of wild-type ZM7698, 2: PCR amplification product of wild-type ZM7698 digested with Nco I, 3-17: PCR amplification products of transgenic plants digested with Nco I; C represents the Sanger sequencing peak diagram of the homozygous mutant;
[0046] Figure 7 The TaHDRLK-1D1 knockout line in Example 4 of the present invention promotes wheat heading, wherein A represents the heading period phenotypic identification of the wild type WT and the TaHDRLK-1D1 knockout line; B represents the heading time statistics of the wild type WT and the TaHDRLK-1D1 knockout line. DETAILED DESCRIPTION
[0047] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.
[0048] The present invention discovered a gene in the common wheat variety Zhengmai 7698 (ZM7698) that can regulate wheat heading period and named it TaHDRLK-1D1. In Zhengmai 7698, the nucleotide sequence of the TaHDRLK-1D1 gene is shown in SEQ ID No. 1, the coding gene sequence of TaHDRLK-1D1 is shown in SEQ ID No. 2, and the encoded amino acid sequence of the protein is shown in SEQ ID No. 3.
[0049]
[0050]
[0051]
[0052]
[0053] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature of the field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0054] pWMB110 vector, pWMB110-Cas9 vector in the following examples (Liu H, Wang K, JiaZ, Gong Q, Lin Z, Du L, Pei X, Ye 19;71(4):1337-1349.doi:10.1093 / jxb / erz529.PMID:31760434;PMCID:PMC7031065.), TaU3::tRNA-crRNA vector (Zhao S, Han X, Zhu Y, Han Y, Liu H, ChenZ, Li H, Wang D, Tian C, Yuan Y, Guo Y,Si X,Wang D,Ji X.CRISPR / CasΦ2-mediated gene editing in wheat and rye.J Integr Plant Biol.2024Apr;66(4):638-641.doi:10.1111 / jipb.13624.Epub 2024Feb 13.PMID:38351739.), the public can obtain the biological material from the applicant, and the biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.
[0055] 2× Taq HiFi PCR mix: Beijing Polymer Biotechnology Co., Ltd., catalog number MF002-100. DNA marker for agarose gel electrophoresis: Beijing Polymer Biotechnology Co., Ltd., catalog number MF026. High-success-rate PCR enzyme KOD FX: TOYOBO, catalog number KFX-101. Microcolumn-based DNA gel recovery kit: Zhuangmeng Biotechnology, catalog number ZPV202. Blunt vector: Beijing Quanshijin Biotechnology, catalog number CB111-01. T4 DNA ligase: Thermo Fisher Scientific, catalog number EL0014. Competent DH5α cells: TOLOBIO, catalog number CC96102. Restriction enzymes BamH I, Sac I, Nco I, Bbs I, and Hind III: Thermo Fisher Scientific, catalog numbers FD0054, FD1134, FD0575, FD1014, and FD0505. Agrobacterium C58C1 competent cells: Beijing Zhuangmeng Biotechnology Co., Ltd., product catalog number ZC1504D-1. Reverse transcription and qRT-PCR kits: Beijing Seven Innovation Biotechnology Co., Ltd., product catalog number SRQ-01.
[0056] Example 1
[0057] Cloning of TaHDRLK-1D1 gene
[0058] Materials: The wheat variety used was Chinese Spring, maintained in our laboratory. Two weeks after germination, Chinese Spring seeds were sampled and RNA was extracted from leaves using the Trizol method. RNA was then reverse-transcribed using a reverse transcription kit to generate cDNA.
[0059] 1. RNA extraction using Trizol
[0060] 1. Quickly freeze fresh samples in liquid nitrogen. Place the samples in a mortar (wash with clean water and treat with DEPC water overnight, then oven-treat at 180°C for 6 hours) and grind them quickly into powder using a pestle. Transfer the mixture to an RNase-free centrifuge tube, add 1 ml of Trizol, shake vigorously to fully lyse the sample, and let it stand at room temperature for 5 minutes.
[0061] 2. Add 200 μl of chloroform, mix by inversion, let stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm at 4°C for 15 minutes. Transfer the supernatant to a new RNase-free centrifuge tube.
