Method for constructing high-expression genetically engineered bacteria of antibacterial peptide Apidaecin IB

By integrating Ty1Cons2 transposon in Saccharomyces cerevisiae, the high expression genetic engineering bacteria of the antimicrobial peptide Apidaecin IB is solved, and the problem of limited sources and high cost of antimicrobial peptides is achieved, which is of great significance to drug development.

CN120574875APending Publication Date: 2025-09-02ACAD OF NAT FOOD & STRATEGIC RESERVES ADMINISTRATION

Patent Information

Application Number
CN202510729178.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2025-09-02

AI Technical Summary

Technical Problem

In the prior art, in-depth research on the antibacterial peptide Apidaecin IB faces problems such as limited source, high cost, easy degradation by proteases, and possible hemolyticity and cytotoxicity, and traditional methods are difficult to achieve efficient expression and broad-spectrum antibacterial effects.

Method used

By integrating Ty1Cons2 transposon into Saccharomyces cerevisiae CENPK2, the antibacterial peptide Apidaecin IB is constructed to achieve multi-copy expression and improve its antibacterial activity against E. coli.

Benefits of technology

It reduces production costs, significantly improves the antibacterial activity of antibacterial peptides on E. coli, and has important drug development potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120574875A_ABST
    Figure CN120574875A_ABST
Patent Text Reader

Abstract

The invention discloses a method for constructing an antibacterial peptide Apidaecin IB high-expression genetically engineered bacterium, which comprises the following steps of: 1, designing three pairs of primers according to a DNA sequence of an amplification template coding region, carrying out PCR (Polymerase Chain Reaction) amplification, and constructing expression plasmids in escherichia coli; step 2, carrying out multiplication culture on engineering bacteria saccharomyces cerevisiae CENPK2, preparing saccharomyces cerevisiae competent cells, and subpackaging and refrigerating for later use; step 3, carrying out enzyme digestion on the constructed expression plasmid, and carrying out mixed transformation on the expression plasmid and a competent cell of saccharomyces cerevisiae CENPK2, so as to obtain the high-expression genetic engineering bacterium CENPK2-Apidaecin IB-Ty1Cons2 of the antibacterial peptide Apidaecin IB, wherein the high-expression genetic engineering bacterium CENPK2-Apidaecin IB-Ty1Cons2 is obtained; according to the invention, the Ty1Cons2 transposon is integrated into the saccharomyces cerevisiae CENPK2, so that the construction of the high-expression gene engineering bacterium of the antibacterial peptide Apidaecin IB is completed, and multiple copies are realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB. Background Art

[0002] At present, a variety of new antibacterial agents have been discovered and gradually applied in practice to solve the serious problem of bacterial resistance caused by the abuse of antibiotics, including phage preparations, enzyme preparations, plant extracts, Chinese herbal preparations and antimicrobial peptides. Among them, antimicrobial peptides have become a research hotspot in the "antibiotic alternative field" due to their unique advantages and are considered to be the most promising antibiotic alternative.

[0003] Natural antimicrobial peptides are a class of small molecule cationic polypeptides produced autonomously by organisms and obtained through extraction, concentration and purification. They have multiple bactericidal mechanisms and exhibit high efficiency and broad-spectrum bactericidal properties. They have important research value in inhibiting drug-resistant bacteria and preparing new antibiotics. In the medical field, antimicrobial peptides can be used to treat multidrug-resistant bacterial infections, especially in skin infections, respiratory infections and intestinal infections. They have potential application value. In animal husbandry, antimicrobial peptides can be used as feed additives to replace antibiotics and reduce antibiotic residues in the food chain. In agriculture, antimicrobial peptides can be used for plant protection, inhibit the growth of pathogens, and reduce the use of chemical pesticides.

[0004] The antimicrobial peptide Apidaecin IB is produced by infection-induced production in Hymenoptera insects. It was first isolated from the hemolymph of the honey bee (Apis mellifera). It is a type of small molecule short peptide composed of 18 amino acids, including 3 arginine and 6 proline residues, with a molecular weight of 2.1kDa. The antimicrobial peptide Apidaecin IB has a strong antibacterial effect mainly against Gram-negative bacteria such as Escherichia coli, but it only has antibacterial activity in the hemolymph of adult bees, and only a considerable number of inactive precursor molecules are present in the larvae.

