A therapeutic target for pancreatic cancer targeting ECHS1 K115 and its application

Abstract

This invention belongs to the field of biomedicine, specifically relating to a therapeutic target for pancreatic cancer targeting the ECHS1 K115 site and its application. Through experiments, this invention discovered that the level of lysine succinylation modification at position 115 of the ECHS1 protein (ECHS1 K115su) is significantly decreased in pancreatic cancer tumors, and for the first time, the presence of this modification was confirmed using a specific succinylation modification antibody. Further findings revealed that K115 succinylation modification can mediate the conversion efficiency of ECHS1 protein to its substrates, thereby inhibiting fatty acid β-oxidation metabolism in pancreatic cancer cells. In vitro and in vivo functional experiments confirmed that ECHS1 K115 succinylation modification inhibits the proliferation of pancreatic cancer tumor cells and tumor volume growth.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to a therapeutic target for pancreatic cancer targeting the ECHS1 K115 site and its application. Background Technology

[0002] Pancreatic cancer is one of the most common aggressive malignant tumors, with an extremely low 5-year survival rate, far lower than other common digestive system tumors such as gastric and colorectal cancer. Due to nonspecific early symptoms and ineffective screening tools, most patients are diagnosed at an advanced stage. Pancreatic cancer is divided into two types: pancreatic ductal adenocarcinoma (PDAC), which accounts for more than 90% of cases, and rare endocrine tumors originating from pancreatic islet cells. Major risk factors include smoking, chronic pancreatitis, diabetes, and a family history of pancreatic cancer, while genetic susceptibility, such as BRCA1 / 2 and PALB2 mutations, further increases susceptibility. Progression of pancreatic cancer involves various genetic alterations, including mutations in oncogenes such as the activating rat sarcoma virus oncogene homolog (KRAS), and the inactivation of tumor suppressor genes such as the tumor protein p53 (TP53) and the cyclin-dependent kinase inhibitor 2A (CDKN2A). Despite advances in surgical intervention, chemotherapy, and targeted therapy, the prognosis remains grim due to the late detection and high metastasis rate of pancreatic cancer. Therefore, by conducting in-depth research on the molecular mechanisms of pancreatic cancer occurrence and development, and identifying potential diagnostic and therapeutic targets, more targeted drugs can be developed, thereby improving treatment outcomes.

[0003] Post-translational modifications (PTMs) of proteins include glycosylation, ubiquitination, succinylation, acetylation, phosphorylation, palmitoylation, lactation, and other protein modifications. PTMs occur on different amino acid side chains or peptide bonds and are usually mediated by proteases. More than 200 enzymes associated with PTMs are found in 5% of the proteome. These enzymes include kinases, phosphatases, transferases, proteases, and ligases, which add or remove functional groups, proteins, lipids, or sugars from amino acid side chains. Many proteins can also self-modify using autocatalytic domains, such as autokinases and autoproteolytic domains. Protein modifications affect almost every aspect of cell biology and pathology. PTMs play important roles in cellular metabolism, signal transduction, protein degradation, DNA replication regulation, stress responses, and are associated with drug resistance. Succinylation occurs by transferring the succinyl group (-CO-CH2-CH2-CO2H) of succinyl-CoA to a lysine residue. Succinylation of proteins can change the charge state of unmodified lysine residues from positive (+1) to negative (-1) at physiological pH (7.4), thus having a greater impact on protein structure and function. Notably, compared to lysine acetylation, succinylation transfers a relatively large mass (100 kDa) to the protein residue. Therefore, the changes in charge and mass resulting from succinylation may have a more significant impact on protein function.

[0004] Short-chain enoyl-CoA hydratase 1 (ECHS1, located on human chromosome 10q26.2-q26.3, containing 8 exons) is mainly located in mitochondria and catalyzes mitochondrial fatty acid oxidation metabolism. It is composed of 299 amino acids. Mutations in this gene have been shown to lead to mitochondrial diseases, causing abnormal ATP synthesis, insufficient energy supply, and other abnormalities that affect the normal function of multiple systems. Researching the biological role and related mechanisms of ECHS1 succinylation modification in cancer may provide new targets for the diagnosis and treatment of pancreatic cancer. Summary of the Invention

[0005] This invention, through integrated proteomics analysis of succinylation modifications in pancreatic cancer tumors, revealed a significant decrease in succinylation levels at lysine 115 of short-chain enoyl-CoA hydratase 1 (ECHS1) in pancreatic cancer tissues. ECHS1 is a key mitochondrial enzyme involved in the fatty acid β-oxidation pathway, crucial for intracellular fatty acid metabolism and energy production. Investigating the biological role and related mechanisms of ECHS1 succinylation modification in cancer holds promise for providing new targets for the diagnosis and treatment of pancreatic cancer.