[0062] 3. Add an equal volume of isopropanol to the supernatant, mix thoroughly by inverting, and place in a -20°C refrigerator for 30 minutes to allow the RNA to precipitate. Centrifuge at 12,000 rpm, 4°C for 10 minutes, remove the supernatant, and the RNA will precipitate at the bottom of the tube.
[0063] 4. Wash the RNA pellet with 1 ml of 75% ethanol (prepared with RNase-free ddH2O). Gently flick the bottom of the tube to resuspend the pellet. Invert the tube several times. Centrifuge at 12,000 rpm at 4°C for 1 minute. Discard the supernatant. Repeat this step once. Allow the tube to dry at room temperature for 5-10 minutes.
[0064] 5. Add 50 μl RNase-free ddH2O to the centrifuge tube (adjust according to the amount of RNA) and vortex at room temperature for 3 minutes to fully dissolve the RNA precipitate.
[0065] 2. Reverse Transcription
[0066] The reverse transcription system is shown in Table 1.
[0067] Table 1 Reverse transcription reaction system
[0068]
[0069]
[0070] Reaction procedure: 50°C for 30 min, 85°C for 5 s, and place on ice.
[0071] 3. Acquisition of the TaHDRLK-1D1 gene
[0072] Primers for TaHDRLK-1D1 were designed based on the Chinese spring wheat reference gene sequence (TraesCS1D02G317400) from Ensembl Plants. The upstream primer for TaHDRLK-1D1 included the translation start codon ATG, and the downstream primer included the stop codon TAA. PCR amplification was then performed using reverse-transcribed Chinese spring leaf cDNA as a template with primers TaHDRLK-1D1-CDS-F and TaHDRLK-1D1-CDS-R and KOD FX. The primer sequences are as follows:
[0073] TaHDRLK-1D1-CDS-F:ATGGCGCTGCGCTTGCAAGGTATC, SEQ ID No. 4;
[0074] TaHDRLK-1D1-CDS-R:TTACTGCGCTGTGGACCAAGATGC, SEQ ID No. 5.
[0075] The PCR reaction system is shown in Table 2.
[0076] Table 2 PCR reaction system
[0077] Element Volume (μL) 2×PCR buffer for KODFX 12.5 2mM dNTPs 5 TaHDRLK-1D1-CDS-F (μM) 0.75 TaHDRLK-1D1-CDS-R (μM) 0.75 cDNA template 100ng KODFX 0.5 <![CDATA[ddH2O]]> Make up 25 Total volume (μL) 25
[0078] Reaction procedure: 95°C for 5 min, (95°C for 30 s; 58-64°C for 30 s; 72°C for 3 min) × 35, 72°C for 5 min.
[0079] The PCR amplification product was electrophoresed on 1% agarose at 150V for 30min, and an amplification band was found at the 2823bp position ( Figure 1 ), excise the band, and recover the PCR product using a DNA gel recovery kit. The recovered DNA fragment was ligated with a Blunt vector at 16°C for 1 hour and transformed into competent E. coli DH5α cells. After overnight culture, single clones were identified by PCR using primers TaHDRLK-1D1-CDS-F and TaHDRLK-1D1-CDS-R (see Table 3 for the reaction system). Positive clones were sequenced to obtain the TaHDRLK-1D1 coding gene sequence.
[0080] Table 3 PCR reaction system
[0081]
[0082]
[0083] Reaction procedure: 95°C for 5 min, (95°C for 30 s; 60°C for 30 s; 72°C for 3 min) × 35, 72°C for 5 min.
[0084] The coding gene sequence of TaHDRLK-1D1 is shown in SEQ ID No. 2, and the encoded amino acid sequence is shown in SEQ ID No. 3.
[0085] Example 2
[0086] Expression pattern analysis of TaHDRLK-1D1
[0087] Tissue expression materials: Wheat ZM7698 was selected to extract tissue RNA from roots (SR), stems (SS), leaves (SL), roots (RES), stems (SES), leaves (LES), roots (HR), stems (HS), leaves (HL), spikelets (HSP), stamens (S), pistils (P), grains 5 days after anthesis (5 DPA), 10 days after anthesis (10 DPA), 15 days after anthesis (15 DPA), 20 days after anthesis (20 DPA), and 25 days after anthesis (25 DPA). The reaction system is shown in Table 1.
