Bacillus subtilis engineering bacterium capable of efficiently producing pullulanase and application of bacillus subtilis engineering bacterium in trehalose enzyme method production

Abstract

The invention discloses bacillus subtilis engineering bacteria capable of efficiently producing pullulanase and application of the bacillus subtilis engineering bacteria in trehalose enzyme method production, and belongs to the technical field of genetic engineering. The invention discloses a bacillus subtilis engineering bacterium capable of efficiently producing pullulanase. The bacillus subtilis engineering bacterium comprises a pullulanase gene of which the nucleotide sequence is as shown in SEQ ID NO.7. According to the invention, the bacillus subtilis strain is used as an expression host, and the bacillus subtilis is modified through an engineering technical means, so that the pullulanase is highly expressed, and the fermentation cost of pullulanase liquid in the production process of trehalose is reduced.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and more particularly to an engineered bacillus subtilis strain capable of efficiently producing pullulanase and its application in the enzymatic production of trehalose. Background Art

[0002] Pullulanase is a protease that can efficiently remove 1,4 bonds and 1,6 bonds between glucose. It is mainly divided into type I pullulanase and type II pullulanase. Type I pullulanase can remove α-1,6 glycosidic bonds on maltodextrin side chains with at least two glucoses, while type II pullulanase can not only remove the α-1,6 bonds of the side chains, but also the 1,4 bonds between starches. It is often used in the field of starch processing.

[0003] Trehalose is a disaccharide composed of two glucose molecules linked by an α-1,1 glycosidic bond and is widely distributed in various organisms in nature. Currently, trehalose production mainly involves extraction and enzymatic methods. The enzymatic method, with its advantages of simple preparation, low cost, and environmentally friendly production, is the mainstream trehalose production method. The single-enzyme method uses maltose as a substrate and synthesizes trehalose by adding TreS (trehalose synthase), with a conversion rate of 50-70%. The dual-enzyme method uses maltodextrin as a substrate and reacts malto-oligosaccharyl trehalose synthase (MTSase) and malto-oligosaccharyl trehalose hydrolase (MTHase) to produce trehalose, with a conversion rate of approximately 60%. Adding a certain amount of pullulanase and glycosyltransferase to the dual-enzyme method can further increase the conversion rate to approximately 80%. The high conversion rate and low raw material cost make the dual-enzyme method the predominant method for industrial trehalose production.

[0004] Currently, the enzymes required for the dual-enzyme method are typically expressed and produced in E. coli. The potential for endotoxins from E. coli fermentation limits the application of trehalose in the food and pharmaceutical sectors. Bacillus subtilis is a GRAS (Gradually Recognized Assured) strain, but its poor ability to heterologously express pullulanase and low expression levels limit its application in trehalose production.

[0005] Therefore, providing an engineered Bacillus subtilis strain capable of efficiently producing pullulanase and its application in the enzymatic production of trehalose is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides an engineered Bacillus subtilis strain capable of efficiently producing pullulanase and its application in the enzymatic production of trehalose.

[0007] The invention uses Bacillus subtilis strain as an expression host and transforms Bacillus subtilis through engineering technology means to make it highly express pullulanase, thereby reducing the fermentation cost of pullulanase enzyme solution in the trehalose production process.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention mainly analyzes the pullulanase gene and performs codon optimization according to the codon preference of Bacillus subtilis. On this basis, the N-terminal amino acid sequence of the pullulanase is modified, thereby greatly improving the expression level of the pullulanase and obtaining a Bacillus subtilis engineered bacterium that can efficiently produce pullulanase.

[0010] The present invention also determines the optimal addition amount and reaction temperature when the strain is used in trehalose production.

[0011] The present invention provides a pullulanase with optimized codons and N-terminal amino acid sequences, which is based on the pullulanase from Pullulanibacillus naganoensis (nucleotide sequence shown in SEQ ID NO.1); the nucleotide sequence after codon optimization and modification of the N-terminal amino acid is shown in SEQ ID NO.7.

[0012] The amino acid sequence of the protein after the above codon optimization and modification of the N-terminal amino acid is shown in SEQ ID NO.8.

[0013] Furthermore, a recombinant plasmid comprises a pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7.

