Synthetic flora, microbial agent and application thereof, and method for improving drought resistance of corn

By constructing a synthetic bacterial flora containing Acinetobacterium X1, Enterobacter mulberry X3, Rope-Based Basketball ZH1 and Aspergillus fumigation ZH2, the problem of the growth and reproduction of microbial flora in different regions was solved, and the drought resistance and growth indicators of corn were improved.

CN120519334APending Publication Date: 2025-08-22NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510730620.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The growth and reproduction of existing microbial flora in different regions is affected, resulting in poor application of plant drought tolerance.

Method used

Synthetic bacterial flora, including bacterial synthesis bacteria and fungal synthesis bacteria, specifically Acinetobacter X1, Enterobacter mulberry X3, rope-like basket bacteria ZH1 and Aspergillus fumigatus ZH2, were used to construct a cross-border synthetic bacterial flora to improve the drought resistance of corn.

Benefits of technology

It can grow and reproduce normally in different regions, significantly improving the drought resistance of corn and enhancing growth indicators such as plant height, fresh weight, dry weight, chlorophyll content and photosynthetic rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519334A_ABST
    Figure CN120519334A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a synthetic flora, a microbial agent, application of the microbial agent and a method for improving drought resistance of corn. The synthetic flora comprises at least one of a bacterial synthetic flora and a fungal synthetic flora; the bacterial synthetic flora comprises acinetobacter X1 and mulberry enterobacter X3; the preservation number of the acinetobacter X1 is CCTCC (China Center For Type Culture Collection) NO: M 20242634; the preservation number of the mulberry enterobacter X3 is CCTCC (China Center For Type Culture Collection) NO: M 20242635; the fungal synthetic flora comprises talaromyces rope ZH1 and aspergillus fumigatus ZH2; the preservation number of the talaromyces rope ZH1 is CCTCC (China Center For Type Culture Collection) NO: M 20242637; the preservation number of the aspergillus fumigatus ZH2 is CCTCC (China Center for Type Culture Collection) NO: M 20242636. The transboundary synthetic flora is obtained by mixing the bacterial synthetic flora and the fungus synthetic flora in an isovolumetric manner; the synthetic flora provided by the invention can be stably colonized at the root of the corn, and has a synergistic effect on improving the drought resistance of the corn and promoting the growth index of the corn.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of microbiology, and in particular relates to a synthetic bacterial community, a microbial agent and application thereof, and a method for improving the drought resistance of corn. Background Art

[0002] Amid global warming, the frequency and intensity of droughts continue to increase, and the area affected by droughts is still expanding, threatening the high-quality development of agriculture. Drought is one of the challenges that hinders crop growth and development, and is one of the main causes of crop production losses, leading to slower plant growth, lower yields, and poor quality.

[0003] In recent years, utilizing the plant microbiome has become an effective method for alleviating plant stress. Its environmental friendliness and high cost-effectiveness have led to its widespread use in drought stress management areas worldwide. Researchers now generally advocate the use of beneficial microorganisms present in the rhizosphere microbiome to induce drought tolerance in plants. Furthermore, core rhizosphere microorganisms play an important role in maintaining plant health. Therefore, identifying, exploring, and applying core rhizosphere microorganisms provides a new approach to improving plant health.

[0004] Currently, the microbial communities used to improve plant drought tolerance include Streptomyces and Trichoderma. However, due to the large differences in soil environment and climatic conditions in different regions, the growth and reproduction of these microorganisms in different areas are affected, resulting in poor results in improving plant drought tolerance. Summary of the Invention

[0005] To address the problem in existing technologies where microbial communities used to improve plant drought tolerance are affected by regional variations in growth and reproduction, resulting in poor results, the present invention proposes a synthetic microbial community, a microbial agent, their application, and a method for improving corn drought resistance. To achieve this objective, the present invention employs the following technical solutions.

[0006] The present invention provides a synthetic microbial community for improving the drought resistance of corn. The synthetic microbial community comprises at least one of a bacterial synthetic microbial community and a fungal synthetic microbial community.

[0007] The bacterial synthetic flora includes Acinetobacter X1 and Enterobacter mulariae X3, and the effective bacterial number ratio of the Acinetobacter X1 to the Enterobacter mulariae X3 is 1:1.

[0008] The Acinetobacter X1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242634; the Enterobacter mulberry X3 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242635.

[0009] The fungal synthetic flora includes Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2, and the effective bacterial number ratio of the Talaromyces fungi ZH1 and the Aspergillus fumigatus ZH2 is 1:1.

[0010] The rope-forming fungus ZH1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242637; the Aspergillus fumigatus ZH2 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242636.

[0011] When the synthetic microbial consortium includes both a bacterial synthetic microbial consortium and a fungal synthetic microbial consortium, a cross-kingdom synthetic microbial consortium is constructed; wherein the volume ratio of the bacterial synthetic microbial consortium to the fungal synthetic microbial consortium is 1:1. That is, the cross-kingdom synthetic microbial consortium is obtained by mixing equal volumes of the bacterial synthetic microbial consortium and the fungal synthetic microbial consortium.