[0005] The antibacterial mechanism of Apidaecin IB is different from that of traditional antimicrobial peptides. It does not rely on destroying cell membranes, but instead exerts its effects by targeting specific molecules inside bacteria. It has potential application value in feed additives, food preservation, and the development of new antimicrobial drugs.

[0006] However, in-depth research on the antimicrobial peptide Apidaecin IB still faces major problems, such as limited sources of natural peptides, high costs, easy degradation by proteases, and possible hemolytic and cytotoxic properties. Compared with traditional methods such as direct isolation of antimicrobial peptides from organisms or chemical synthesis of antimicrobial peptides, the use of genetic engineering technology to synthesize antimicrobial peptides is simpler and can effectively overcome the defects of natural antimicrobial peptides such as sensitivity to proteases, high cytotoxicity, and high extraction costs. It has gradually become one of the main ways to obtain antimicrobial peptides.

[0007] Saccharomyces cerevisiae has unique advantages in the field of genetic engineering. It does not produce toxins and is widely used in food production, pharmaceutical protein production, etc. Compared with prokaryotic expression systems, Saccharomyces cerevisiae has relatively complete post-translational modification and secretion capabilities, which can achieve efficient expression of exogenous proteins at low cost; and the Ty1Cons2 transposon is an important retrotransposon in Saccharomyces cerevisiae, usually existing in multiple copies.

[0008] Therefore, the present invention proposes a method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB. By integrating the Ty1Cons2 site, a genetically engineered yeast strain of Saccharomyces cerevisiae is constructed to achieve multi-copy expression of the target protein, thereby increasing its expression level and antibacterial activity against Escherichia coli, which is of great significance. Summary of the Invention

[0009] In response to the above problems, the present invention aims to propose a method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB. This method integrates the Ty1Cons2 transposon into the Saccharomyces cerevisiae CENPK2 to complete the construction of a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB, thereby achieving multiple copies. This method is of great significance for the development of drugs against Escherichia coli infections.

[0010] To achieve the purpose of the present invention, the present invention is implemented through the following technical solution: an antimicrobial peptide Apadaecin IB, the amino acid sequence of the antimicrobial peptide Apadaecin IB is shown in SEQ ID NO.1.

[0011] A method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB comprises the following steps:

[0012] Step 1: Based on the coding region DNA sequences of the amplification templates pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-Apidaecin IB, three pairs of primers were designed and PCR amplified to obtain nucleic acid fragments containing the TEF1 promoter, Apidaecin IB-FLAG tag, and ADH1 terminator, respectively, and expression plasmids were constructed in Escherichia coli;

[0013] Step 2: amplify and culture the engineered bacteria Saccharomyces cerevisiae CENPK2 to prepare Saccharomyces cerevisiae competent cells, and aliquot and refrigerate for later use;

[0014] Step 3: The constructed expression plasmid was digested with enzymes and mixed with Saccharomyces cerevisiae CENPK2 competent cells for transformation, thereby obtaining the antimicrobial peptide Apidaecin IB highly expressed genetically engineered bacteria CENPK2-Apidaecin IB-Ty1Cons2.

[0015] A further improvement is that the templates pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-Apidaecin IB in step 1 are obtained by gene synthesis and stored in a -20°C refrigerator, and the nucleotide sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

[0016] A further improvement is that the three pairs of primers in step 1 are Primer1 and Primer2, Primer3 and Primer4, Primer5 and Primer6, and their nucleotide sequences are shown as SEDID NO.5, SEDID NO.6, SEDID NO.7, SEDID NO.8, SEDID NO.9 and SEDID NO.10 respectively.

[0017] The further improvement is that: the primer pair Primer1 and Primer2 are used to amplify a DNA fragment with a length of 676 bp (TEF1 promoter) on pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG; the primer pair Primer3 and Primer4 are used to amplify a DNA fragment with a length of 77 bp (Apidaecin IB-FLAG) on pPICZaA-HSAD2-D3-Apidaecin IB; and the primer pair Primer5 and Primer6 are used to amplify a DNA fragment with a length of 114 bp (ADH1 terminator) on pPICZaA-HSAD2-D3-Apidaecin IB.