[0014] Furthermore, an engineered strain of Bacillus subtilis capable of efficiently producing pullulanase comprises a pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7 or the recombinant plasmid.

[0015] Furthermore, the pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7 or the recombinant plasmid or the engineered Bacillus subtilis is used to increase the expression level of pullulanase.

[0016] Furthermore, the pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7 or the recombinant plasmid or the engineered Bacillus subtilis is used to improve the activity of pullulanase.

[0017] Furthermore, the pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7 or the recombinant plasmid or the engineered Bacillus subtilis is used in the enzymatic production of trehalose.

[0018] Furthermore, the pullulanase gene with a nucleotide sequence as shown in SEQ ID NO.7 or the recombinant plasmid or the engineered Bacillus subtilis is used to improve the conversion rate of trehalose.

[0019] Through the above technical solution, it can be seen that compared with the prior art, the present invention discloses a Bacillus subtilis engineered strain that can efficiently produce pullulanase and its application in the enzymatic production of trehalose. The pullulanase derived from Pullulanibacillus naganoensis is optimized according to the codon preference of Bacillus subtilis, and the N-terminal amino acid sequence is modified. The obtained Bacillus subtilis engineered strain can efficiently produce pullulanase, and in the enzymatic conversion method of trehalose production, adding 400 μl of crude enzyme solution can obtain a trehalose conversion rate of more than 80%, which has a high industrial prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0021] Figure 1 PCR amplified gene fragments; 1: 1kb Plus DNA LadderMarker; 2: PCR fragment of pnPUL-wt; 3: PCR fragment of lwkPUL;

[0022] Figure 2 PCR amplified vector fragments; 1: 1kb Plus DNA LadderMarker; 2: pWB980 vector fragment;

[0023] Figure 3 For crude enzyme solution SDS-PAGE; 1: solarbio PR1910 marker; 2: WB600-pnPUL-wt crude enzyme solution; 3: WB600-lwkPUL crude enzyme solution;

[0024] Figure 4 Grayscale scan comparison of pullulanase expression levels between WB600-pnPUL-wt and WB600-lwkPUL;

[0025] Figure 5 The role of pullulanase in the process of producing trehalose from maltodextrin. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Materials and Reagents: The chassis host, Bacillus subtilis WB600, and plasmid pWB980 were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. Plasmid extraction kits and DNA purification and recovery kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; and the SDS-PAGE gel rapid preparation kit was purchased from Shanghai Yazyme Biopharmaceutical Technology. For instructions on using these kits, refer to the product manuals.

[0028] Primer and gene synthesis, and gene sequencing were completed by Qingke Biotechnology Co., Ltd. (Shanghai).

[0029] The competent culture of Bacillus subtilis was prepared according to the Spizizen method and used on the same day.

[0030] In the trehalose production reaction system, maltodextrin was a product produced by Kangtong (Shanghai) Biological Research and Development Co., Ltd., and the disodium hydrogen phosphate and sodium dihydrogen phosphate used in the preparation of phosphate buffer were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.; the MTSase and MTHase ​​expression strains refer to the pBAD-MTSase-op strain and pBAD-MTHase-op strain in patent 202411264163.0; the 4-α-glycosyltransferase expression strain refers to the A470F mutant strain in the literature (Xie Jingwen et al., Semi-rational design to improve the dismutation activity of 4-α-glycosyltransferase and its application in industrial production, Food and Fermentation Industries, ISSN 0253-990X, CN 11-1802 / TS); saccharifying enzyme was purchased from Shandong Longkote Enzyme Preparation Co., Ltd.

[0031] The wild type pullulanase was derived from Pullulanibacillus naganoensis strain ATCC 53909, GenBank: JN872757.1.

[0032] Example 1 Construction of vectors and strains

[0033] 1) Construction of wild-type pullulanase-producing Bacillus subtilis strain WB600-pnPUL-wt

[0034] Pullulanase from Pullulanibacillus naganoensis was heterologously expressed in Bacillus subtilis. Based on the Pullulanase gene sequence from Pullulanibacillus naganoensis (shown in SEQ ID NO. 1), upstream and downstream primers (pnPUL-wt-F / R) were designed for the pnPUL-wt gene. PCR amplification was performed using the synthesized wild-type pullulanase sequence (pnPUL-wt) as a template. The amino acid sequence of the wild-type pullulanase is shown in SEQ ID NO. 2.