[0012] The microorganisms used in the present invention are all from arid farmland in Northwest China and can grow and reproduce normally in most arid soils and help plants resist drought stress. Therefore, the synthetic bacterial consortium composed of the above microorganisms in the present invention will not be affected in the growth and reproduction of different regions and can still be normally applied to plant drought tolerance, playing a role in improving plant drought resistance. The synthetic bacterial consortium provided by the present invention can solve the problem that the growth and reproduction of microbial consortiums used in plant drought tolerance in the prior art are affected in different regions, resulting in poor results in plant drought tolerance.

[0013] The present invention also provides a microbial agent, including at least one of microbial agent one, microbial agent two and microbial agent three.

[0014] The microbial agent includes a bacterial solution of the bacterial synthetic flora; the bacterial solution of the bacterial synthetic flora is obtained by mixing the bacterial solution of Acinetobacter X1 and the bacterial solution of Enterobacter mulariae X3 in equal volume proportions.

[0015] The second microbial agent includes the fungal spore suspension of the fungal synthetic flora, which is obtained by mixing the fungal spore suspension of Talaromyces fungi ZH1 and the fungal spore suspension of Aspergillus fumigatus ZH2 in equal volume proportions.

[0016] The microbial agent three includes a mixed bacterial liquid of a trans-kingdom synthetic bacterial community; the mixed bacterial liquid of the trans-kingdom synthetic bacterial community is obtained by mixing the bacterial liquid of the bacterial synthetic bacterial community and the fungal spore suspension of the fungal synthetic bacterial community in equal volume proportions.

[0017] The bacteria Acinetobacter X1 and Enterobacter mulariae X3, and the fungi Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2 used in the present invention are all from drought-treated corn rhizosphere soil. After the selection effect of corn, they can all stably colonize in the roots of corn, and have a synergistic effect on improving the drought resistance of corn and promoting the growth indicators of corn.

[0018] Preferably, the OD values ​​of the bacterial solution of Acinetobacter X1 and the bacterial solution of Enterobacter mori X3 are 600 The values ​​are all between 0.5 and 0.7.

[0019] Preferably, the concentration of the fungal spore suspension of Talaromyces cordifolia ZH1 is 1×10 4 cfu / mL~1×10 6 cfu / mL; the concentration of the Aspergillus fumigatus ZH2 fungal spore suspension is 1×10 4 cfu / mL~1×10 6 cfu / mL.

[0020] The present invention also provides the use of the synthetic bacterial group or the microbial agent in improving the drought resistance of corn.

[0021] Preferably, the synthetic bacterial community or the microbial agent can promote the increase of growth indicators of corn.

[0022] The growth indicator includes at least one of the following indicators: Plant height, fresh weight, dry weight, leaf chlorophyll content, root length and photosynthetic rate.

[0023] Preferably, the synthetic bacterial consortium or the microbial agent can reduce the damage to corn caused by drought stress.

[0024] Preferably, the synthetic bacterial community or the microbial agent is applied to the soil in the root zone of corn to improve the drought resistance of corn.

[0025] Preferably, the frequency of application of the synthetic flora or the microbial agent to the corn root zone soil is once every 10 days, and the amount of the synthetic flora or the microbial agent applied each time is 100 mL / pot to 200 mL / pot or 500 L / mu to 1000 L / mu.

[0026] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a synthetic microbial consortium for improving drought tolerance in corn. The synthetic microbial consortium comprises at least one of a bacterial synthetic microbial consortium and a fungal synthetic microbial consortium. When the synthetic microbial consortium comprises both bacterial synthetic microbial consortium and fungal synthetic microbial consortium, the volume ratio of the bacterial synthetic microbial consortium to the fungal synthetic microbial consortium is 1:1. The bacterial synthetic microbial consortium comprises Acinetobacter X1 and Enterobacter mori X3; the fungal synthetic microbial consortium comprises Talaromyces fungiformis ZH1 and Aspergillus fumigatus ZH2.

[0027] The Acinetobacter X1, Enterobacter mulae X3, Talaromyces fungi ZH1, and Aspergillus fumigatus ZH2 used in the present invention are all from arid farmland in Northwest China. They can grow and reproduce normally in most arid soils and help plants resist drought stress. Therefore, the synthetic bacterial consortium composed of these microorganisms in the present invention will not be affected in terms of growth and reproduction in different regions and can still be used normally to improve plant drought tolerance, playing a role in enhancing plant drought resistance. The synthetic bacterial consortium provided by the present invention can solve the problem that the growth and reproduction of microbial consortiums used in plant drought tolerance in the prior art are affected in different regions, resulting in poor results in plant drought tolerance.

[0028] 2. The bacteria Acinetobacter X1 and Enterobacter mulariae X3, and the fungi Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2 used in the present invention are all derived from drought-treated corn rhizosphere soil. After being selected by corn, they can stably colonize the roots of corn, and have a synergistic effect on improving the drought resistance of corn and promoting the growth indicators of corn.