[0018] A further improvement is that the mixed conversion method in step three is one of an electrical conversion method and a chemical conversion method.

[0019] The beneficial effects of the present invention are as follows: the present invention completes the construction of a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB by integrating the Ty1Cons2 transposon into Saccharomyces cerevisiae CENPK2, thereby achieving multiple copies; compared with natural antimicrobial peptides, the production cost is reduced; compared with Saccharomyces cerevisiae CENPK2, the obtained antimicrobial peptide genetically engineered strain has significantly improved antibacterial activity against Escherichia coli, which is of great significance for the development of drugs against Escherichia coli infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The construction diagram of the recombinant plasmid Apidaecin IB-Ty1Cons2 of the present invention.

[0021] Figure 2 This is a verification diagram of the recombinant plasmid Apidaecin IB-Ty1Cons2 of the present invention being transformed into Escherichia coli Top10.

[0022] Figure 3 This is a colony PCR verification diagram of the expression plasmid Apidaecin IB-Ty1Cons2 of the present invention transferred into Saccharomyces cerevisiae CENPK2.

[0023] Figure 4 This is a Tricine-SDS-Page verification diagram of CENPK2-Apidaecin IB-Ty1Cons2 of the present invention. DETAILED DESCRIPTION

[0024] In order to deepen the understanding of the present invention, the present invention will be further described in detail below with reference to the examples. The examples are only used to explain the present invention and do not constitute a limitation on the scope of protection of the present invention.

[0025] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent suppliers.

[0026] according to Figures 1-4 As shown, this embodiment provides an antimicrobial peptide Apadaecin IB, the amino acid sequence of the antimicrobial peptide Apadaecin IB is shown in SEQ ID NO.1, specifically: GNNRPVYIPQPRPPHPRL.

[0027] A method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB comprises the following steps:

[0028] Step 1: Based on the coding region DNA sequences of the amplification templates pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-Apidaecin IB, three pairs of primers were designed for PCR amplification to obtain fragments containing the TEF1 promoter, Apidaecin IB-FLAG tag, and ADH1 terminator, respectively, and expression plasmids were constructed in Escherichia coli;

[0029] The amplification templates pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-Apidaecin IB were obtained by gene synthesis and stored in a -20°C refrigerator. The nucleotide sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

[0030] The three pairs of primers are Primer1 and Primer2, Primer3 and Primer4, Primer5 and Primer6, and the nucleotide sequences are shown as SEDID NO.5, SEDID NO.6, SEDID NO.7, SEDID NO.8, SEDID NO.9 and SEDID NO.10, respectively.

[0031] Primer pair Primer1 and Primer2 were used to amplify a 676 bp pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG DNA fragment (TEF1 promoter nucleic acid fragment); primer pair Primer3 and Primer4 were used to amplify a 77 bp pPICZaA-HSAD2-D3-Apidaecin IB DNA fragment (Apidaecin IB-FLAG nucleic acid fragment); primer pair Primer5 and Primer6 were used to amplify a 114 bp pPICZaA-HSAD2-D3-ApidaecinIB DNA fragment (ADH1 terminator nucleic acid fragment).

[0032] Step 2: amplify and culture the engineered bacteria Saccharomyces cerevisiae CENPK2 to prepare Saccharomyces cerevisiae competent cells, and aliquot and refrigerate for later use;

[0033] Step 3: The constructed expression plasmid was digested with enzymes and mixed with Saccharomyces cerevisiae CENPK2 competent cells for transformation, thereby obtaining the antimicrobial peptide Apidaecin IB highly expressed genetically engineered bacteria CENPK2-Apidaecin IB-Ty1Cons2.

[0034] The hybrid transformation method is electroporation, and the specific steps are: first, prepare Saccharomyces cerevisiae CENPK2 competent cells, then mix the expression plasmid after enzyme digestion with the competent cells and culture them, and then plate them.

[0035] The starting vector used to construct the expression plasmid is the E. coli vector pUC57, which contains the initiation site ori, the multiple cloning site MCS and the selectable marker gene ampR.