[0006] In order to overcome the shortcomings of the prior art, the present invention provides a target for pancreatic cancer tumor treatment and its application.

[0007] This invention is achieved through the following technical solution:

[0008] In a first aspect, the present invention provides a target for the treatment of pancreatic cancer, wherein the target is ECHS1 K115su modified by succinylation of lysine at position 115 of ECHS1.

[0009] Secondly, this invention provides the application of ECHS1 K115su, modified by succinylation of lysine at position 115 of ECHS1, as a target in the preparation of drugs for treating pancreatic cancer tumors.

[0010] Thirdly, this invention provides the application of a reagent for detecting the expression level of ECHS1 K115su modified by succinylation of lysine at position 115 in the preparation of pancreatic cancer tumor diagnostic products.

[0011] Succinylation of lysine at position 115 of ECHS1 can mediate the conversion efficiency of ECHS1 protein to its substrate, thereby inhibiting fatty acid β-oxidation metabolism in pancreatic cancer cells, thus inhibiting the proliferation of pancreatic cancer cells and the growth of tumor volume.

[0012] Fourthly, the present invention provides an antigenic peptide for the pancreatic cancer tumor therapeutic target ECHS1 K115su, the sequence of which is: Su-2:CYSS-(Su)K-FLKHWDHL.

[0013] Fifthly, the present invention provides the application of the antigenic peptide targeting ECHS1 K115su in the preparation of drugs for the prevention or treatment of tumors.

[0014] Compared with existing technologies, the advantages of this invention are that it experimentally discovered that the level of lysine succinylation modification at position 115 of the ECHS1 protein (ECHS1 K115su) is significantly reduced in pancreatic cancer tumors, and for the first time, the existence of this modification was confirmed by a specific succinylation antibody. Furthermore, it was found that K115 succinylation modification can mediate the conversion efficiency of ECHS1 protein to its substrate, thereby inhibiting fatty acid β-oxidation metabolism in pancreatic cancer cells. In vitro and in vivo functional experiments confirmed that ECHS1 K115 succinylation modification inhibits the proliferation of pancreatic cancer tumor cells and tumor volume growth. Attached Figure Description

[0015] The present invention will be further described below with reference to the accompanying drawings.

[0016] Figure 1 A proteomics analysis of succinylation modifications in pancreatic cancer revealed a map showing a significant decrease in the abundance of ECHS1 115 lysine succinylation (ECHS1K115su) in pancreatic cancer cells; among which, Figure 1Image A shows a map analyzing the ECHS1 K115 succinylation modification level in pancreatic cancer succinymics data. Figure 1 B is a representative secondary mass spectrometry chromatogram of ECHS1 K115 succinylated modification;

[0017] Figure 2 Mass spectra of ECHS1 K115 succinylated modified peptides and unmodified peptides; among them, Figure 2 A in the image represents the mass spectrum of the Su-1 antigen polypeptide. Figure 2 B is the mass spectrum of the Su-2 antigen polypeptide. Figure 2 The middle C is the mass spectrum of the control polypeptide Su-3. Figure 2 D is the mass spectrum of the unmodified control peptide Su-4;

[0018] Figure 3 Analysis of succinylated modified antibodies and ECHS1 protein; among which, Figure 3 In section A, the analysis of the specificity verification results of the ECHS1 K115 succinylated modified antibody is presented. Figure 3 B represents the position of the K115 site within the predicted small molecule binding pocket of the ECHS1 protein; Figure 3 Analysis of the position of the K115 site within the ECHS1 protein domain (C in the diagram).

[0019] Figure 4 This was to validate the ECHS1 K115 succinylation modification in pancreatic cancer cell lines; among which, Figure 4 In section A, succinylation modification at the ECHS1 K115 site was verified by detecting IgG and HA in Hs766T (a human pancreatic cancer cell line). Figure 4 In section B, succinylation modification at the ECHS1K115 site was verified by detecting IgG and HA in PANC-1 (a human pancreatic cancer cell line). Figure 4 In section C, succinylation modification at the ECHS1 K115 site was verified by detecting HA in Hs766T. Figure 4 D is the result of detecting HA in PANC-1 to verify the presence of succinylation modification at the K115 site of ECHS1;

[0020] Figure 5 An analysis diagram confirms that the K115 site is a key site for succinylation modification of the ECHS1 protein; among which, Figure 5 In section A, Hs766T confirmed that the K115 site is a key site for succinylation modification of the ECHS1 protein. Figure 5 B in the diagram is the K115 site, which, as confirmed by PANC-1, is a key site for succinylation modification of the ECHS1 protein.