[0029] 3. The synthetic bacterial community provided by the present invention not only effectively improves the drought resistance of corn, but can also be directly applied to the soil, which is convenient to use.

[0030] 4. The bacterial synthetic flora provided by the present invention increased the plant height of corn by 25.12%, the fresh weight by 40.60%, the dry weight by 21.04%, the chlorophyll content of the leaves by 28.04%, the root length by 71.59%, and the photosynthetic rate by 83.39%; the fungal synthetic flora increased the plant height of corn by 14.85%, the fresh weight by 27.23%, the dry weight by 34.97%, the chlorophyll content of the leaves by 16.48%, the root length by 66.72%, and the photosynthetic rate by 46.27%; the cross-border synthetic flora increased the plant height of corn by 20.51%, the fresh weight by 48.83%, the dry weight by 66.57%, the chlorophyll content of the leaves by 21.76%, the root length by 101.45%, and the photosynthetic rate by 85.25%.

[0031] The bacterial synthetic flora includes Acinetobacter X1 and Enterobacter mori X3.

[0032] The Acinetobacter X1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242634; the Morus alba Enterobacter X3 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242635.

[0033] The fungal synthetic flora includes Talaromyces funiculosus ZH1 and Aspergillus fumigatus ZH2.

[0034] The rope-forming fungus ZH1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242637; the Aspergillus fumigatus ZH2 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242636. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The phenotypic determination of corn plants in the present invention is as follows, wherein Drought is a drought treatment, Water is a watering treatment, CK is an uninoculated group, Bac is an inoculated bacterial synthetic group, Fun is an inoculated fungal synthetic group, and BF is an inoculated cross-kingdom synthetic group; wherein, Figure 1 Figure (a) shows the height of corn plants; Figure 1 Figure (b) shows the chlorophyll content of corn leaves; Figure 1 Figure (c) shows the fresh weight of corn plants; Figure 1 Figure (d) shows the dry weight of corn plants; different letters indicate significant differences among groups.

[0036] Figure 2 The determination of photosynthetic parameters of corn plants in the present invention, wherein Drought is drought treatment, Water is watering treatment, CK is the uninoculated group, Bac is the inoculated bacterial synthetic bacteria group, Fun is the inoculated fungal synthetic bacteria group, and BF is the inoculated cross-kingdom synthetic bacteria group; wherein, Figure 2 Figure (a) shows the photosynthetic rate; Figure 2 Figure (b) shows the intercellular carbon dioxide concentration; Figure 2 Figure (c) in the figure is the transpiration rate; Figure 2 Figure (d) shows the stomatal conductance.

[0037] Figure 3 is the root morphology index of the corn plant in the present invention, wherein Drought is drought treatment, Water is watering treatment, CK is the uninoculated group, Bac is the bacterial synthetic group inoculated, Fun is the fungal synthetic group inoculated, and BF is the cross-kingdom synthetic group inoculated; wherein, Figure 3 Figure (a) shows the number of root tips; Figure 3 Figure (b) shows the total length of the root system; Figure 3 Figure (c) shows the root surface area; Figure 3 Figure (d) shows the root volume.

[0038] Figure 4 is the stress resistance index of the corn plant in the present invention, wherein Drought is drought treatment, Water is watering treatment, CK is the uninoculated group, Bac is the inoculated bacterial synthetic bacteria group, Fun is the inoculated fungal synthetic bacteria group, and BF is the inoculated cross-kingdom synthetic bacteria group; wherein, Figure 4 Figure (a) shows the malondialdehyde content; Figure 4 Figure (b) shows the proline content; Figure 4 Figure (c) shows peroxidase activity; Figure 4 Figure (d) shows superoxide dismutase activity.

[0039] Figure 5 For the Acinetobacter X1 in the present invention ( Acinetobacter sp. morphological characteristics.

[0040] Figure 6 Enterobacter mulberry X3 ( Enterobacter mori morphological characteristics.

[0041] Figure 7 The present invention is the rope-forming fungus ZH1 ( Talaromyces funiculosus) morphological characteristics.

[0042] Figure 8 Aspergillus fumigatus ZH2 ( Aspergillus fumigatus) morphological characteristics. DETAILED DESCRIPTION

[0043] The following will provide a clear and complete description of the technical solutions of the present invention in conjunction with the accompanying drawings and specific implementations of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0044] Unless otherwise specified, the methods described in the embodiments of the present invention are conventional methods. The materials and reagents used are all commercially available unless otherwise specified.

[0045] The culture medium used in the following examples is as follows: The formula of R2A solid culture medium is: 0.5 g tryptone, 0.5 g yeast extract, 0.3 g potassium nitrate, 0.01 g inorganic salt, 0.5 g glucose, 15 g agar and 1000 mL deionized water.

[0046] The formula of LB solid medium is: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, 15 g of agar and 1000 mL of deionized water.

[0047] The formula of LB liquid medium is: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride and 1000 mL of deionized water.