[0036] Since the expression plasmid has a KIURA3 expression cassette, after it is transformed into Saccharomyces cerevisiae competent cells, it can be screened in SC-U medium to obtain transformant strains. The nucleotide sequences of primer pairs Primer7 and Primer8 shown in the sequence listing SEDID NO.11 and SEDID NO.12 are used to verify them, and finally the antimicrobial peptide Apidaecin IB highly expressed genetically engineered bacteria CENPK2-Apidaecin IB-Ty1Cons2 are obtained.

[0037] The present application further provides the use of the antimicrobial peptide Apidaecin IB expressed by the above-mentioned genetically engineered bacteria in treating Escherichia coli infection, which is of great significance.

[0038] In this application, the antimicrobial peptide high-expressing genetically engineered strain was passaged on SC-U plates, the stably passaged strain was fermented and cultured, and compared with Saccharomyces cerevisiae CENPK2 (original strain) to verify its improved antibacterial activity against Escherichia coli.

[0039] Application Examples

[0040] 1. Construction of the expression plasmid Apidaecin IB-Ty1Cons2

[0041] 1. Obtaining amplification template

[0042] pUC57-Ty1Cons2-TEF-alphadel57-70-CLPx2-FLAG, pPICZaA-HS AD2-D3-Apidaecin IB, and pUC57-Ty1Cons2-5'-TADH-1TCYC1-URA3-3' are all gene synthesis amplification templates, synthesized by Sangon Biotech (Shanghai) Co., Ltd., and stored in a -20°C refrigerator. The nucleotide sequences are shown in SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, respectively.

[0043] 2. Primer design

[0044] According to the DNA sequences of the coding regions of pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPIC ZaA-HSAD2-D3, three pairs of primers were designed for amplification, and primers were designed for PCR verification and sequencing of the expression plasmids.

[0045] The specific primer pair Primer1 and Primer2 were used to amplify the 676 bp pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG DNA fragment, the nucleotide sequence of which is:

[0046] Primer1 (TEF1-F (Gib), forward primer, nucleotide sequence shown in SED ID NO. 5) TCGGTTAGAGCGGATGCATGAGTGATCCCCCACACACCATAG;

[0047] Primer2 (a57-70-Api-R (Gib), reverse primer, nucleotide sequence shown in SED ID NO. 6) TGTTGTTACCCCTTTTCTCGAGAGATACCCCTTC.

[0048] Primer pair Primer3 and Primer4 were used to amplify a 77 bp pPICZaA-HSAD2-D3-ApidaecinIB DNA fragment with the following nucleotide sequence:

[0049] Primer3 (Api-1-F (Gib), forward primer, nucleotide sequence shown in SED ID NO. 7) CGAGAAAAGGGGTAACAACAGACCAGTTTAC;

[0050] Primer4 (Api-1-R (Gib), reverse primer, nucleotide sequence shown in SED ID NO. 8) CCTTGTAATCTCACAATCTTGGATGTGGTGG.

[0051] Primer pair Primer5 and Primer6 were used to amplify the 114 bp pPICZaA-HSAD2-D3-ApidaecinIB DNA fragment, the nucleotide sequence of which is:

[0052] Primer 5 (Api-2-F (Gib), forward primer, nucleotide sequence shown in SED ID NO. 9) AAGATTGTGAGATTACAAGGATGATGACGACAAG;

[0053] Primer6 (Api-2-R (Gib), reverse primer, nucleotide sequence shown in SED ID NO. 10) TCATAAATCATAAGAAATTCGCGTCACAATCTTGGATGTGGTG.

[0054] The primer pair used for PCR verification and sequencing of the expression plasmid Apidaecin IB-Ty1Cons2 was Primer7 and Primer8, and the nucleotide sequence was:

[0055] Primer 7 (CYC1-seq, forward primer, nucleotide sequence shown in SED ID NO. 11) GGGACCTAGACTTCAGGTTG;

[0056] Primer8 (ADH1-seq, reverse primer, nucleotide sequence shown in SED ID NO.12) GAGAAAGCAACCTGACCTAC.

[0057] 3. PCR amplification of gene synthesis fragments pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3

[0058] Using pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG as template, primers Primer1 and Primer2, and KOD One TM PCR amplification was performed using PCR Master Mix. The amplification conditions were as follows: 98°C for 10 seconds, annealing at 58°C for 5 seconds, and 68°C for 1 second, for a total of 10 cycles; then 98°C for 10 seconds, annealing at 64°C for 5 seconds, and 68°C for 1 second, for a total of 35 cycles.