[0021] Figure 6 An analytical map of the construction of ECHS1 knockout and K115 succinylation-modified cell lines; among which, Figure 6 In Figure A, Western blot analysis was used to verify the ECHS1 knockout efficiency in pancreatic cancer cell lines. Figure 6 In Figure B, wild-type ECHS1 or its mutant K115R were reintroduced into ECHS1 knockout cell lines, and the ECHS1 expression level was analyzed by Western blot.

[0022] Figure 7 A map illustrating the impact of ECHS1 K115 succinylation modification loss on pancreatic cancer tumor development; among which, Figure 7 Figures A and B show the effect of ECHS1 K115 succinylation modification deficiency on the proliferation ability of pancreatic cancer cells as detected by the CCK8 assay. Figure 7 C and D in the figure represent the effects of ECHS1 K115 succinylation modification on cell proliferation as detected by a colony formation assay.

[0023] Figure 8 To investigate the effect of ECHS1 K115su deficiency on the migration ability of pancreatic cancer cells using a Transwell assay; among which, Figure 8 Figures A and B show the effect of ECHS1 K115su deletion on the migration ability of pancreatic cancer cells as detected by Hs766T. Figure 8 In the middle, C and D represent the effects of ECHS1 K115su deletion on the migration ability of pancreatic cancer cells as detected by PANC-1.

[0024] Figure 9 Nude mice were subcutaneously injected with ECHS1 K115 succinylated deletion cells and their corresponding control cell lines. Tumor volume was measured during growth. After approximately one month, the tumors were harvested, photographed, and their weight and volume were measured for analysis. Figure 9 Image A is a picture of a tumor. Figure 9 B in the diagram represents tumor volume analysis. Figure 9 In the middle, C represents tumor weight analysis;

[0025] Figure 10 To investigate the effect of ECHS1 K115 site succinylation on intracellular metabolites using targeted metabolomics analysis; among which, Figure 10 Scatter plot of principal component analysis (PCA) in the middle. Figure 10 Image B is a heatmap showing the differential expression analysis of ECHS1 protein in wild-type (WT) and K115R mutant (K115R) samples. Figure 10 The middle C figure shows the results of ECHS1 metabolic pathway enrichment analysis. Figure 10D represents a heatmap of differential expression of metabolites between wild-type (WT) and ECHS1 K115R mutant samples;

[0026] Figure 11 A graph illustrating the effects of ECHS1 K115 succinylation modification on fatty acid and tricarboxylic acid cycle metabolism is provided for metabolic flux analysis. Figure 11 In diagram A, the metabolic flow diagram linking fatty acid oxidation (FAO) and the tricarboxylic acid cycle (TCA cycle) is shown. Figure 11 In Figure B, the relative abundance of ¹³C-labeled acetyl-CoA is shown in different samples. Figure 11 In the figure, C represents the relative abundance of ¹³C-labeled citric acid in different samples. Figure 11 D represents the relative abundance of ¹³C-labeled isocitrate in different samples. Figure 11 E represents the relative abundance of ¹³C-labeled fumarate in different samples;

[0027] Figure 12 This analysis uses spectral mapping to depict the effect of K115 site succinylation modification on ECHS1 protein binding to its substrate and product release during stretching kinetics. Figure 12 In the diagram, A represents the structure of ECHS1, which binds to trans-Δ2-enoyl-CoA. Figure 12 B is a schematic diagram of the ECHS1 K115su structure, which binds to trans-Δ2-enoyl-CoA as a substrate. Figure 12 C is a schematic diagram of the ECHS1 structure, which binds to 3-hydroxyacyl-CoA as a substrate. Figure 12 D is a schematic diagram of the ECHS1K115su structure, which binds to 3-hydroxyacyl-CoA substrate. Figure 12 E represents the PMF energy diagram of the dissociation process of the binding pocket of ECHS1 protein with substrates that are unmodified and succinylated at the K115 site. Figure 12 In the middle F, the PMF energy diagram shows the dissociation process of the binding pocket of the ECHS1 protein without modification and the ECHS1 protein modified by succinylation at the K115 site. Detailed Implementation

[0028] The invention will now be further described with reference to the accompanying drawings.

[0029] Example 1

[0030] Analysis of ECHS1 succinylation modification status using the pancreatic cancer succinylation modification database (the pancreatic cancer succinylation modification database was constructed by Hangzhou Jingjie Biotechnology Co., Ltd.)

[0031] Protein extraction: Fifteen pairs of pancreatic cancer tissues and their corresponding adjacent normal tissue samples were removed from a -80°C freezer. Appropriate amounts of each sample were weighed into a liquid nitrogen-pre-cooled mortar and ground thoroughly into powder. Four times the volume of lysis buffer (1% sodium dodecyl sulfate (SDS), 1% protease inhibitor, 3 μM richostatin A (TSA), 50 mM nicotinamide (NAM)) was added to each sample, and the mixture was sonicated. The mixture was centrifuged at 12000 g for 10 min at 4°C. The supernatant was transferred to a new centrifuge tube, and protein concentration was determined using the Bicinchoninic Acid Assay (BCA) kit.