[0048] The formula of PDA solid culture medium is: 200 mL of potato juice, 20 g of glucose, 15 g of agar and 1000 mL of deionized water.

[0049] The formula of PDA liquid culture medium is: 200 mL of potato juice, 20 g of glucose and 1000 mL of deionized water.

[0050] The formula of nitrogen-fixing solid culture medium is: 1 g of sodium nitrate, 0.2 g of potassium dihydrogen phosphate, 0.2 g of magnesium sulfate, 15 g of agar and 1000 mL of deionized water.

[0051] The formula of organophosphorus solid culture medium is: 0.5g calcium phosphate, 5g glucose, 15g agar and 1000mL deionized water.

[0052] The formula of the inorganic phosphorus-dissolving solid culture medium is: 1 g of potassium dihydrogen phosphate, 0.5 g of tryptone, 15 g of agar and 1000 mL of deionized water.

[0053] Example 1 1. Soil Sample Collection Soil samples of corn subjected to drought treatment were collected from the experimental field of the National Key R&D Program project in Wugong County, Xianyang City, Shaanxi Province. Soil samples were collected at the V12 (large bell stage), R2 (grain filling stage) and R4 (waxy stage) stages of corn.

[0054] Corn plants were pulled using a five-point sampling method, with 15 plants per plot. After shaking off the soil clods around the corn roots, the soil tightly attached to the corn root system within 2 mm was vigorously shaken to obtain the corn root soil. The corn root soil from the same plot was mixed, sieved through a 2 mm sieve, and bagged as a soil sample for the isolation of corn rhizosphere microorganisms.

[0055] 2. Isolation of Corn Root Bacteria Take 5g of soil within 2mm of the corn root system, add 45mL of sterile water and sterile glass beads, place on a shaker at 28℃, and shake at 180r min. -1 Oscillate at a speed of 1000 nm for 30 minutes, mix thoroughly and let it stand for 15 minutes. Pipette 1 mL of supernatant in a clean bench and add it to a centrifuge tube containing 9 mL of sterile water. Shake it manually to obtain a dilution of 10. -2 Repeat this step to dilute the rhizosphere soil suspension to obtain a dilution of 10-5 , 10 -6 and 10 -7 of rhizosphere soil suspension.

[0056] 20 μL of the rhizosphere soil suspensions of the three concentrations were respectively pipetted onto R2A solid medium and LB solid medium, and three replicates were performed for each medium and each concentration.

[0057] The rhizosphere soil suspensions of the above three concentrations were evenly spread with a sterile applicator, inverted and placed in a 28°C incubator for 7 days. The growth of the colonies was observed every day and the morphology, size, color and transparency were selected. Different single colonies were streaked onto new LB solid culture medium for purification until pure bacteria were isolated. A total of 140 bacterial strains belonging to 4 phyla and 58 genera were obtained.

[0058] 3. Isolation of Corn Root Fungi Take 5g of soil within 2mm of the corn root system and repeat the above steps to prepare the rhizosphere soil suspension to obtain a concentration of 10 -4 , 10 -5 and 10 -6 Rhizosphere soil suspension: Pipette 20 μL of each of the three concentrations of rhizosphere soil suspension onto PDA solid medium, and perform three replicates for each concentration.

[0059] The rhizosphere soil suspensions of the above three concentrations were evenly spread with a sterile applicator, inverted and placed in a 28°C incubator for culture for 7 days. After 7 days, colonies with different mycelial morphology, texture, and color were picked, and the bacterial cakes were inoculated into new PDA solid culture medium for purification until colonies with uniform morphology and color were obtained. A total of 33 fungal strains were obtained, belonging to 3 phyla and 11 genera.

[0060] 4. Screening of drought-tolerant and growth-promoting bacteria and fungi 1. Screening of drought-resistant bacteria Screening of drought-tolerant bacteria and fungi A 15% (mass ratio) PEG-6000 concentration was selected as the drought condition, and no PEG-6000 was used as the control. Single colonies of the 140 isolated bacterial strains were picked and placed in 20 mL of LB liquid medium, placed at 28°C and 180 r min -1 The suspension of 140 bacterial strains was obtained by culturing on a shaker for 3 days. The OD of each bacterial suspension was adjusted. 60 The value was set to 0.6, and 1% (volume ratio) of the inoculum was inoculated into 20 mL of LB liquid medium and the mixture was incubated at 28 ° C and 180 r min -1 The OD value at 600 nm was measured similarly, and strains with an OD value drop of less than 30% were considered drought-tolerant bacteria, ultimately obtaining 18 drought-tolerant bacterial strains.

[0061] The 33 fungal strains isolated were collected and inoculated into 20 mL of PDA liquid culture medium. -1 The fungal suspension of 33 strains was obtained by culturing on a shaker for 5 days. The fungal suspension was filtered, and the remaining mycelium was dried at 60°C and its biomass was measured. Strains with a biomass decrease of less than 30% were considered drought-tolerant fungi. Finally, 10 drought-tolerant fungi were obtained.