[0059] Using pPICZaA-HSAD2-D3-Apidaecin IB as a template, PCR amplification was performed using primers Primer3 and Primer4, Primer5 and Primer6, respectively, and KOD One TM PCR Master Mix, the only difference is that the annealing temperatures of the amplification primers are 52°C and 63°C, and 51°C and 61°C, respectively.

[0060] After the reaction was completed, the PCR products were subjected to 2% agarose gel electrophoresis to detect the expected specific bands at 676 bp, 77 bp and 114 bp, respectively. The three target bands were cut out and recovered on gel for subsequent vector construction.

[0061] 4. Construction of Apidaecin IB-Ty1Cons2 expression plasmid

[0062] Apidaecin IB-Ty1Cons2 expression vector is as attached to the instruction manual. Figure 2 The specific method is as follows: the plasmid pUC57-Ty1Cons2-5'-TADH-1TCYC1-URA3-3' was double-digested with EcoRI and SphI, the digestion product was recovered by gel gel, and the recovered product was Gibson assembled with the amplified fragment using the Uniclone One Step Seamless Cloning Kit (Beijing Jinsha Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli Top10 competent cells and cultured overnight at 37°C on LB plates containing 100 mg / mL ampicillin. A single white colony was picked and the correctness of the plasmid construction was verified using primers Primer7 and Primer8. The resulting plasmid was named Apidaecin IB-Ty1Cons2, and the instructions are attached. Figure 3 This is a verification diagram of the expression plasmid Apidaecin IB-Ty1Cons2 transformed into Escherichia coli Top10. In the figure, M: DNA marker (TakaraDL5000), and lanes 1.2.3 are all Apidaecin IB-Ty1Cons2.

[0063] This step can achieve efficient transformation of the plasmid, thereby obtaining E. coli Top10 transformed colonies carrying the expression plasmid, which are further transferred into the expression strain for protein production.

[0064] 2. Transformation of Saccharomyces cerevisiae CENPK2 with the expression plasmid Apidaecin IB-Ty1Cons2 and verification

[0065] 1. Preparation of Saccharomyces cerevisiae CENPK2 competent cells

[0066] Take a single colony of Saccharomyces cerevisiae CENPK2 and inoculate it into 6 mL of YPD liquid medium containing chloramphenicol (Cm), and culture it at 29°C with shaking at 220 rpm for 2-3 days. Transfer it to 40 mL of YPD liquid medium at a 2% inoculum volume and culture it under the same conditions until the OD 600 The value reaches 1.3-1.5.

[0067] The following operations must be sterile and low temperature, and will reach OD 600Transfer the culture to a 50mL centrifuge tube, incubate on ice for 10 minutes, and then centrifuge at 5000 rpm for 5 minutes at 4°C. Discard the supernatant. Wash the pellet sequentially with equal volumes of pre-chilled sterile water, 1 / 2 volume of pre-chilled sterile water, 1 / 4 volume of pre-chilled 1M sorbitol solution, and 1 / 8 volume of pre-chilled 1M sorbitol solution. Washing conditions: centrifuge at 5000 rpm for 5 minutes at 4°C. Discard the supernatant. Resuspend the pellet in 400μL of pre-chilled 1M sorbitol solution. Aliquot 200μL into 1.5mL sterile EP tubes, store on ice, and use the same day.

[0068] 2. Electroporation of the expression plasmid Apidaecin IB-Ty1Cons2 into Saccharomyces cerevisiae CENPK2

[0069] Take 200 μL of prepared CENPK2 competent cells, add 5 μg of ScaI-digested plasmid Apidaecin IB-Ty1Cons2 (the volume should not exceed 1 / 10 of the competent cells), pipette to mix, and place on ice for 5 minutes. Transfer the mixture to a pre-cooled 0.2 cm electric shock cup, use an electroporator, set the parameters: 1500V, 25 μF, 200Ω, and perform electric shock. Immediately after electric shock, add 1 mL of pre-cooled 1M sorbitol solution, mix well, take an appropriate amount of bacterial solution and spread it on SC-U screening medium, culture at 29°C for 3-5 days, until a single colony CENPK2-Apidaecin IB-Ty1Cons2 is formed, and screen positive clones for subsequent expression experiments. Instructions attached Figure 3 This is a colony PCR verification image of the transformation of Apidaecin IB-Ty1Cons2 into Saccharomyces cerevisiae CENPK2. In the image, M: DNA marker (Takara DL5000). Lanes 1, 2, and 3 all represent Apidaecin IB-Ty1Cons2.