[0088] Based on the obtained TaHDRLK-1D1 coding gene sequence, a pair of TaHDRLK-1D1 qRT-PCR primers were designed. The primer sequences are as follows:
[0089] TaHDRLK-1D1-qPCR-F: TTCCAACACCAAGCCTG, SEQ ID No. 6;
[0090] TaHDRLK-1D1-qPCR-R: CCGAAGTCACCAAGATGTG, SEQ ID No. 7.
[0091] The qRT-PCR reaction system is shown in Table 4.
[0092] Table 4 qRT-PCR reaction system
[0093]
[0094] Reaction procedure: 94°C for 5 min, (94°C for 30 s; 60°C for 30 s; 72°C for 30 s) × 40, 72°C for 7 min.
[0095] The expression levels of TaHDRLK-1D1 gene in different developmental stages and tissues of wheat were studied. Figure 2 As shown in , the TaHDRLK-1D1 gene was expressed at the highest level in leaves at the heading stage, followed by leaves at the seedling stage, leaves at the jointing stage, stems at the heading stage, and ears at the heading stage. The expression level was lower in pistils and grains 15 days after anthesis.
[0096] Example 3
[0097] Obtaining and Phenotypic Identification of TaHDRLK-1D1 Transgenic Wheat
[0098] 1. Construction of TaHDRLK-1D1 gene overexpression vector using In-Fusion technology
[0099] The pWMB110 vector was cut with restriction endonucleases BamH I and Sac I to obtain the vector backbone fragment. The target fragment with a linker was ligated into the vector backbone fragment using In-Fusion enzyme. The resulting recombinant vector is the TaHDRLK-1D1 gene overexpression vector. The specific steps are as follows:
[0100] (1) PCR amplification
[0101] Using the CDS sequence of TaHDRLK-1D1 cloned in Example 1 (as shown in SEQ ID No. 2) as a template, PCR amplification was performed using primers 110-TaHDRLK-1D1-BamHI-F and 110-TaHDRLK-1D1-SacI-R (see Table 2 for the reaction system) to obtain a PCR amplification product (the underlined sequence is the In-Fusion linker sequence).
[0102] 110-TaHDRLK-1D1-BamHI-F:GGTCGACTCTAGAGGATCCATGGCGCTGCGCTTG CAAGGTATC, SEQ ID No. 8;
[0103] 110-TaHDRLK-1D1-SacI-R: ATCGGGGAAATTCGAGCTCTTACTGCGCTGTGGACC AAGATGC, SEQ ID No. 9.
[0104] (2) Plasmid digestion
[0105] The pWMB110 vector was digested with restriction endonucleases BamH I and Sac I to obtain the vector backbone fragment.
[0106] (III) In-Fusion enzyme ligation
[0107] The PCR amplification product from step (1) was ligated into the vector backbone fragment from step (2) using In-Fusion enzyme. The resulting recombinant vector, which had been sequenced correctly, was designated pWMB110::TaHDRLK-1D1. pWMB110::TaHDRLK-1D1 contained the CDS sequence of the TaHDRLK-1D1 gene as shown in SEQ ID No. 2. Expression of the TaHDRLK-1D1 gene was driven by the maize ubiquitin promoter (Ubi).
[0108] 2. Obtaining recombinant Agrobacterium
[0109] The recombinant plasmid pWMB110::TaHDRLK-1D1 was introduced into Agrobacterium C58C1 to obtain the recombinant bacterium C58C1 / pWMB110::TaHDRLK-1D1.
[0110] 3. Obtaining T0 generation transgenic wheat
[0111] 1. Take the immature embryos of ZM7698 15-17 days after flowering, sterilize them with 70% alcohol for 1 minute, 2% sodium hypochlorite for 10 minutes in a clean bench, and finally wash them with sterile water 4-5 times.
[0112] 2. Peel off the intact immature embryos under a stereoscope and infect them with the activated recombinant bacteria C58C1 / pWMB110::TaHDRLK-1D1 for 5 minutes.
[0113] 3. Transfer the infected embryos to the co-culture medium for 2 days, followed by 5 days of recovery culture and 35 days of screening culture to obtain resistant callus tissue.
[0114] 4. Transfer the resistant callus to the differentiation medium for about 14 days to obtain differentiated seedlings.
[0115] 5. The differentiated seedlings were transferred to the rooting medium for 14 days and then transplanted into pots in the greenhouse to obtain T0 generation transgenic wheat. They were cultured at 25°C for 16 hours of light and 20°C for 8 hours of darkness for 3 months to obtain T1 generation seeds.
