A method for synthesizing D-chiro-inositol by biotransformation and its synthetic strain

By using a strain that co-expresses the inositol dehydrogenase iolG mutant Q122V/D187Y derived from Bacillus subtilis with the inositol isomerase iolI, the problems of low DCI yield and long reaction time in the existing technology have been solved, realizing efficient and economical DCI production, which is suitable for the functional food field.

CN120608032BActive Publication Date: 2025-10-28HANG ZHOU HE TAN CHUANG WU KE JI YOU XIAN GONG SI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511121126.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-10-28
Estimated Expiration
2045-08-12

AI Technical Summary

Technical Problem

Existing biological methods for producing D-chiro-inositol (DCI) have problems such as low yield, long reaction time, and high cost, and it is difficult for enzymes to specifically recognize different chiral compounds of inositol during the catalytic process.

Method used

A strain co-expressing the inositol dehydrogenase iolG mutant Q122V/D187Y and inositol isomerase iolI from Bacillus subtilis was used to produce DCI by whole-cell catalytic conversion of myo-inositol (MI). The reaction conditions such as pH and temperature were optimized.

Benefits of technology

The DCI yield reached 24.1 g/L within 4 hours, with a production rate of 6.025 g/L/h, which significantly improved the yield and production efficiency, shortened the synthesis time, reduced the cost, and made the process simple and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608032B_ABST
    Figure CN120608032B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to a method for biotransformation synthesis of D-chiral inositol and its synthetic strain, wherein the strain is Bacillus subtilis. Bacillus subtle The inositol dehydrogenase (iolG) gene and the inositol isomerase (iolI) gene were co-expressed in *E. coli*. Further modification of the key enzyme, inositol dehydrogenase, resulted in the construction of the inositol dehydrogenase mutant Q122V / D187Y. This mutant Q122V / D187Y was obtained by mutating glutamine at position 122 of inositol dehydrogenase (iolG) to valine and aspartic acid at position 187 to tyrosine. A strain co-expressing the inositol dehydrogenase (iolG) mutant Q122V / D187Y and the inositol isomerase (iolI) was used for whole-cell transformation of D-chiral inositol. Within a 4-hour production cycle, the DCI yield reached 24.1 g / L, with a production rate of 6.025 g / L / h.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for biotransformation synthesis of D-chiral inositol and its synthetic strain. Background Technology

[0002] Inositol, also known as cyclohexanehexol, is widely distributed in plants, animals, and microorganisms, and is an important factor in animal and microbial processes. Inositol has nine stereoisomers, among which D-chiral inositol (DCI) exists in nature as compounds in plants such as buckwheat and carob, as well as insects. DCI has a variety of important physiological functions and has broad application prospects in the pharmaceutical and health care fields. Studies show that the DCI market demand is growing at an annual rate of 15%, and the global market size exceeded US$350 million in 2024.

[0003] Currently, there are many shortcomings in the preparation methods of DCI. Plant extraction: Extracted from buckwheat or carob, the extraction efficiency is only 0.2%-0.5%, the product purity is less than 90%, the production capacity is low, but the cost is high. Chemical synthesis: Produced through hydrolysis of D-pineol or kasugamycin with hydrochloric acid, but the raw materials D-pineol or kasugamycin are expensive, and the method involves strong acid and strong base reactions, requiring sophisticated equipment, making it economically unfeasible.

[0004] In biosynthesis, muscle inositol (MI) can be converted to dimethyl inositol (DCI) through a three-step reaction by inositol dehydrogenase (EC 1.1.1.18, iolG) and 2-keto-myo-inositol isomerase (EC 5.3.99.11, iolI). First, iolG oxidizes and dehydrogenates MI to 2-keto-inositol (2KMI). Then, iolI isomerizes 2KMI to 1-keto-D-chiral inositol (1KDCI). Finally, iolG reduces 1KDCI back to DCI.

[0005] With the development of bioengineering technology, the synthesis of DCI using microbial conversion is currently a relatively economical and environmentally friendly production method. However, existing biological methods generally have low yields and long reaction times—usually around 48 hours—with production rates mostly between 0.3 and 1.7 g / L / h.