[0062] 2. Screening of growth-promoting bacteria Eighteen purified bacteria with drought-resistant characteristics were selected and inoculated into 20 mL of LB liquid medium, and then incubated at 180 r min. -1 , cultured in a shaker at 28°C until OD 600 The value was 0.6, resulting in a suspension of 18 drought-tolerant bacterial strains. In a clean bench, 10 μL of the suspension was pipetted onto a nitrogen-fixing solid medium, an organic phosphate-solubilizing solid medium, and an inorganic phosphate-solubilizing solid medium, three times per plate. After three days of incubation in a 28°C incubator, strains exhibiting clear zones were identified as having growth-promoting properties. Ultimately, two drought-tolerant and growth-promoting bacterial strains were obtained: Acinetobacter X1 and Enterobacter morii X3.

[0063] Ten drought-tolerant fungal strains were plated with three cakes each on a nitrogen-fixing solid medium, an organic phosphorus-dissolving solid medium, and an inorganic phosphorus-dissolving solid medium. After incubation at 28°C for five days, the plates were observed for the presence of clear zones. Strains with clear zones exhibited growth-promoting properties. Ultimately, two drought-tolerant and growth-promoting fungal strains were obtained: Talaromyces cordiformis ZH1 and Aspergillus fumigatus ZH2.

[0064] 5. Acinetobacter X1, Enterobacter mulariae X3 、 Identification of Talaromyces funiculosus ZH1 and Aspergillus fumigatus ZH2 1. Morphological characteristics (1) Single colonies of Acinetobacter X1 on LB solid medium are off-white, with smooth surfaces and neat edges. The colonies are small and round, opaque, with regular edges and are not sticky. Microscopic examination revealed that they are short rod-shaped, have flagella, and are Gram-negative (e.g. Figure 5 shown).

[0065] (2) The colonies of Enterobacter mulberry X3 on LB solid medium are white and translucent. The single colony is round and large, with smooth surface and edge and moist appearance. Microscopic examination shows that it has no spores, flagella and is Gram-negative (such as Figure 6 shown).

[0066] (3) The fungus ZH1 is dark green with grayish white edges on PDA solid medium. The mycelium is multi-branched and villi-like. The conidia are spherical and arranged in chains (e.g. Figure 7 shown).

[0067] (4) The hyphae of Aspergillus fumigatus ZH2 on PDA solid medium are generally dark green. The central area is light pink, gradually turning dark green in the later stage, the edge of the hyphae is grayish white, and the conidia are spherical (such as Figure 8 shown).

[0068] 2. Strain Sequencing Pick up purified Acinetobacter X1 and Enterobacter mulariae X3 、 Single colonies of Talaromyces funiculosus ZH1 and Aspergillus fumigatus ZH2 were dissolved in 10 μL of sterile water to obtain bacterial suspensions of each strain. The bacterial suspensions of each strain were sent to Qingke Bio for sequencing. The resulting sequences were compared on NCBI to obtain species information for each strain.

[0069] Among them, Acinetobacter X1 is classified as Acinetobacter ,and Acinetobacter sp. The similarity is 99.93%. The sequence was amplified using universal primers 27F / 1492R to obtain the nucleotide sequence shown in SEQ ID NO.1:

[0070]

[0071] Enterobacter mulberry X3 is classified as Enterobacter ,and Enterobacter mori The similarity is 99.93%. The sequence was amplified using universal primers 27F / 1492R to obtain the nucleotide sequence shown in SEQ ID NO.2:

[0072]

[0073] Talaromyces cordifolia ZH1 is classified as Talaromyces ,and Talaromyces funiculosus The similarity is 100.00%. The sequence was amplified using universal primers ITS1 / ITS4 to obtain the nucleotide sequence shown in SEQ ID NO.3:

[0074] .

[0075] Aspergillus fumigatus ZH2 is classified as Aspergillus ,and Aspergillus fumigatus The similarity is 100.00%. The sequence was amplified using universal primers ITS1 / ITS4 to obtain the nucleotide sequence shown in SEQ ID NO.4:

[0076] gaaggatcattaccgagtgagggccctctgggtccaacctcccacccgtgtctatcgtaccttgttgcttcggcgggcccgccgtttcgacggccgccggggaggccttgcgcccccgggcccgcgcccg ccgaagacccccaacatgaacgctgttctgaaagtatgcagtctgagttgattatcgtaatcagttaaaactttcaacaacggatctcttggttccggcatcgatgaagaacgcagcgaaatgcgataagt aatgtgaattgcagaattcagtgaatcatcgagtctttgaacgcacattgcgccccctggtattccggggggcatgcctgtccgagcgtcattgctgccctcaagcacggcttgtgtgttgggcccccgt ccccctctcccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcctatggggctttgtcacctgctctgtaggcccggccggcgccagccgacacccaactttatttttctaag.