[0035] Wild-type pullulanase pnPUL-wt sequence:

[0036] ATGGATGGGAACACCACAAACATCTCTTCATCAAGAAGTAAGCCCATCTGATGGTAAATAG ; SEQ ID NO.1.

[0037] Wild-type pullulanase amino acid sequence:

[0038] MDGNTTNIVVHYFRPSGDYTDWNLWMWPENGDGAEYDFNQPTDSYGEVASVDIPGNPSQVGIIVRKGNWDAKDIDSDRYIDLSKGHEIWLVQGNSQIFYSEKDAEAAAQPAVSNAYLDASNQVLVKLSQPFTLGEGSSGFTVHDDTANKDIPVTSVSDANQVTAVLAGTFQHIFGGSDWAPDNHNTLLKKVNSNLYQFSGNLPEGNYQYKVALNDSWNNPSYPSDNINLTVPAGGAHVTFSYIPSTHAVYDTINNPNADLQVDSSGVKTDLVAVTLGENPDVSHTLSIQTEDYQAGQVIPRKVLDSSQYYYSGDDLGNTYTKNATTFKVWAPTSTQVNVLLYNSATGAVTKTVPMTASGHGVWEATVNQDLENWYYMYEVTGQGSTRTAVDPYATAIAPNGTRGMIVDLAKTDPAGWESDKHITPKNIEDEVIYEMDVRDFSIDSNSGMKNKGKYLALTEKGTKGPDNVKTGVDSLKQLGITHVQLQPVFAFNSVNENDPTQYNWGYDPRNYNVPEGQYATNANGTTRIKEFKEMVLSLHQDHIGVNMDVVYNHTFATQISDFDKIVPEYYYRTDDAGNYTNGSGTGNEIAAERPMVQKFIIDSLKFWVNEYHVDGFRFDLMALLGKDTMSKAATQLHAIDPGIALYGEPWTGGTSALPADQLLTKGAQKGMGVAVFNDNLRNGLDGSVFDSSAQGFATGATGLTDAIKNGVEGSINDFTASPGETINYVTSHDNYTLWDKIAQSNPNDSEADRIKMDELAQAIVMTSQGIPFMQGGEEMLRTKGGNDNSYNAGDVVNEFDWSRKAQYPDVFNYYSGLIHLRLDHPAFRMTTANEINSHLQFLNSPENTVAYELSDHANKDTWGNIVVIYNPNKTAETINLPSGKWEINATSGKVGESTLGQAEGSVQVPGISMMILHQEVSPSDGK; SEQ ID NO.2。

[0039] The primer sequences are as follows:

[0040] pnPUL-wt-F:

[0041] AGGAGACATGAACG ATGGATGGGAACACCACAAACATC ; SEQ ID NO.3.

[0042] pnPUL-wt-R:

[0043] GGAATTGTGCTGAA CTATTTACCATCAGATGGGCTTACTTCTTGATGAAGA ; SEQ ID NO.4.

[0044] PCR amplification reaction system (50 μl): template 1 μl, Prime STARMax DNA Polymerase 25 μl, pnPUL-wt-F 2 μl, pnPUL-wt-R 2 μl, ddH2O 20 μl.

[0045] PCR amplification reaction program: 98°C for 1 min; 98°C for 15 s, 59°C for 15 s, 72°C for 2 min, 32 cycles; 5°C infinity.

[0046] PCR amplification results are shown in Figure 1 Lane 2.

[0047] The pWB980 vector primers were designed based on the pWB980 commercial plasmid. The primer sequences are as follows:

[0048] pWB980-F: TAATTCAGCACAATTCCAAGAAAAACACGAT; SEQ ID NO.5;

[0049] pWB980-R:

[0050] CATCGTTCATGTCTCCTTTTTTATGTACTGTGTTAGCCGT; SEQ ID NO. 6.

[0051] The PCR amplification system and procedure were the same as above.

[0052] PCR amplification results are shown in Figure 2 Lane 2.