[0070] 3. Fermentation expression and verification of the engineered strain CENPK2-Apidaecin IB-Ty1Cons2

[0071] 1. Seed liquid culture

[0072] A single colony of CENPK2-Apidaecin IB-Ty1Cons2 was picked from the SC-U solid plate and inoculated into 6 mL of SC-U liquid medium (without antibiotics). CENPK2 was used as a control and cultured at 29°C, 220 rpm, with shaking for 12-16 hours. Among them, the seed culture medium is: adenine 0.1g, arginine 0.1g, cysteine ​​0.1g, leucine 0.1g, lysine 0.1g, threonine 0.1g, tryptophan 0.1g, aspartic acid 0.05g, histidine 0.05g, isoleucine 0.05g, methionine 0.05g, phenylalanine 0.05g, proline 0.05g, serine 0.05g, tyrosine 0.05g, valine 0.05g, Yeast Nitrogen Base 6.7 g, dilute to 900 mL with deionized water, sterilize under high pressure at 121°C for 20 min, add 100 mL of 20% glucose or 20% galactose before use. If preparing solid culture medium, add 2% agar.

[0073] 2. Shake flask fermentation of original strains and engineered strains

[0074] The seed liquid was transferred to 40mL YPD fermentation medium at a 1% inoculum volume, and three biological replicates were set up. The culture was cultured at 29°C and 220rpm for 5d and 10d respectively. After the fermentation, the bacterial liquid was centrifuged at 5000rpm for 10min, the supernatant was collected, and centrifuged again at 12000rpm for 10min. The supernatant was retained and stored at 4°C for a short time for subsequent experiments. Among them, the fermentation medium is: 10g yeast extract, 20g peptone, deionized water is adjusted to 900mL, and it is sterilized by high pressure at 121°C for 20min. Before use, 100mL of 20% glucose is added. If a solid culture medium is prepared, 2% agar needs to be added.

[0075] 3. Tricine-SDS-Page Verification

[0076] Use 15.5% concentration of separation gel to perform Tricine-SDS-Page gel electrophoresis qualitative analysis on the fermentation supernatant. Take 40μL of fermentation supernatant, add 10μL of protein loading buffer, mix thoroughly, and heat in a boiling water bath for 5 minutes to denature the protein. Cool to room temperature, centrifuge for 2 minutes, and store on ice. Place the electrophoresis tank in a 4°C environment or an ice water bath, add 1× anode electrophoresis buffer to the outer tank, add 1× cathode electrophoresis buffer to the inner tank, add the treated sample and Marker to the spotting hole, and perform electrophoresis at 30V for 1 hour, and then at 100V until bromophenol blue reaches the bottom of the gel, stop electrophoresis, and stain with Coomassie Brilliant Blue for 1 hour. Instructions attached Figure 4 This is the Tricine-SDS-Page verification image of CENPK2-Apidaecin IB-Ty1Cons2. The expected size of the target band is 5.2 kDa. M in the figure: protein marker (TureColor 2.7-40 kDa). Lanes 1.2.3 are CENPK2-Apidaecin IB-Ty1Cons2 fermentation supernatant samples.

[0077] 4. Antibacterial activity and expression analysis

[0078] The 96-well plate method was used to determine the antibacterial rate. The specific operation is as follows:

[0079] 1. Inoculate E. coli O157:H7 into 6 mL of antibiotic-free LB liquid medium and culture at 37°C with shaking at 220 rpm for 12-16 hours. Transfer the inoculum to 1% of the original volume and culture until the OD 600 =1, dilute 10 times, and prepare bacterial suspension for later use.