[0077] Acinetobacter X1 was deposited with the China Center for Type Culture Collection on November 25, 2024, with the accession number CCTCC NO: M 20242634; Enterobacter mori X3 was deposited with the China Center for Type Culture Collection on November 25, 2024, with the accession number CCTCC NO: M 20242635. Talaromyces fungiformis ZH1 was deposited with the China Center for Type Culture Collection on November 25, 2024, with the accession number CCTCC NO: M 20242637; and Aspergillus fumigatus ZH2 was deposited with the China Center for Type Culture Collection on November 25, 2024, with the accession number CCTCC NO: M 20242636.

[0078] VI. Construction of synthetic bacterial communities With drought tolerance as the basic condition and growth-promoting properties as the advanced condition, drought-resistant bacteria with growth-promoting properties are preferred as backup strains. Among them, the bacteria in the backup strains are Acinetobacter X1 and Enterobacter mulberry X3 , The fungi in the reserve strains were Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2. These reserve strains were subjected to a pairwise antagonism experiment. The specific procedure was as follows:

[0079] Using an inoculating loop, single colonies of each of the aforementioned alternative strains were picked and dispersed into sterile test tubes containing sterile water. The suspensions were then mixed to prepare bacterial suspensions of the aforementioned alternative strains. The bacterial suspensions of the various alternative strains were Acinetobacter X1, Enterobacter mori X3, Talaromyces fungi ZH1, and Aspergillus fumigatus ZH2.

[0080] Adjust the concentration of the bacterial suspension of Acinetobacter X1 and Enterobacter mori X3 to OD 600 =0.6, and the concentrations of the fungal spore suspensions of Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2 were adjusted to 1×10 5 cfu / mL.

[0081] Take a sterile culture dish, pour in the melted and cooled agar medium, and wait for it to solidify before use. Use a spreader to dip the bacterial suspension of Acinetobacter X1 and evenly spread it on the surface of the agar medium. After the bacterial liquid dries, use the same method to apply the bacterial suspension of Enterobacter mulberry X3. Invert the culture dish and culture it at 37°C for 3 days. Pay attention to whether an inhibition zone, i.e., a transparent circle, appears in the contact area of ​​the two backup strains. If both backup strains can grow normally and there is no obvious inhibition zone, it indicates that there is no antagonism between them. Use this method to test whether there is pairwise antagonism between the above four backup strains, and retain the strains that do not antagonize each other to combine and construct three synthetic bacterial communities.

[0082] Among them, the three synthetic bacterial communities constructed are as follows: Colony 1 is a synthetic bacterial colony constructed from equal volumes of a bacterial suspension of Acinetobacter X1 and a bacterial suspension of Enterobacter mori X3. Colony 1 is referred to as a synthetic bacterial colony or synthetic bacterial colony (B).

[0083] Colony 2 is a synthetic fungal colony constructed from equal volumes of a spore suspension of Talaromyces fungi ZH1 and a spore suspension of Aspergillus fumigatus ZH2. Colony 2 is referred to as a synthetic fungal colony or synthetic fungal colony (F).

[0084] Bacteria group 3 is a bacterial suspension of Acinetobacter X1 and Enterobacter mulariae X3 、 A cross-kingdom synthetic bacterial consortium was constructed using equal volumes of spore suspensions of Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2. Colony 3 is referred to as a cross-kingdom synthetic consortium, a cross-kingdom consortium, or a cross-kingdom synthetic consortium (BF).

[0085] VII. Verification of the efficacy of synthetic flora The above-constructed bacterial synthetic consortium, fungal synthetic consortium, cross-kingdom synthetic consortium and sterile water were inoculated into corn pots respectively to explore whether the above three synthetic consortia have obvious drought resistance.

[0086] 1. Strain activation and preparation of microbial agents Acinetobacter X1 and Enterobacter mulariae X3 were added to 20 mL of LB liquid medium at a volume ratio of 1% and inoculated at 180 r·min. -1 , shake at 28°C until OD 600 The value reached about 0.8, and the bacterial culture liquid of Acinetobacter X1 and Enterobacter mulberry X3 were obtained respectively. The bacterial cakes of Talaromyces cordiformis ZH1 and Aspergillus fumigatus ZH2 were respectively beaten and added to 20mL PDA liquid culture medium, and the mixture was stirred at 180r·min. -1 , and cultured in a shaking incubator at 28°C for 5 days to obtain the fungal spore suspensions of Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2, respectively.

[0087] Resuspend the bacterial suspension of Acinetobacter X1 and Enterobacter mori X3 in sterile water and adjust the OD 600 The concentration of the fungal spore suspension of Talaromyces tricholoma ZH1 and Aspergillus fumigatus ZH2 was adjusted to 10 with sterile water. 5 cfu / mL for future use.