[0116] The above infection method is specifically referred to the following literature: Wang K, Liu H, Du L, Ye X (2017). Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated cotransformation strategy in commercial Chinese wheat varieties. Plant Biotechnol J 15:614-623.
[0117] 4. Identification of transgenic plants
[0118] 1. Identification of positive strains by PCR and test strips
[0119] The leaves of the transgenic plants were taken and the T0 transgenic plants obtained in step 3 were PCR-positively identified using primers Bar67F and Bar496R (see Table 3 for the reaction system). The lines that could obtain the amplified band of the screening marker bar gene with a size of 429 bp were considered positive lines (see Table 3 for the reaction system). Figure 3At the same time, the PAT / BAR gold-labeled rapid immunoassay kit from AoChuang Biotech was used to screen positive transgenic wheat. The lines that could detect two bands were positive (see Figure 4 A total of 12 positive transgenic wheat plants were screened.
[0120] The primer sequences of Bar67F and Bar496R are as follows:
[0121] Bar67F: ACCATCGTCAACCACTACATCG, SEQ ID No. 10;
[0122] Bar496R:GCTGCCAGAAACCCACGTCATG, SEQ ID No. 11.
[0123] 2. Phenotypic identification
[0124] The investigation of heading period traits can be found in Figure 5 In the T1 generation, three TaHDRLK-1D1 overexpression lines OE-1, OE-2, and OE-3 with delayed heading period were selected (see Figure 5 A), and analysis of its expression levels revealed that the expression levels of TaHDRLK-1D1 in transgenic lines OE-1, OE-2, and OE-3 were significantly increased compared to the negative control (ZM7698, WT) (see Figure 5 B), the heading period phenotype of the T2 generation plants was further identified. The results showed that compared with the wild type WT, the heading period of the three lines OE-1, OE-2 and OE-3 was delayed by an average of 2 to 4 days ( Figure 5 C).
[0125] The above results indicate that the TaHDRLK-1D1 gene is involved in regulating the heading period of wheat.
[0126] Example 4
[0127] Obtaining and phenotypic identification of TaHDRLK-1D1 gene knockout strains
[0128] The TaHDRLK-1D1 gene was subjected to CRISPR / Cas9 system-mediated gene editing in the ZM7698 background. A target site was designed in the first exon of the TaHDRLK-1D1 gene, and a gene editing vector based on the CRISPR / Cas9 system was constructed. Figure 6 .
[0129] 1. Construction of TaHDRLK-1D1 gene knockout vector
[0130] In this example, a target Target1 was selected for the experiment. The sequence of Target1 is CCATGGCTCGGCAATTTGAC, SEQ ID No. 12 ( Figure 6 A, i.e., positions 334 to 353 of SEQ ID No. 2).
[0131] 1. React primers sgRNA-F and sgRNA-R in the reaction system listed in Table 5, allowing the target site to gradually anneal to form a double strand. (The underlined sequence indicates the sticky end sequence.)
[0132] sgRNA-F: AGCACCATGGCTCGGCAATTTGAC, SEQ ID No. 13;
[0133] sgRNA-R: AAACGTCAAATTGCCGAGCCATGG, SEQ ID No. 14.
[0134] Table 5 Target primer annealing system
[0135] Element Volume (μL) sgRNA-F 20 sgRNA-R 20 <![CDATA[ddH2O]]> 10 Total volume (μL) 50
[0136] Annealing conditions: 90℃ for 1 min; 80℃ for 1 min; 70℃ for 1 min; 60℃ for 1 min; 50℃ for 1 min; 40℃ for 1 min; 30℃ for 1 min; 20℃ for 1 min; store at 16℃.
[0137] 2. The vector TaU3::tRNA-crRNA was digested with restriction endonuclease Bbs I (see Table 6 for the reaction system), and the digested product was electrophoresed on 1.0% agarose at 150 V for 30 min, and the digested fragment was recovered using a DNA gel recovery kit.
[0138] Table 6 Enzyme digestion reaction system
[0139] Element Volume (μL) 10×FastDigestGreenBuffer 5 FastDigestBbsI 2 TaU3::tRNA-crRNA Plasmid 2 μg FastAP 2 <![CDATA[ddH2O]]> Make up 50 Total volume (μL) 50
[0140] Reaction procedure: enzyme digestion at 37°C for 1 h.