[0032] Trypsin digestion: Equal volumes of each protein sample (protein samples extracted from 15 pairs of pancreatic cancer tissues) were digested, and the volumes were adjusted to be consistent with lysis buffer. One volume of pre-chilled acetone was added, vortexed, and then four volumes of pre-chilled acetone were added. The mixture was precipitated at -20°C for 2 h. The mixture was centrifuged at 4500 g for 5 min, the supernatant was discarded, and the precipitate was washed twice with pre-chilled acetone. After drying the precipitate, tetraethylammonium bromide (TEAB) was added to a final concentration of 200 mM. The precipitate was sonicated to disperse the precipitate, and trypsin was added at a ratio of 1:50 (protease: protein, m / m). The mixture was digested overnight. Dithiothreitol (DTT) was added to a final concentration of 5 mM, and the mixture was reduced at 56°C for 30 min. Iodoacetamide (IAA) was then added to a final concentration of 11 mM, and the mixture was incubated at room temperature in the dark for 15 min.

[0033] Modification and Enrichment: The IP peptides were dissolved in immunoprecipitation buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, 0.5% NP-40, pH 8.0). The supernatant was transferred to pre-washed succinylated resin (antibody resin catalog number (PTM-402), sourced from Hangzhou Jingjie Biotechnology Co., Ltd., PTM Bio). The resin was incubated overnight on a rotary shaker at 4 ℃ with gentle shaking. After incubation, the resin was washed four times with IP buffer and twice with deionized water. Finally, the resin-bound peptides were eluted three times with 0.1% trifluoroacetic acid eluent. The eluent was collected and freeze-dried under vacuum. After drying, the resin was desalted according to the C18 ZipTips instructions, freeze-dried, and then used for LC-MS / MS analysis.

[0034] Liquid chromatography-mass spectrometry (LC-MS) analysis: Peptides were dissolved in mobile phase A of the LC system and then separated using a NanoElute ultra-high performance liquid chromatography (UHPLC) system. Mobile phase A was an aqueous solution containing 0.1% formic acid and 2% acetonitrile; mobile phase B was a solution containing 0.1% formic acid and 100% acetonitrile. The LC gradient settings were: 0-42 min, 7%~24% B; 42-54 min, 24%~32% B; 54-57 min, 32%~80% B; 57-60 min, 80% B, with the flow rate maintained at 450 nL / min. After separation by the UHPLC system, the peptides were injected into a Capillary ion source for ionization and then analyzed by a TimsTOF Pro mass spectrometer. The ion source voltage was set to 1.6 kV, and the precursor ion and secondary fragments of the peptides were detected and analyzed using high-resolution TOF. The secondary mass spectrometry scan range was set to 100-1700. The data acquisition mode used was Parallel Accumulation Serial Fragmentation (PASEF). After a primary mass spectrometer acquisition, 10 secondary spectra were acquired in PASEF mode for precursor ion charge numbers in the range of 0-5. The dynamic exclusion time for tandem mass spectrometry was set to 30 s to avoid repeated scanning of precursor ions.

[0035] Mass spectrometry data search: Acquired MS and MS / MS data were searched in the human SwissProt database (20,422 entries) using the MaxQuant search engine (version 1.6.15.0). Search parameters were set to include the proteolytic enzyme trypsin and to allow up to two missing cleavage sites. Precursor ion tolerance was set to 20 ppm, main search peptide tolerance to 5 ppm, and fragment ion mass tolerance to 0.02 Da. Methylation of carbamate on Cys was specified as a fixed modification, while acetylation at the N-terminus of the protein and oxidation on Met were specified as variable modifications. For analysis of lysine succinylation-modified (Ksu) peptide enrichment data, the variable modification settings included lysine succinylation. The false discovery rate (FDR) for peptide matching, site, and protein identification was set to <1%.

[0036] Succinylation modification proteomics analysis: Ksu peptide levels were calculated based on raw spectral intensities. A database containing all succinylated modified peptides was constructed and normalized according to their protein abundance to exclude Ksu peptide level variations caused by protein level dynamics. Differences between pancreatic cancer and adjacent normal tissues were compared and analyzed.

[0037] Develop a specific antibody against ECHS1 K115 succinylation modification (contracted to Hangzhou Jingjie Biotechnology Co., Ltd.)