[0080] 2. Mix the bacterial suspension with the supernatant obtained in Application Example 5 (Fermentation Expression and Verification of the Engineered Strain CENPK2-Apidaecin IB-Ty1Cons2) at a 1:1 ratio. Add 100 μL of the supernatant to a 96-well plate, then add 100 μL of the bacterial suspension and mix thoroughly by pipetting. Use PBS containing the bacterial suspension as a negative control, PBS as a blank control, and various concentrations of pure peptide Apidaecin IB as a standard. Incubate at 37°C for 12-16 hours, with three biological replicates per group. Measure the absorbance at 600 nm using a microplate reader.

[0081] 3. According to the formula: The inhibition rate was calculated and the expression level was analyzed. OD1 represents the PBS group containing bacterial solution, OD2 represents the experimental group, and OD3 represents the PBS group. The results are shown in Table 1 below.

[0082] Table 1 Inhibition rate of CENPK2-Apidaecin IB-Ty1Cons2

[0083]

[0084] As shown in Table 1, the engineered bacteria CENPK2-Apidaecin IB-Ty1Cons2 exhibited excellent antibacterial efficacy, with inhibition rates of 97.4%, 95.6%, and 93.7%, respectively, with an average inhibition rate of 95.57 ± 1.51%. By comparing the concentrations of the standard product at different concentrations, it can be estimated that the expression level of the antimicrobial peptide Apidaecin IB ranged from 128 to 256 μM.

[0085] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the foregoing embodiments. The foregoing embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB, wherein the amino acid sequence of the antimicrobial peptide Apidaecin IB is shown in SEQ ID NO. 1, characterized in that: The following steps are involved: Step 1: Based on the coding region DNA sequences of templates pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-ApidaecinIB, three pairs of primers were designed for PCR amplification to obtain fragments containing the TEF1 promoter, ApidaecinIB-FLAG tag, and ADH1 terminator, respectively, and expression plasmids were constructed in Escherichia coli; Step 2: amplify and culture the engineered bacteria Saccharomyces cerevisiae CENPK2 to prepare Saccharomyces cerevisiae competent cells, and aliquot and refrigerate for later use; Step 3: The constructed expression plasmid is digested with enzymes and mixed with competent cells of Saccharomyces cerevisiae CENPK2 for transformation, thereby obtaining the antimicrobial peptide Apidaecin IB highly expressed genetically engineered bacteria CENPK2-ApidaecinIB-Ty1Cons2.

2. The method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB according to claim 1, characterized in that: The pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG and pPICZaA-HSAD2-D3-Apidaecin IB in the step 1 were obtained by gene synthesis and stored in a -20°C refrigerator. The nucleotide sequences are shown in SEQ ID NO. 2 and SEQ ID NO. 3, respectively.

3. The method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB according to claim 1, characterized in that: The three pairs of primers in step 1 are Primer1 and Primer2, Primer3 and Primer4, Primer5 and Primer6, and their nucleotide sequences are shown as SEDID NO.5, SEDID NO.6, SEDID NO.7, SEDID NO.8, SED ID NO.9 and SEDID NO.10, respectively.

4. The method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB according to claim 3, characterized in that: The primer pair Primer1 and Primer2 are used to amplify a pUC57-Ty1Cons2-TEF-alphadel57-70-CLP1x2-FLAG DNA fragment with a length of 676 bp; the primer pair Primer3 and Primer4 are used to amplify a pPICZaA-HSAD2-D3-Apidaecin IB DNA fragment with a length of 77 bp; and the primer pair Primer5 and Primer6 are used to amplify a pPICZaA-HSAD2-D3-Apidaecin IB DNA fragment with a length of 114 bp.

5. The method for constructing a genetically engineered bacterium that highly expresses the antimicrobial peptide Apidaecin IB according to claim 1, characterized in that: The mixed conversion method in step three is one of an electrochemical conversion method and a chemical conversion method.

Citation Information

Patent Citations

  • Expression and enlarged culture of Apidaecin type antibacterial peptide in Pichia yeast

    CN103352046A

  • Genetically engineered saccharomyces cerevisiae strains capable of realizing high yield of santalene and santalol as well as construction method and application of genetically engineered saccharomyces cerevisiae strains

    CN112852650A

  • Compositions and methods related to serpin SPI6

    WO2006091773A2

Cited By

  • Multi-copy expression construction method of insecticidal fusion peptide U10-MYRTX-Mri1a-GNA with bacteriostatic activity in pichia pastoris

    CN121575023A