[0088] The bacterial suspension of the bacterial synthetic flora (B) was prepared by mixing equal volumes of the bacterial suspension of Acinetobacter X1 and the bacterial suspension of Enterobacter mulariae X3. The fungal spore suspension of the fungal synthetic flora (F) was prepared by mixing equal volumes of the fungal spore suspension of Talaromyces fungi ZH1 and the fungal spore suspension of Aspergillus fumigatus ZH2. The mixed bacterial suspension of the cross-kingdom synthetic flora (BF) was prepared by mixing the bacterial suspension of Acinetobacter X1 and Enterobacter mulariae X3. 、 The fungal spore suspension of Talaromyces fungi ZH1 and the fungal spore suspension of Aspergillus fumigatus ZH2 were mixed in equal volumes.

[0089] The bacterial suspension of the above-constructed bacterial synthetic flora (B), the fungal spore suspension of the fungal synthetic flora (F) and the mixed bacterial liquid of the cross-kingdom synthetic flora (BF) are all prepared microbial agents, also known as mixed bacterial liquids.

[0090] Among them, the microbial agents include microbial agent one, microbial agent two and microbial agent three.

[0091] Microbial inoculant - a bacterial suspension of a synthetic bacterial flora (B).

[0092] The second microbial agent is a fungal spore suspension of a fungal synthetic flora (F).

[0093] Microbial agent three is a mixed bacterial solution of cross-kingdom synthetic flora (BF).

[0094] 2. Corn seed preparation and potting soil pretreatment Select plump Zhengdan 958 corn seeds and treat them with 75% alcohol by volume for 45 seconds. Rinse thoroughly with sterile water and then soak in a NaClO solution containing 4% available chlorine by mass for 2 minutes for surface disinfection. Spread the seeds evenly on water agar and incubate in a dark incubator at 28°C for 5 days to accelerate germination.

[0095] The collected in situ soil from the field experiment was packaged into 5 kg PE flat bags and sterilized by autoclaving at 121°C for 1 hour. Equal amounts (50 mL) of the bacterial suspension of the synthetic bacterial consortium (B), the fungal spore suspension of the synthetic fungal consortium (F), and the mixed bacterial suspension of the cross-kingdom synthetic consortium (BF) were inoculated into sterile PE flat bags that had not yet been planted with corn. Sterile water was used as a control. Each treatment was replicated four times and the bags were placed in the greenhouse for one week to acclimate.

[0096] 3. Corn planting and inoculation Retrieve the soil that has been acclimated in the greenhouse for a week and place each bag of soil into individual flower pots (19 cm diameter, 20 cm height). Plant five corn seeds with approximately 2 cm primary roots in each pot and water with 300 mL of water. Place a flat PE bag over the pot to prevent contamination. After two true leaves have grown, remove any seedlings that are showing poor growth. Keep three seedlings per pot that are showing consistent growth and add 50 mL of the corresponding treatment mixture or sterile water to each pot. Return the pots to the greenhouse for incubation. Thereafter, inoculate with 50 mL of the mixture or sterile water every 10 days.

[0097] 4. Control of relative soil moisture content Water treatments were applied one week after corn planting. Two treatments were used: a watered (relative soil moisture content of 75% ± 5%) and a drought (relative soil moisture content of 45% ± 5%) treatment. Soil relative humidity was measured each evening using a soil moisture meter, and evaporative moisture was added to maintain relative soil humidity. Plants were harvested after 30 days of water treatment.

[0098] 5. Determination of corn indicators Measure the height of the corn plants with a tape measure.

[0099] The chlorophyll content of corn plants was measured using a chlorophyll meter.

[0100] After weighing the fresh weight of the corn plants using a balance, the corn plants were placed in envelopes and placed in an oven at 105°C for 1 hour, and then dried at 65°C to constant weight, and their dry weight was weighed.

[0101] On the morning of the day before harvest, the net photosynthetic rate (Pn), intercellular carbon dioxide concentration (Ci), stomatal conductance (Gs), and transpiration rate (Tr) of corn plants were measured using the Li-6400XT portable photosynthesis measurement system.

[0102] Remove the corn plants from their pots, rinse the roots, and dry them with absorbent paper. Spread the roots evenly on a root scanner's root tray and arrange them to ensure each root is clearly visible. Scan the roots using the root scanner and analyze the total root length, root surface area, root volume, and number of root tips.

[0103] The malondialdehyde (MDA) content, proline (Pro) content detection kit, superoxide dismutase (SOD) activity detection kit and peroxidase (POD) activity detection kit of corn plants were respectively measured using the Solebo malondialdehyde (MDA) kit, proline (Pro) content detection kit, superoxide dismutase (SOD) activity detection kit and peroxidase (POD) activity detection kit.

[0104] The results are shown in the attached figure Figure 1 、 Figure 2 、 Figure 3 and Figure 4 As shown, all three synthetic bacterial consortia showed good drought resistance effects on maize. Under drought conditions, the bacterial synthetic consortium increased maize plant height by 25.12%, fresh weight by 40.60%, dry weight by 21.04%, chlorophyll content in leaves by 28.04%, root length by 71.59%, and photosynthetic rate by 83.39%.

[0105] The fungal synthetic flora increased the plant height of corn by 14.85%, the fresh weight of corn by 27.23%, the dry weight of corn by 34.97%, the chlorophyll content of corn leaves by 16.48%, the root length of corn by 66.72%, and the photosynthetic rate of corn by 46.27%.