[0038] I. Immunogen Design: Based on the protein sequence and succinylation modification, two succinylated modified antigen peptides (ECHS1 and K115) were designed and synthesized. Mass spectra of the succinylated modified peptide and the unmodified peptide are shown below. Figure 2 As shown), it is used for animal immunization, purification and detection; at the same time, one succinylated modified control peptide and one unmodified control peptide were designed and synthesized for purification and detection, and the four immunogenic peptides synthesized were detected by mass spectrometry. After multiple immunizations, a small amount of serum was taken from 6 SPF experimental-grade New Zealand white rabbits and ELISA was performed to preliminarily evaluate the titer and specificity of the antiserum. II. Antibody quality control: a sufficient amount of rabbit serum was taken and purified by affinity purification of Protein A and immunogenic peptide columns. The purified antibody was first detected by ELISA, Dot Blot and Western blot. (1) Antibody ELISA detection: antibody was added to a 96-well microplate coated with antigen-modified peptide and control peptide according to different dilution ratios for incubation. Then, enzyme-labeled secondary antibody and TMB substrate were applied, and the binding of peptides and antibodies was detected by colorimetric analysis; (2) Antibody Dot blot detection: Different doses of modified peptides and unmodified peptides were immobilized on a solid membrane, incubated with antibody, and then enzyme-labeled secondary antibody and chemiluminescent substrate were added to detect the binding of peptides and antibodies. The results are as follows Figure 1 As shown in the figure, it can be seen that in this embodiment, succinylation modification was found at the K115 position of ECHS1, and its abundance was significantly reduced in pancreatic cancer.

[0039] In this embodiment, Figure 3 The prepared ECHS1 K115su antibody was specifically detected by the Chinese team. HeLa and MCF-7 cells were treated with suramin (40 μM, 7 h) + SBA (5 mM, 7 h) + succinic acid (30 μM, 16 h) (this drug can induce an increase in succinylation modification), and the ECHS1 K115 succinylation modification level in the cells was detected by the prepared antibody.

[0040] Example 2

[0041] Validation of ECHS1 115 lysine succinylation modification (ECHS1 K115su) in pancreatic cancer cells

[0042] I. Construction of a lentiviral overexpression plasmid fused with the HA tag for wild-type ECHS1 and its K115 mutation: Forward and reverse amplification primers were designed based on its CDS sequence (forward primer: ATGGCCGCCCTGCGTGTCCTG; reverse primer: CTGGTCTTTGAAGTTGGCCTTTCTC). The ECHS1 expression sequence was obtained by PCR amplification and ligated into the PCDNA6B-HA vector to obtain the pcDNA6B-HA-ECHS1 plasmid expressing ECHS1. Additionally, point mutation primers were designed (forward primer: GACTGTTACTCCAGCCGGTTCTTGAAGC; reverse primer: CCGGCTGGAGTAACAGTCCTGGAAACTC) to mutate lysine at position 115 of ECHS1 to arginine, constructing the ECHS1 K115 mutant plasmid pcDNA6B-HA-ECHS1-K115R.

[0043] II. Validation of ECHS1 115 succinylation modification in pancreatic cancer cells: The ECHS1-expressing plasmid pcDNA6B-HA-ECHS1 and the control empty vector plasmid were transfected into pancreatic cancer cells, respectively. Cells were treated with 5 mM succinic acid for 24 hours. ECHS1 protein was enriched by immunoprecipitation. Cells were lysed using RIPA weak lysis buffer (Beyotime, P0013D), and total protein was extracted. Agarose beads (Sigma-Aldrich, A2095) conjugated with HA antibody were added, and the mixture was incubated overnight at 4°C. After gentle washing with PBS (pH 7.4), proteins were separated by SDS-PAGE (polyacrylamide gel electrophoresis). The ECHS1 succinylation modification level in the cells was detected using a pan-succinylation modification antibody.

[0044] III. Confirmation that K115 is the key site for succinylation modification of ECHS1: ECHS1 cells lacking K115 succinylation modification and control cells were treated with 5 mM succinic acid for 24 hours. The cell lines were lysed using RIPA strong lysis buffer, total protein was extracted, and the cells were incubated overnight with agarose beads (Sigma-Aldrich, A2095) conjugated with HA antibody. The cells were then gently washed with PBS buffer, and the changes in ECHS1 succinylation modification level were detected by Western blot experiment.

[0045] The results are as follows Figure 4-5 As shown in the figure, ECHS1 in pancreatic cancer cell lines exhibits succinylation modification, and K115 is the key site for succinylation modification of ECHS1.