[0006] Existing technology CN119799803A utilizes whole cells expressing squalinositol dehydrogenase mutants and thermostable muscle inositol dehydrogenase mutants to catalyze the two-step cascade synthesis of epi-inositol from muscle inositol. Unlike previously reported methods for synthesizing squalinositol and D-chiral inositol, this method requires dehydrogenation at the C4 position of muscle inositol followed by hydrogenation to achieve chiral reversal. Because both the substrate and product structures are highly symmetrical, enzymes often struggle to specifically recognize each other during catalysis. Therefore, the synthesis of different chiral compounds of inositol has always been a significant challenge in biocatalysis. Through enzyme modification, the yield of epi-inositol was increased to 1.89 g / L, with a conversion rate of 52.6%, both of which are the highest levels reported to date.

[0007] Existing technology CN119842646A mutates squalinositol dehydrogenase to obtain a beneficial mutant C261R, which is then coupled with a thermostable muscle inositol dehydrogenase for highly efficient catalytic synthesis of epiinositol, belonging to the field of biocatalysis engineering. This novel epiinositol synthesis pathway is completely different from previously reported methods for synthesizing squalinositol and D-chiral inositol. It uses muscle inositol, first dehydrogenating it at the C4 position to form an intermediate ketone, then adding hydrogen to achieve chirality reversal at the C4 position, yielding the final product epiinositol. The yield of epiinositol was 1.39 g / L, with a conversion rate of 38.7%.

[0008] Existing technology CN118028322A overexpressed different myoglycosidase genes iolIn and inositol dehydrogenase genes iolG in Corynebacterium glutamicum, achieving the conversion from myo-inositol (MI) to DCI, increasing the conversion rate to 16%. Based on this, this invention uses iolI2-iolG co-expressing bacteria for whole-cell transformation of D-chiral inositol, and optimizes the transformation conditions such as temperature, pH, and MI concentration, increasing the conversion rate to 17%-28% and the yield to approximately 7 g / L.

[0009] Studies have shown that the reaction catalyzed by muscle inositol dehydrogenase is the rate-limiting step in the entire pathway, therefore screening for highly efficient muscle inositol dehydrogenases is crucial for improving DCI yield. Summary of the Invention

[0010] To increase the yield of D-chiral inositol and achieve rapid DCI production, this invention provides a strain co-expressing an inositol dehydrogenase iolG mutant derived from subtilis and an inositol isomerase iolI derived from subtilis. This strain is used for whole-cell catalysis of muscle inositol (MI) to produce DCI. This method significantly increases yield while greatly shortening the DCI synthesis process time, achieving a production rate far exceeding existing technologies, reducing production costs, and is also simple, green, economical, and environmentally friendly.

[0011] To achieve the above objectives, the present invention discloses the following technical solutions:

[0012] In a first aspect, the present invention provides an inositol dehydrogenase mutant Q122V / D187Y, said inositol dehydrogenase mutant being produced by Bacillus subtilis... Bacillus subtilis It was obtained by modifying the inositol dehydrogenase iolG. Specifically, glutamine at position 122 of iolG was mutated to valine, and aspartic acid at position 187 was mutated to tyrosine.

[0013] The nucleotide sequence of the inositol dehydrogenase mutant Q122V / D187Y is shown in SEQ ID NO.1.

[0014] Secondly, the present invention provides a recombinant plasmid containing the inositol dehydrogenase mutant Q122V / D187Y gene and the inositol isomerase gene.

[0015] The nucleotide sequence of the myoglycoisomerase iolI is shown in SEQ ID NO.2.

[0016] Thirdly, the present invention provides a recombinant cell, characterized in that it contains the recombinant plasmid described in the second aspect.

[0017] Preferably, the recombinant cells are selected from prokaryotic cells or eukaryotic cells.

[0018] Fourthly, the present invention provides a method for preparing D-chiral inositol, the method comprising: reacting the cell-catalyzed muscle inositol as described in the third aspect.

[0019] The reaction was carried out at pH 6.0-8.0 and a temperature of 30-50°C. Under these conditions, the inositol dehydrogenase mutant Q122V / D187Y and the inositol isomerase iolI in recombinant cells synergistically converted muscle inositol to D-chiral inositol.