[0053] After purification of the gene and vector fragments, the two fragments were incubated at 50°C for 25 minutes using the Minerva SuperFusion Cloning Kit to generate the expression vector pWB980-pnPUL-wt. The constructed expression vector was transformed into competent Bacillus subtilis WB600 cells, incubated at 37°C for two hours, and then plated on 2YT agar plates (16 g / L peptone, 10 g / L yeast extract, 5 g / L sodium chloride, 15 g / L agar powder) containing 50 μg / ml kanamycin for overnight culture for 12-16 hours.

[0054] Single colonies growing on the plates were picked and expanded in vitro, after which plasmids were extracted and sequenced. The positive clones that were sequenced were named WB600-pnPUL-wt, stored in 30% glycerol, snap-frozen in liquid nitrogen, and then stored in a -80°C freezer.

[0055] 2) Construction of pullulanase strain with optimized N-terminal amino acid: WB600-lwkPUL

[0056] In order to improve the expression of the pullulanase in Bacillus subtilis, the wild-type pullulanase gene pnPUL-wt was codon-optimized for the Bacillus subtilis host, and the N-terminal amino acid sequence was optimized. The final pullulanase lwkPUL sequence is shown in SEQ ID NO.7; the amino acid sequence of the pullulanase after the N-terminal amino acid modification is shown in SEQ ID NO.8.

[0057] According to the optimized pullulanase gene sequence (as shown in SEQ ID NO.7), the upstream and downstream primers lwkPUL-F / R of the lwkPUL gene were designed, and PCR amplification was performed using the synthesized optimized pullulanase lwkPUL sequence as a template.

[0058] Pullulanase lwkPUL gene sequence after codon optimization and optimization of the N-terminal amino acid sequence:

[0059] ATGGATGGCAATACAACAACAATTATTGTTCATTACTTCAGACCGAGCGGCGATTATACAGATTGGAA TCTGTGGAGCATCAAGAAGTTAGCCCGTCAGATGGCAAATAA ; SEQ ID NO.7.

[0060] The amino acid sequence of pullulanase after modification of the N-terminal amino acid:

[0061] MDGNTTTIIVHYFRPSGDYTDWNLWMWPENGDGAEYDFNQPTDSYGEVASVDIPGNPSQVGIIVRKGNWDAKDIDSDRYIDLSKGHEIWLVQGNSQIFYSEKDAEAAAQPAVSNAYLDASNQVLVKLSQPFTLGEGSSGFTVHDDTANKDIPVTSVSDANQVTAVLAGTFQHIFGGSDWAPDNHNTLLKKVNSNLYQFSGNLPEGNYQYKVALNDSWNNPSYPSDNINLTVPAGGAHVTFSYIPSTHAVYDTINNPNADLQVDSSGVKTDLVAVTLGENPDVSHTLSIQTEDYQAGQVIPRKVLDSSQYYYSGDDLGNTYTKNATTFKVWAPTSTQVNVLLYNSATGAVTKTVPMTASGHGVWEATVNQDLENWYYMYEVTGQGSTRTAVDPYATAIAPNGTRGMIVDLAKTDPAGWESDKHITPKNIEDEVIYEMDVRDFSIDSNSGMKNKGKYLALTEKGTKGPDNVKTGVDSLKQLGITHVQLQPVFAFNSVNENDPTQYNWGYDPRNYNVPEGQYATNANGTTRIKEFKEMVLSLHQDHIGVNMDVVYNHTFATQISDFDKIVPEYYYRTDDAGNYTNGSGTGNEIAAERPMVQKFIIDSLKFWVNEYHVDGFRFDLMALLGKDTMSKAATQLHAIDPGIALYGEPWTGGTSALPADQLLTKGAQKGMGVAVFNDNLRNGLDGSVFDSSAQGFATGATGLTDAIKNGVEGSINDFTASPGETINYVTSHDNYTLWDKIAQSNPNDSEADRIKMDELAQAIVMTSQGIPFMQGGEEMLRTKGGNDNSYNAGDVVNEFDWSRKAQYPDVFNYYSGLIHLRLDHPAFRMTTANEINSHLQFLNSPENTVAYELSDHANKDTWGNIVVIYNPNKTAETINLPSGKWEINATSGKVGESTLGQAEGSVQVPGISMMILHQEVSPSDGK; SEQ ID NO.8。

[0062] The primer sequences are as follows:

[0063] lwkPUL-F:

[0064] AGGAGACATGAACG ATGGATGGCAATACAACAACAATTATTGTTCATTACTTCAGACCGAGCGGCGAT TATACAGATTGGAATCTGTGGA ; SEQ ID NO.9;

[0065] LwkPUL-R:

[0066] GGAATTGTGCTGAA TTATTTGCCATCTGACGGGCTAACTTCTTGATGC ; SEQ ID NO.10.