[0046] Figure 4In cell line A, ECHS1 was exogenously introduced into pancreatic cancer cells. Simultaneously, the cell lines were treated with 5 mM succinic acid for 24 hours, and exogenous ECHS1 was enriched by immunoprecipitation. The succinylation modification was verified using a pansuccinylation modification antibody. Figure 4 In the middle B cell line, exogenous ECHS1 was introduced into pancreatic cancer cells. Exogenous ECHS1 was enriched by immunoprecipitation. The effect of succinate treatment on the succinylation modification level of ECHS1 was detected using a pansuccinylation modification antibody. Figure 5 In cells A and B, exogenous ECHS1 or its mutant K115R was introduced into pancreatic cancer cells. The cell lines were treated with 5 mM succinic acid for 24 hours, and exogenous ECHS1 and its mutant K115R were enriched by immunoprecipitation. The level of exogenous ECHS1 succinylation modification in the cell lines was detected using a pansuccinylation modification antibody.

[0047] Example 3

[0048] Construction of ECHS1 knockout and K115 succinylation-derived cell lines

[0049] I. Construction of ECHS1 knockout plasmids based on CRISPR-Cas9 technology: Based on the analysis of conserved structural functional domains of the ECHS1 protein, the following three sgRNA sequences were designed: 5'-CACCGCCCTCAATGCACTTTGCGA-3', 5'-CACCGGAGGCCTTATCCCCGCCGGTG-3', and 5'-CACCGATCCAACTGAACCGCCCCA-3'. The above sequences were annealed and ligated into the PX330 vector to construct pX330-U6-gRNA-Cas9 knockout plasmids.

[0050] 2. The ECHS1 knockout plasmid constructed above was co-transfected into pancreatic cancer cells. After 48 hours, G418 drug (Beyotime, ST081) was added to screen cells. GFP-expressing positive cells were further sorted by flow cytometry and seeded into 96-well plates at a density of one cell per well. After the clones grew, the cells were harvested and lysed. The ECHS1 knockout efficiency was detected by Western blot.

[0051] III. Construction of a lentiviral overexpression plasmid fused with the GFP tag for wild-type ECHS1 and its K115 mutation: Forward and reverse amplification primers were designed based on its CDS sequence (forward primer: ATGGCCGCCCTGCGTGTCCTG; reverse primer: CTGGTCTTTGAAGTTGGCCTTTCTC). The ECHS1 expression sequence was obtained by PCR amplification and ligated into the pLVX-GFP vector to obtain the lentiviral plasmid pLVX-GFP-ECHS1 expressing ECHS1. Additionally, point mutation primers were designed (forward primer: GACTGTTACTCCAGCCGGTTCTTGAAGC and reverse primer: CCGGCTGGAGTAACAGTCCTGGAAACTC) to mutate lysine at position 115 of ECHS1 to arginine, constructing the plasmid pLVX-GFP-ECHS1K115R with the ECHS1 K115 succinylation deletion.

[0052] IV. Construction of ECHS1 K115 succinylation-deficient cell lines: HEK293T cells were seeded in 10 cm culture dishes and allowed to reach 70-80% confluence. The target plasmids (pLVX-GFP-ECHS1 and pLVX-GFP-ECHS1K115R): PSPAX2: PMD2G = 12 μg: 9 μg: 3 μg were dissolved in 1.5 ml of Opti-Mem medium. Separately, 72 μl of PEI reagent was dissolved in 1.5 ml of Opti-Mem medium. After standing for 5 min, the two solutions were mixed and incubated for 15 min before being added to HEK293T cells. After 48 h, the viral supernatant was collected, filtered through a 0.22 μm filter, and added to the ECHS1 knockout pancreatic cancer cells constructed above. After 12-16 h, the culture medium was replaced with fresh medium. After 48 h of culture, puromycin (Solepro, P8230) was added to screen for stable expression cell lines, and the ECHS1 expression level was detected by Western blot.

[0053] The results are as follows Figure 6 As shown in the figure, this invention successfully constructed a pancreatic cancer cell line with ECHS1 knockout and K115 mutation.

[0054] Example 4

[0055] The effect of ECHS1 K115 succinyl modification on the development and progression of pancreatic cancer

[0056] I. CCK8 and Colony Formation Assay to Detect the Effect of ECHS1 K115 Succinylation Deletion on Pancreatic Cancer Cell Proliferation: ECHS1 K115 succinylation deletion and control cells were treated with 5 mM succinic acid for 24 hours. Cells in the logarithmic growth phase were digested and passaged, counted, and transferred to 96-well plates. The cells were then incubated at 37°C. The following experimental procedures were performed at 0, 24, 48, and 96 hours: the culture medium was aspirated, the cells were washed three times with PBS, and cultured for 4 hours with medium containing 10% CCK8. The OD450 value was measured and statistically analyzed using a microplate reader. Simultaneously, the succinic acid-treated cell lines were seeded into 6-well plates and incubated at 37°C for 1-2 weeks. After the colonies reached a suitable size, the culture medium was aspirated, the cells were washed three times with PBS, fixed at room temperature for 30 min, stained with diluted crystal violet solution for 30 min, rinsed with double-distilled water, and allowed to air dry. The colony count was then statistically analyzed.