[0020] Fifthly, the present invention provides the application of the inositol dehydrogenase mutant, recombinant plasmid, recombinant cell, and preparation method according to the first, second, and third aspects in the production of D-chiral inositol or products containing D-chiral inositol.

[0021]

[0022] This invention also provides a myoglycoisomerase iolI, the nucleotide sequence of which is shown in SEQ ID NO: 2, specifically:

[0023] .

[0024] Compared with the prior art, the present invention has at least the following beneficial effects:

[0025] This invention provides a strain co-expressing the inositol dehydrogenase iolG mutant Q122V / D187Y and the inositol isomerase iolI for whole-cell transformation of D-chiral inositol. Within a 4-hour production cycle, the DCI yield reaches 24.1 g / L, and the production rate is 6.025 g / L / h, which is far higher than the prior art.

[0026] This invention effectively solves the problems of high reaction temperature, low yield and long conversion time in existing DCI production methods, improves the yield of DCI, greatly shortens the process time of DCI synthesis, reduces production costs, and has the advantages of simple production process, green economy and environmental protection, providing a more advantageous technical solution for the industrial production of DCI. Attached Figure Description

[0027] Figure 1 pACYCDuet-1-BsiolG+BsiolI plasmid map;

[0028] Figure 2 HPLC chromatograms of DCI and MI. Detailed Implementation

[0029] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0030] The materials used in the embodiments of the present invention include: Escherichia coli ( Escherichia coli The BL21 (DE3) strain and its gene were synthesized by Beijing Qingke Biotechnology Co., Ltd.; PCR polymerase, restriction endonuclease, modifying enzymes and other reagents were purchased from Dalian TaKaRa Co., Ltd.; muscle inositol was purchased from Bohaoda Co., Ltd.; and D-chiral inositol was purchased from Maclean Co., Ltd.

[0031] LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0032] Fermentation medium: potassium dihydrogen phosphate 13.4 g / L, ammonium sulfate 4 g / L, citric acid 1.8 g / L, antifoaming agent 300 μL / L, glucose 10 g / L, magnesium sulfate heptahydrate 0.6 g / L, trace element I 10 mL / L, chloramphenicol 50 mg / L;

[0033] Fermentation feed: glucose 600g / L, magnesium sulfate heptahydrate 0.8g / L, trace element II 10mL / L;

[0034] Table 1. Components of Trace Elements

[0035]

[0036]

[0037] SEQ ID NO: 2:

[0038] ATGAAACTTTGTTTTAATGAAGCGACAACATTGGAAAACTCAAACCTTAAACTGGATTTAGAACTATGCGAAAAGCATGGCTATGATTATATTGAAATCCGTACTATGGATAAGCTGCCGGAGTACTTAAAAGATCATTCATTGGATGACCTTGCGGAATATTTTCAAACCCACCACATCAAACCGCTTGCCTTAAACGCACTCGTTTTCTTCAACAACCGTGATGAAAAGGGTCACAACGAGATCATCACTGAATTTAAAGGCATGATGGAAACATGCAAAACCCTCGGTGTGAAATATGTGGTGGCCGTTCCGCTTGTGACAGAGCAGAAGATTGTAAAAGAAGAGATCAAAAAGAGCAGTGTAGACGTGCTGACTGAGCTGTCAGATATCGCGGAGCCGTACGGCGTAAAAATCGCGCTTGAGTTTGTCGGCCATCCGCAATGTACGGTCAATACGTTTGAACAGGCGTATGAGATTGTAAACACAGTTAACCGTGACAATGTCGGGCTTGTCCTTGACAGTTTTCACTTCCATGCAATGGGTTCAAATATTGAGAGCTTAAAGCAGGCGGACGGAAAGAAAATCTTCATCTATCATATTGATGATACAGAAGATTTCCCAATCGGCTTTTTAACAGATGAGGATCGTGTATGGCCGGGACAAGGGGCAATTGACTTAGATGCCCACTTATCAGCACTGAAGGAAATCGGCTTCTCTGATGTTGTTTCGGTTGAGCTCTTCCGGCCTGAATACTATAAGCTGACTGCTGAGGAAGCCATTCAAACAGCGAAAAAAACAACAGTGGATGTCGTATCAAAATACTTCAGCATGTAA。