[0067] See the results Figure 1 Lane 3. After purification, the PCR product was incubated with the pWB980 vector fragment using the Minerva SuperFusion Cloning Kit at 50°C for 25 minutes to generate the expression vector pWB980-lwkPUL. This expression vector was then transformed into competent Bacillus subtilis WB600 cells, incubated at 37°C for two hours, plated on agar plates containing 50 μg / ml kanamycin, and cultured overnight for 12-16 hours.

[0068] Single colonies growing on the plates were picked and expanded in vitro, after which plasmids were extracted and sequenced. The positive clones that were sequenced were named WB600-lwkPUL, stored in 30% glycerol, snap-frozen in liquid nitrogen, and then stored in a -80°C freezer.

[0069] Example 2 Strain culture and protein expression

[0070] The correctly sequenced recombinant strains WB600-pnPUL-wt and WB600-lwkPUL were inoculated into 5 mL of 2YT liquid culture medium (16 g / L peptone, 10 g / L yeast powder, 5 g / L sodium chloride) containing 50 μg / ml kanamycin resistance, respectively, and cultured in a constant temperature shaker at 37°C and 220 rpm for 8 h. After that, all of them were transferred to 200 mL of 2YT liquid culture medium containing 50 μg / ml kanamycin resistance and continued to be cultured for more than 16 h.

[0071] After the culture is completed, the bacterial solution is poured into a 200 mL centrifuge tube and centrifuged at 4000 rpm for 20 min at room temperature. The supernatant is discarded and pure water is added to the volume until the OD 600 = 25, oscillate to resuspend the cells, and then perform ultrasonic disruption for 20 min to obtain crude pullulanase WB600-pnPUL-wt and WB600-lwkPUL enzyme solutions, respectively.

[0072] The crude enzyme solutions of wild-type WB600-pnPUL-wt and sequence-optimized WB600-lwkPUL were subjected to SDS-PAGE, with the sample volume and protein marker both being 5 μl.Figure 3 The optimized WB600-lwkPUL crude enzyme solution protein band is thicker and darker in color, indicating that its expression level has been effectively improved. The grayscale test of the two crude protein bands was performed using imageJ software, and the target protein grayscale of WB600-pnPUL-wt was used as the unit control group. The target protein expression results of WB600-lwkPUL are shown in Figure 2. Figure 4 The expression level was about 8.32 times that of WB600-pnPUL-wt.

[0073] Example 3 Preparation of crude enzyme solutions of MTSase, MTHase ​​and 4-α-glycosyltransferase

[0074] In the process of producing trehalose from maltodextrin, the roles of maltooligosaccharide trehalose synthase MTSase, maltooligosaccharide trehalose hydrolase MTHase, and 4-α-glycosyltransferase are shown in Figure 5 The strains expressing MTSase, MTHase ​​and 4-α-glycosyltransferase were inoculated into 5 mL of 2YT liquid medium (peptone 16 g / L, yeast powder 10 g / L, sodium chloride 5 g / L) containing 50 μg / ml kanamycin resistance, respectively, and cultured in a constant temperature shaker at 37°C and 220 rpm for 8 h. After that, they were transferred into 200 mL of 2YT liquid medium containing 50 μg / ml kanamycin resistance and cultured until OD 600 =0.8, add 2% arabinose inducer, place in 28 ℃, 220 rpm constant temperature shaker culture for 16 hours. After the culture is completed, pour the bacterial liquid into a 200 mL centrifuge tube, room temperature, 4000 rpm centrifuge for 20 minutes. Discard the supernatant and add pure water to the volume to OD 600 =25, oscillate and resuspend the cells, and then perform ultrasonic disruption for 20 min to obtain crude enzyme solutions of MTSase, MTHase ​​and 4-α-glycosyltransferase, respectively.