[0141] 3. The product obtained in step 1 was ligated into the vector backbone fragment obtained in step 2 using T4 DNA ligase (see Table 7 for the reaction system), and transformed into Escherichia coli competent cells DH5α. After overnight culture, single clones were picked for PCR identification (see Table 3 for the reaction system), and positive single clones were sequenced and identified. The monoclonal plasmid with correct sequencing was extracted to obtain the intermediate vector TaU3-Blunt-sgRNA.
[0142] Table 7T4 DNA ligation system
[0143] Element Volume (μL) 10×T4 DNA Ligase Buffer 2 T4DNALigase 1 Step 1 reaction product 50~100ng Step 2 enzyme digestion product 100~150ng <![CDATA[ddH2O]]> Make up 20 Total volume (μL) 20
[0144] Reaction procedure: Ligation at 16°C for 1 h.
[0145] 4. Using the plasmid TaU3-Blunt-sgRNA as a template, PCR amplification was performed using pWMB110-Cas9-HindIII-F and pWMB110-Cas9-HindIII-R as primers (see Table 2 for the reaction system) to obtain a PCR amplification product containing the TaU3 promoter and Target1 sequence (the underlined sequence is the In-Fusion linker sequence).
[0146] pWMB110-Cas9-HindIII-F: ATGTTACTAGATCAAGCTTGAATTCATCCTCACGTTC AACAC, SEQ ID No. 15;
[0147] pWMB110-Cas9-HindIII-R: CTGCACTGCAGGCATGCAAGCTTCCATCCACTCCAAG CTCT, SEQ ID No. 16.
[0148] 5. Digest the pWMB110-Cas9 vector with the restriction endonuclease Hind III (see Table 6 for the reaction system) to obtain the vector backbone fragment.
[0149] 6. Use In-Fusion enzyme to ligate the PCR amplification product from step 4 into the vector backbone fragment from step 5. The resulting recombinant vector, which has been sequenced correctly, is named pWMB110-Cas9-TaHDRLK-1D1. pWMB110-Cas9-TaHDRLK-1D1 contains the target Target1 driven by the TaU3 promoter.
[0150] 2. Obtaining recombinant Agrobacterium
[0151] The recombinant plasmid pWMB110-Cas9-TaHDRLK-1D1 was introduced into Agrobacterium C58C1 to obtain the recombinant bacterium C58C1 / pWMB110-Cas9-TaHDRLK-1D1.
[0152] 3. Obtaining T0 generation transgenic wheat
[0153] 1. Take the immature embryos of ZM7698 15-17 days after flowering, sterilize them with 70% alcohol for 1 minute, 2% sodium hypochlorite for 10 minutes in a clean bench, and finally wash them with sterile water 4-5 times.
[0154] 2. Peel off the intact embryos under a stereoscope and infect them with the activated recombinant bacteria C58C1 / pWMB110-Cas9-TaHDRLK-1D1 for 5 minutes.
[0155] 3. Transfer the infected embryos to the co-culture medium for 2 days, followed by 5 days of recovery culture and 35 days of screening culture to obtain resistant callus tissue.
[0156] 4. Transfer the resistant callus to the differentiation medium for about 14 days to obtain differentiated seedlings.
[0157] 5. Transfer the differentiated seedlings to a rooting medium for 14 days and then transplant them into pots in a greenhouse to obtain T0-generation transgenic wheat. Cultivate them at 25°C with 16 hours of light and 20°C with 8 hours of darkness for 3 months to obtain T1-generation seeds.
[0158] The above infection method is specifically referred to the following literature: Wang K, Liu H, Du L, Ye X (2017). Generation of marker-free transgenic hexaploid wheat via an Agrobacterium-mediated cotransformation strategy in commercial Chinese wheat varieties. Plant Biotechnol J 15:614-623.