[0039] Example 1: Whole gene synthesis of pACYCDuet-1-BsiolG + BsiolI gene

[0040] The company commissioned Qingke Biotechnology to obtain the gene from Bacillus subtilis using whole-genome synthesis. Bacillus subtilis The inositol dehydrogenase gene iolG (GeneID: 937615) and the inositol isomerase gene iolI (GeneID: 937582) were linked. The iolG gene was linked between the PstI and HindIII restriction sites in the MCS1 region of the vector pACYCDuet-1, and the iolI gene was linked between the NdeI and XhoI restriction sites in the MCS2 region of the vector pACYCDuet-1, forming the recombinant plasmid: pACYCDuet-1-BsiolG+BsiolI (…). Figure 1 ).

[0041] Example 2: Obtaining the inositol dehydrogenase mutant Q122V / D187Y

[0042] The Q122V / D187Y gene was modified by mutating glutamine at position 122 of the inositol dehydrogenase gene iolG to valine and aspartic acid at position 187 to tyrosine. The nucleotide sequence is shown in SEQ ID NO.1. The specific procedure is as follows:

[0043] (1) Using pACYCDuet-1-BsiolG+BsiolI from Example 1 as a template, reverse PCR was performed using the primers in Table 2. The PCR system is shown in Table 3, and the PCR conditions are shown in Table 4.

[0044] Table 2. Primers required for PCR

[0045] Primer name Primer sequence Q122V-F CGCCTTGTTGTTGTCGGCT Q122V-R TGAAGCCGACAACAACAAGGC D187Y-F GGCTCGTCAATTACGACTACGAG D187Y-R GACTCGTAGTCGTAATTGACGAGC

[0046] Table 3. PCR reaction system

[0047] reaction system volume Q122V-F 0.5 µL Q122V-R 0.5 µL D187Y-F 0.5 µL D187Y-R 0.5 µL Template plasmid 1 µL 2*PCR polymerase 12.5µL ddH2O 9.5µL Total volume 25 µL

[0048] Table 4. PCR reaction conditions

[0049] PCR steps PCR conditions Pre-denaturation denaturation 98 ℃, 3 min 98 ℃, 30 s annealing 58 ℃, 30 s (denaturation, annealing; 30 batches cycled) Extended low-temperature preservation 72 ℃, 1 min 4℃, forever

[0050] (2) The above PCR products were examined by gel electrophoresis. Then, 1 μL of Dpn I restriction endonuclease was added to 20 μL of PCR products to digest the template plasmid, and the product was incubated at 37°C for 1 h.

[0051] (3) Take 5 μL of the product from (2) and transform it into Escherichia coli BL21 (DE3) to obtain the corresponding recombinant Escherichia coli. Spread it on LB agar plates containing chloramphenicol (50 mg / L) and incubate overnight at 37°C. Randomly select clones for colony PCR identification and sequencing verification. The results showed that the recombinant expression vector containing the gene encoding the inositol dehydrogenase mutant was successfully transformed into the expression host Escherichia coli BL21 (DE3). The strain that successfully mutated, as verified by sequencing by Beijing Qingke Biotechnology Co., Ltd., is the recombinant strain containing the mutant, named Q122V / D187Y.

[0052] Example 3: Induction of Recombinant Strains and Cell Preparation

[0053] Single colonies of the recombinant mutant Q122V / D187Y constructed in Example 2 were picked and inoculated into 10 mL of LB medium (containing 50 mg / L chloramphenicol). The culture was incubated overnight at 37 °C with shaking. The next day, a 1% inoculum was transferred to 50 mL of LB medium (containing 50 mg / L chloramphenicol) and incubated at 37 °C for 2–3 h. Then, 0.5 mM IPTG was added and the cells were induced at 25 °C for 12–24 h. Cells were collected by centrifugation at 8000 rpm for 10 min at 4 °C for subsequent reactions.

[0054] Example 4: Optimized reaction for whole-cell catalytic conversion of D-chiral inositol

[0055] The catalytic reaction was carried out using Q122V / D187Y cells collected in Example 3. A 5 ml system included: 200 g / L muscle inositol, 50 mM HEPES buffer, and after dissolution, the pH was adjusted to 7.0 with sodium hydroxide. 100 g / L of cells were added, and the reaction was carried out at 45°C and 200 rpm for 12 h. A sample was taken, and the reaction was terminated by centrifugation. The product was detected by HPLC.