[0057] II. Results as follows Figure 7 As shown in the figure, ECHS1 K115 succinylation modification inhibits the proliferation of pancreatic cancer cells.

[0058] III. Transwell assay to detect the effect of ECHS1 K115 succinylation modification deficiency on pancreatic cancer cell migration: ECHS1 K115 succinylation modification deficiency and control cells were treated with 5 mM succinic acid for 24 hours, respectively. Cells in the logarithmic growth phase were digested and passaged, and the cells were counted. The cells were resuspended in serum-free medium and added to the upper chamber of the transwell, while the lower chamber was added with complete medium. The cells were incubated at 37°C for 20-24 hours. After the cells passed through the transwell wells and spread out, the medium was discarded, the cells were washed three times with PBS, fixed at room temperature for 30 min, stained with diluted crystal violet solution for 30 min, rinsed with double-distilled water, and allowed to air dry. The number of cells that passed through the wells was counted and analyzed.

[0059] The results are as follows Figure 8 As shown in the figure, ECHS1 K115 succinylation modification inhibits the migration of pancreatic cancer cells.

[0060] III. Effect of ECHS1 K115 succinylation modification deficiency on pancreatic cancer cell growth in nude mice: ECHS1 K115 succinylation modification deficiency cells and control cells were treated with 5 mM succinic acid for 24 hours. Cells in the logarithmic growth phase were digested and passaged, cells were counted, and cells were resuspended in PBS buffer to adjust the cell density to 5 × 10⁶ cells / year. 7Cells were counted at a rate of 1 / mL. Then, 0.1 mL of cell suspension was subcutaneously injected into the axilla of nude mice. Once tumors had grown, their volume was measured every 4 days. After approximately one month, the tumors were harvested, and their weight and volume were measured.

[0061] IV. Results Figure 9 As shown in the figure, ECHS1 K115 succinylation modification inhibits the in vivo growth of pancreatic cancer tumors.

[0062] As demonstrated by the above embodiments, this invention provides an application of ECHS1 with desuccinylated lysine at position 115 as a target for pancreatic cancer development. Desuccinylation of ECHS1 at position 115 promotes the growth and metastasis of pancreatic cancer cells, and the level of ECHS1 with desuccinylation at position 115 is significantly reduced in pancreatic cancer. The decreased level of ECHS1 with desuccinylation at position 115 can predict the risk of pancreatic cancer development and progression, and also provides a new diagnostic method for the molecular-level diagnosis of pancreatic cancer in clinical practice, as well as a new drug target for the treatment of pancreatic cancer.

[0063] Example 5

[0064] ECHS1 K115 succinyl modification inhibits fatty acid β-oxidation metabolism in pancreatic cancer.

[0065] I. Targeted Metabolomics Experiment to Detect the Effect of ECHS1 K115 Succinylation Deletion on Metabolites in Pancreatic Cancer Cells: ECHS1 K115 succinylation-deleted cells and control cells were treated with 5 mM succinic acid for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and cell counts were performed. 150 μL of 80% methanol solution (containing internal standard) pre-chilled in ice water was added, and the cells were sonicated at appropriate power for 3 seconds, 3 times, and centrifuged at 18000g for 20 minutes at 4°C. 30 μL of the supernatant was transferred to a 96-well plate. The following steps were performed on an Eppendorf epMotion workstation (Eppendorf Inc., Humburg, Germany). 20 μL of freshly prepared derivatization reagent was added to each well, the plate was sealed, and derivatization was performed at 30°C for 60 min. Next, the sample was diluted with 330 μL of 50% methanol solution in an ice bath, followed by centrifugation at 4°C (4000 g, 30 min). 135 μL of the supernatant was then transferred to a new 96-well plate, with 10 μL of internal standard added to each well. A gradient dilution of the derivatized standard stock solution was added to the left-hand wells. Finally, the plate was sealed for LC-MS analysis.

[0066] The results are as follows Figure 10 As shown in the figure, ECHS1 K115 succinylation modification affects the levels of fatty acid-related metabolites and carnitine in pancreatic cancer cells.

[0067] This embodiment Figure 10 In this study, ECHS1 K115 succinylation-deficient cells and control cells were treated with 5 mM succinic acid for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and metabolites were extracted for targeted metabolomics analysis. PCA plots showed differences in metabolite analysis between ECHS1 K115su-deficient and control cells. A heatmap was then used to visualize the differentially expressed metabolites in these cell lines; KEGG was used for pathway enrichment analysis of these differentially expressed metabolites; and a heatmap was used to visualize the differentially expressed carnitine metabolites identified in these cell lines.