[0106] The cross-kingdom synthetic bacterial community increased the plant height of corn by 20.51%, the fresh weight of corn by 48.83%, the dry weight of corn by 66.57%, the chlorophyll content of corn leaves by 21.76%, the root length of corn by 101.45%, and the photosynthetic rate of corn by 85.25%.

[0107] The above experimental results show that under drought stress, inoculation with the three synthetic bacterial consortia promoted corn growth, improved corn photosynthetic performance, optimized corn root morphology, and alleviated stress damage to corn. The cross-kingdom synthetic consortium had the most effective effect, followed by the bacterial consortium and the fungal consortium. Under watered conditions, only the cross-kingdom synthetic consortium treatment had a highly significant effect.

[0108] The bacteria Acinetobacter X1 and Enterobacter mulariae X3, and the fungi Talaromyces fungi ZH1 and Aspergillus fumigatus ZH2 used in the present invention are all from drought-treated corn rhizosphere soil. After the selection effect of corn, they can all stably colonize in the roots of corn, and have a synergistic effect on improving the drought resistance of corn and promoting the growth indicators of corn.

[0109] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0110] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0111] Obviously, those skilled in the art may make various modifications and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if such modifications and variations fall within the scope of the claims and their equivalents, the present invention is intended to include such modifications and variations.

Claims

1. A synthetic bacterial consortium for improving drought tolerance of corn, characterized in that: The synthetic flora comprises at least one of a bacterial synthetic flora and a fungal synthetic flora; The bacterial synthetic flora includes Acinetobacter ( Acinetobacter sp .) X1 and Enterobacter mulariae ( Enterobacter mori X3, the effective bacterial count ratio of the Acinetobacter X1 and the Enterobacter mulariae X3 is 1:1; The Acinetobacter X1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242634; the Enterobacter mulariae X3 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242635; The fungal synthetic flora includes Talaromyces fusca ( Talaromyces funiculosus) ZH1 and Aspergillus fumigatus ( Aspergillus fumigatus) ZH2, the effective bacterial count ratio of the Talaromyces fungi ZH1 and the Aspergillus fumigatus ZH2 is 1:1; The Talaromyces funiculosus ZH1 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242637; the Aspergillus fumigatus ZH2 was deposited in the China Center for Type Culture Collection on November 25, 2024, with a deposit number of CCTCC NO: M 20242636; When the synthetic flora comprises both bacterial synthetic flora and fungal synthetic flora, the bacterial synthetic flora and the fungal synthetic flora are mixed in equal volumes.

2. A microbial agent, characterized in that: The microbial agent includes at least one of microbial agent 1, microbial agent 2 and microbial agent 3; The microbial agent includes a bacterial solution of the bacterial synthetic flora; the bacterial solution of the bacterial synthetic flora is obtained by mixing the bacterial solution of Acinetobacter X1 and the bacterial solution of Enterobacter mulariae X3 according to claim 1 in equal volume proportions; The second microbial agent includes a fungal spore suspension of the fungal synthetic flora, which is obtained by mixing a fungal spore suspension of Talaromyces fungi ZH1 and a fungal spore suspension of Aspergillus fumigatus ZH2 in equal volume proportions; The microbial agent three is obtained by mixing the bacterial liquid of the bacterial synthetic flora and the fungal spore suspension of the fungal synthetic flora in equal volume proportions.

3. The microbial agent according to claim 2, characterized in that OD of the bacterial solution of the Acinetobacter X1 and the bacterial solution of the Enterobacter mori X3 600 The values ​​are all between 0.5 and 0.

7.

4. The microbial agent according to claim 2, characterized in that The concentration of the fungal spore suspension of Talaromyces cordifolia ZH1 is 1×10 4 cfu / mL~1×10 6 cfu / mL; the concentration of the Aspergillus fumigatus ZH2 fungal spore suspension is 1×10 4 cfu / mL~1×10 6 cfu / mL.

5. Use of the synthetic bacterial consortium according to claim 1 or the microbial agent according to claim 2 in improving the drought resistance of corn.

6. The use according to claim 5, characterized in that The synthetic bacterial flora or the microbial agent can promote the increase of growth indicators of corn; The growth indicator includes at least one of the following indicators: Plant height, fresh weight, dry weight, leaf chlorophyll content, root length and photosynthetic rate.

7. The use according to claim 5, characterized in that The synthetic bacterial consortium or the microbial agent can reduce the damage to corn caused by drought stress.

8. The use according to claim 5, characterized in that The synthetic bacterial consortium or the microbial agent is applied to the soil in the root zone of corn.

9. The use according to claim 8, characterized in that The frequency of applying the synthetic bacterial community or the microbial agent to the soil in the root zone of corn is once every 10 days, and the amount of the synthetic bacterial community or the microbial agent applied each time is 100 mL / pot plant to 200 mL / pot plant or 500 L / mu to 1000 L / mu.