[0056] HPLC detection conditions: Column: amino column (4.6×150 mm, 3.5 μm); Mobile phase: 80% acetonitrile: 20% water; Flow rate: 2 mL / min isocratic elution; Column temperature: 40℃; Injection volume: 10 μL; Detector: differential detector.

[0057] Table 5. Catalytic results in shake flasks

[0058] strain wild type mutant Q122V / D187Y DCI yield (g / L) 16 20.3

[0059] The results are shown in Table 5. The yield of the mutant was increased by 26.88% compared with the wild type.

[0060] The wild type refers to Escherichia coli containing the original nucleotide sequences of the iolG and iolI genes derived from Bacillus subtilis.

[0061] Example 5: Optimization of enzyme production on a 5L fermenter scale and whole-cell catalysis process

[0062] 1. Preparation of whole-cell catalysts

[0063] (1) Primary seed culture: Pick one single colony of Q122V / D187Y from the plate and place it in 5 mL of LB liquid medium (containing 50 mg / L chloramphenicol), and incubate at 37℃ and 180 rpm for 8-12 h.

[0064] (2) Secondary seed culture: The mutant Q122V / D187Y was inoculated into 200 mL LB (containing 50 mg / L chloramphenicol) at a ratio of 1‰ (v / v) and cultured at 37℃ and 200 rpm for 10 h.

[0065] (3) Fermentation in a fermenter: Freshly cultured secondary seed culture was inoculated into a fermentation medium containing 0.05% antifoaming agent and 50 mg / L chloramphenicol at a volume concentration of 5%. The temperature was controlled at 37℃, and the dissolved oxygen (DO) was controlled to be greater than 20%. The fermentation pH was controlled at 6.5 using 25% ammonia. When the OD600 reached about 10, dissolved oxygen was monitored. When the dissolved oxygen rose rapidly (to 70), sugar was added, and automatic feeding of 6 g / L was started. When the OD600 reached 20, the fermenter temperature was adjusted to 25℃. After cooling, the sugar addition rate was reduced, and 0.5 M IPTG was added for induction. The culture was continued for 18 h to obtain the fermentation broth. Cells were collected by centrifugation at 8000 rpm for 10 min for subsequent reactions.

[0066] 2. Whole-cell catalysts for the biotransformation of DCI

[0067] The catalytic reaction was carried out using the cells collected above. The 3 L system included: 200 g / L muscle inositol, 50 mM HEPES buffer, pH adjusted to 7.0 with sodium hydroxide after dissolution, 100 g / L cells added, and reacted at 45°C and 200 rpm for 4 h. The reaction was then stopped by centrifugation after sampling. The product was detected by HPLC. Figure 2 The concentration of DCI produced by catalysis was 24.1 g / L, and the production rate was 6.025 g / L / h.

[0068] The choice of host cell is not limited to *Escherichia coli*, but can also include other suitable prokaryotic or eukaryotic cell systems to adapt to different production needs and conditions. By using the Q122V / D187Y mutant of this invention, industry can produce DCI more efficiently and rapidly, thereby meeting the growing market demand for DCI, especially in the functional food sector.

[0069] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A recombinant plasmid, characterized in that, The recombinant plasmid contains the inositol dehydrogenase mutant Q122V / D187Y gene and the inositol isomerase gene; the nucleotide sequence of the inositol dehydrogenase mutant Q122V / D187Y is shown in SEQ ID NO.1; the inositol isomerase is iolI, and its nucleotide sequence is shown in SEQ ID NO.

2.

2. A method for preparing D-chiral inositol, characterized in that, Recombinant cells containing the recombinant plasmid of claim 1 catalyze the production of D-chiral inositol from muscle inositol.

3. The use of the recombinant plasmid according to claim 1 in the production of D-chiral inositol or products containing D-chiral inositol.

Citation Information

Patent Citations

  • Method for efficiently synthesizing epiinositol by using heat-resistant myo-inositol dehydrogenase mutant cascade system

    CN119799803A

  • Method for efficiently synthesizing epiinositol through double-enzyme cascade catalysis of myo-inositol

    CN119842646A