[0068] II. Metabolic flux assay to detect the effect of ECHS1 K115 succinylation deficiency on fatty acid β-oxidation metabolism in pancreatic cancer: using a mixture containing... 13 C 16 ECHS1 K115 cells lacking succinylation modification and control cells were cultured in palmitic acid medium for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and cell counts were performed. 400 μL of 80% methanol solution was added to each cell sample tube, and cells were sonicated (JY92-IIN, NingBoScientz Biotechnology Co., Ltd.). The cells were centrifuged at 18000g for 15 minutes at 4°C (Microfuge 20R, Beckman Coulter, Inc., Indianapolis, IN, USA). The supernatant was collected, centrifuged, concentrated, and reconstituted in 100 μL of 80% methanol solution before analysis. Metabolic flux was detected using an ACQUITY-I UPLC / Xevo TQS system (Waters Corporation, USA).

[0069] The results are as follows Figure 11 As shown in the figure, ECHS1 K115 succinylation modification inhibits fatty acid β-oxidation metabolism in pancreatic cancer cells. This embodiment... Figure 11 Using contains 13 C 16 ECHS1 K115 cells without succinylation modification and control cells were cultured in palmitic acid medium for 24 hours. Cells in the logarithmic growth phase were digested and passaged, and the cells were collected for metabolic flux detection and analysis.

[0070] III. Molecular Dynamics Simulation Analysis of the Effect of K115 Succinylation Modification on the Catalytic Activity of ECHS1 (Structural analysis of this part was commissioned to Shanghai Taoshu Biotechnology Co., Ltd.): This section uses stretched molecular dynamics simulations to study the simulated trajectories of the substrate and product in the binding pockets of succinylated and unmodified ECHS1. Using the last frame conformation from the conventional molecular dynamics simulation as the initial conformation, stretched dynamics simulations were performed on the products bound to succinylated and unmodified ECHS1. The dissociation position of the product molecule was set as the center point of the CB atoms of residues K282 and K353, and the stretching direction was defined as the vector formed by the product molecule's center of mass and this center. Umbrella sampling and potential surface analysis were performed along this dissociation direction, with a confinement force constant of 1.5 kcal mol−1 Å−2. Figure 12 China E and Figure 12 The PMF energy diagram of the medium-F region shows that the initial energy barriers for dissociation from the binding pocket of the substrate in both unmodified and succinylated ECHS1 proteins are similar. Within the 1-3 Å range from the initial position, the energy barrier for substrate dissociation from the unmodified protein is slightly higher. During this period, the purine groups of the substrate maintain hydrogen bonds with residues A359 and I361, and these hydrogen bonds break after 2.5 Å, resulting in rapid dissociation. In the succinylated ECHS1 protein, the hydrogen bonds between the purine groups and residues A359 and I361 break earlier, while the hydrogen bonds with K282 are maintained. The energy barrier for product dissociation from the binding pocket of the unmodified ECHS1 protein is significantly lower than that of the succinylated ECHS1 protein. The purine groups of the product maintain hydrogen bonds with residues A359 and I361, and these hydrogen bonds break after 3.1 Å and 2.5 Å, respectively, resulting in dissociation.

[0071] IV. Results Figure 12 As shown in the figure, the purine group of the substrate is more easily detached from the succinylated ECSH1 binding pocket, while the product is relatively more stable in the succinylated ECSH1 binding pocket. Based on this result, it is speculated that K115 succinylation will reduce the conversion efficiency of ECSH1 for the substrate.

[0072] also, Figure 12As shown in the PMF energy diagram, the initial energy barriers for dissociation from the binding pocket of the substrate in both unmodified and succinylated ECHS1 proteins are similar. Within the 1-3 Å range from the initial position, the energy barrier for substrate dissociation from the unmodified protein is slightly higher. During this period, the purine groups of the substrate maintain hydrogen bonds with residues A359 and I361, and these hydrogen bonds are broken after 2.5 Å, resulting in rapid dissociation. In the succinylated ECHS1 protein, the hydrogen bonds between the purine groups and residues A359 and I361 are broken earlier, while the hydrogen bonds with K282 are maintained. The energy barrier for product dissociation from the binding pocket of the unmodified ECHS1 protein is significantly lower than that of the succinylated ECHS1 protein. The purine groups of the product maintain hydrogen bonds with residues A359 and I361, and these hydrogen bonds are broken after 3.1 Å and 2.5 Å, respectively, resulting in dissociation.

Claims

1. An antigenic peptide targeting the ECHS1 K115 site for pancreatic cancer therapy, characterized in that, The target is ECHS1 K115su modified by succinylation of lysine at position 115 of ECHS1. The antigenic peptide sequence of the target ECHS1 K115su is Su-2:CYSS-(Su)K-FLKHWDHL.

Images