[0159] 4. Mutation Types and Phenotypic Identification of Transgenic Wheat
[0160] 1. PCR-RE (polymerase chain reaction-restriction enzyme analysis) detection: Using the genomic DNA (gDNA) of T0 transgenic wheat as a template, PCR amplification was performed using primers TaHDRLK-1D1-sgRNA-F and TaHDRLK-1D1-sgRNA-R (see Table 3 for the reaction system). The amplified product was digested with restriction endonuclease Nco I, and the digested product was electrophoresed on 1.5% agarose at 150 V for 30 minutes; the PCR amplified products of the wild-type and unedited plants were cut into two short fragments by the endonuclease Nco I because they had a complete Nco I restriction site at the Target1 sequence. When the target site was edited, the Nco I at the Target1 sequence was not cut into two short fragments. I restriction enzyme cleavage site will be destroyed, and its PCR amplification product will not be cut by endonuclease NcoI; at this time, when only one of the DNA chains is edited, the enzyme cleavage product will appear three bands after agarose gel electrophoresis, one of which is cut into two short fragments, while the other chain is not cut. When both DNA chains are edited at the same time, the enzyme cleavage product will appear only one uncut band after agarose gel electrophoresis. Through screening, we obtained 5 homozygous edited plants (numbers 9, 10, 11, 13 and 17) and 5 heterozygous edited plants (numbers 4, 6, 12, 15 and 16) from 15 transgenic plants ( Figure 6 B).
[0161] TaHDRLK-1D1-sgRNA-F: GTTGTTCTGAGTATTCGCAAGAAC, SEQ ID No. 17;
[0162] TaHDRLK-1D1-sgRNA-R: TGACTCAAAATCGAAGCGTTCAAG, SEQ ID No. 18.
[0163] 2. The PCR amplification products of the homozygous edited plants were recovered and purified, and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.
[0164] 3. Using SnapGene to analyze the sequencing results, we obtained two types of mutations from five homozygous edited plants of the TaHDRLK-1D1 gene ( Figure 6 C), two homozygous mutant lines KO-1 (TaHDRLK-1D1 gene deletion of 2bp) and KO-2 (TaHDRLK-1D1 gene deletion of 27bp) were selected for propagation and planting.
[0165] 4. The results of the phenotypic identification of the offspring lines of KO-1 and KO-2 at heading stage are shown in Figure 7Compared with the wild type WT, the heading date of the KO-1 and KO-2 lines was 4 to 5 days earlier on average. These results indicate that the TaHDRLK-1D1 gene is involved in regulating the heading date of wheat.
[0166] The above experimental results show that overexpression of the TaHDRLK-1D1 gene can significantly delay the heading period of wheat, while the knockout strain of the TaHDRLK-1D1 gene can advance the heading period of wheat. In the field breeding process, appropriate heading and maturity periods are the prerequisites for ensuring high and stable crop yields. In the future, we can use the expression level of TaHDRLK-1D1 in different breeding materials, the functional differences of alleles and gene editing technology to regulate the growth period of varieties, and significantly improve the adaptability of excellent varieties based on the diversity of heading period.
[0167] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0168] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Application of wheat receptor protein kinase TaHDRLK-1D1 gene in regulating the heading period of plants, characterized in that: The nucleotide sequence of the TaHDRLK-1D1 gene is shown in SEQ ID No. 1; Or a nucleotide sequence with a homology of more than 90% to the nucleotide sequence of SEQ ID No. 1, and encoding the amino acid as shown in SEQ ID No.
3.
2. Use of a protein or a substance that regulates the expression of a gene encoding the protein in regulating the heading period of a plant, characterized in that: The amino acid sequence of the protein is shown in SEQ ID No. 3; or a protein having the same function as that obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 3; Or a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus in the above two cases.
3. Use of the gene according to claim 1 or the biological material related to the protein according to claim 2 in regulating the heading period of a plant, characterized in that: The biological material is any one of the following: A: nucleotide sequence of the nucleic acid molecule according to claim 1 or the nucleic acid molecule encoding the protein according to claim 2; B: expression cassette containing the nucleic acid molecule described in A; C: an expression vector containing the nucleic acid molecule described in A, or a recombinant vector containing the expression cassette described in B; D: A recombinant microorganism containing the nucleic acid molecule described in A, or a recombinant microorganism containing the expression cassette described in B, or a recombinant microorganism containing the recombinant vector described in C.
4. The use according to any one of claims 1 to 3, characterized in that: The plant is wheat.
5. The use according to any one of claims 1 to 3, characterized in that: The regulating the heading period of the plant is to delay or advance the heading period of the plant.