[0075] Example 4 Comparative Analysis of Pullulanase-Producing Bacillus subtilis Engineering Bacteria Activity Before and After Optimization

[0076] In the process of producing trehalose from maltodextrin, the role of pullulanase is shown in Figure 5 , is to cut off the side chains on maltodextrin, so as to improve the utilization rate of raw materials.

[0077] The trehalose production reaction system is as follows:

[0078] To a 20 ml reaction system, add 300 g / L maltodextrin, 200-800 μl pullulanase crude enzyme solution, 480 μl MTSase crude enzyme solution, 480 μl MTHase ​​crude enzyme solution, 600 μl 4-α-glycosyltransferase crude enzyme solution, and 500 μl disodium hydrogen phosphate / sodium dihydrogen phosphate buffer (mother liquor 1 M, pH 6.0), and add ddH2O to make the volume up to 20 ml.

[0079] Trehalose production reaction conditions and subsequent treatment are as follows:

[0080] The reaction system was placed at 55-60°C and 120 rpm for 12 hours. After the reaction, the pH was adjusted to approximately 4.3, 500 μl of commercial saccharifying enzyme (enzyme activity 130,000 U / ml) was added, and hydrolysis was continued at 60°C for 1 hour to completely hydrolyze the remaining maltooligosaccharides in the reaction system into glucose for subsequent product detection. After the reaction, the system was boiled and inactivated for 10 minutes. After centrifugation, the supernatant was removed and 50 μl of the reaction solution was aspirated and added to 1450 μl of ultrapure water, diluted 30-fold, and prepared for liquid chromatography detection.

[0081] Liquid phase detection and conversion rate calculation are as follows:

[0082] The sample was filtered through a 0.22 μm water filter and then set aside. The liquid chromatography system was first flushed with ultrapure water as the mobile phase at a flow rate of 0.5 mL / min for 0.5-1 h. A Sugar-Pak Column (10 μm, 6.5 mm × 300 mm) was then installed. After the baseline and pressure stabilized, 10 μL of the sample, filtered through a 0.22 μm water filter, was injected. The sugar components in the sample were qualitatively determined based on the retention time of the standard, and the trehalose conversion rate was calculated based on the peak area ratio of the sample. The conversion results are shown in Table 1.

[0083] Table 1 Results of trehalose reaction catalyzed by the multi-enzyme catalytic system involving pullulanase

[0084]

[0085]

[0086] A 200μl reaction of the crude pnPUL-wt enzyme at 55°C for 12 hours yielded only a 61.7% conversion rate, while the optimized lwkPUL crude enzyme achieved a 79.4% conversion rate under the same conditions. This demonstrates that the codon-optimized and N-terminal amino acid-optimized pullulanase strain WB600-lwkPUL outperformed the WB600-pnPUL-wt in both pullulanase expression and activity. Temperature gradient experiments also demonstrated that the pullulanase exhibited good activity within the reaction temperature range of 55-60°C, with a maximum conversion rate of 82.1%.

[0087] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A pullulanase gene, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

7.

2. The protein encoded by the pullulanase gene according to claim 1, characterized in that Its amino acid sequence is shown in SEQ ID NO.

8.

3. A recombinant plasmid, characterized in that: Comprising the pullulanase gene according to claim 1.

4. An engineered Bacillus subtilis strain capable of efficiently producing pullulanase, characterized in that: Comprising the pullulanase gene according to claim 1 or the recombinant plasmid according to claim 3.

5. Use of the pullulanase gene according to claim 1, the recombinant plasmid according to claim 3, or the engineered Bacillus subtilis strain according to claim 4 in increasing the expression level of pullulanase.

6. Use of the pullulanase gene according to claim 1, the recombinant plasmid according to claim 3, or the engineered Bacillus subtilis strain according to claim 4 in improving pullulanase activity.

7. Use of the pullulanase gene according to claim 1, the recombinant plasmid according to claim 3, or the engineered Bacillus subtilis strain according to claim 4 in the enzymatic production of trehalose.

8. Use of the pullulanase gene according to claim 1, the recombinant plasmid according to claim 3, or the engineered Bacillus subtilis according to claim 4 in improving the conversion rate of trehalose.

Images